Presence Of Betasatellite Research Articles

Cotton leaf curl Multan betasatellite impaired ToLCNDV ability to maintain cotton leaf curl Multan alphasatellite.

Alphasatellites (family Alphasatellitidae) are circular, single-stranded (ss) DNA molecules of ~1350 nucleotide in size that have been characterized in both the Old and New Worlds. Alphasatellites have inherent ability to self-replicate, which is accomplished by a single protein, replication-associated protein (Rep). Although the precise function of alphasatellite is yet unknown, and these consider dispensable for infectivity, however, their Rep protein functions as a suppressor of host defence. While alphasatellites are most frequently associated with begomoviruses, particularly with monopartite than bipartite begomoviruses, they have recently been found associated with mastreviruses. The in planta maintenance of alphasatellites by helper geminivirus is still an enigma, with no available study on the topic. This study aimed to investigate whether a widely distributed bipartite begomovirus, tomato leaf curl New Delhi virus (ToLCNDV), can maintain cotton leaf curl Multan alphasatellite (CLCuMuA) in the presence or absence of cotton leaf curl Multan betasatellite (CLCuMuB). The findings of this study demonstrated that ToLCNDV or its DNA A could maintain CLCuMuA in Nicotiana benthamiana plants. However, the presence of CLCuMuB interferes with the maintenance of CLCuMuA, and mutations in the CP of ToLCNDV further reduces it. Our study highlighted that the maintenance of alphasatellites is impaired in the presence of a betasatellite by ToLCNDV. Further investigation is needed to unravel all the interactions between a helper virus and an alphasatellites.

Occurrence and molecular detection of bipartite begomovirus on tomato in Southern India

Begomoviruses are major constraint in tomato production across the world. In India, tomato production is affected by both monopartite and bipartite begomoviruses. Monopartite were reported to infect tomato crop across India. However, bipartite were reported to infect tomato in Nothern India. In the current study, seventy begomovirus symptomatic tomato samples were collected from southernstates of India and analysed using PCR-based specific primer. The analysis revealed that 45 of them were monopartite, 23 of them were bipartite and 8 bipartite also showed the presence of betasatellite. This is the first report of bipartite begomovirus infecting tomato in Southern India.

Natural infection of croton yellow vein mosaic virus and its cognate betasatellite in germplasm of different Crambe spp in India

Crambe is an important crop grown worldwide for industrial oil and seed meal. Besides the fungal and bacterial diseases, the crop is reported to be infected by tobacco mosaic virus, beet western yellows virus and turnip mosaic virus under experimental condition. Till now, there was no report of natural infection of any begomovirus in this crop. In the present study, a leaf curl disease was observed in germplasm accessions of three species of Crambe (C. abyssinica, C. glabrata and C. hispanica). Based on the symptoms and presence of whitefly population in the field, begomovirus infection was suspected. Molecular characterization through RCA approach, indicated presence of croton yellow vein mosaic virus (CYVMV, KJ747958) and croton yellow vein mosaic betasatellite (CroYVMB, KM229762). Co-agroinoculation of partial dimeric construct of CYVMV with complete dimeric construct of CroYVMB, produced typical leaf curl symptoms in C. abyssinica, whereas, agroinoculation of partial dimeric construct of CYVMV alone could not produce symptoms in the same plant. In contrast, the CYVMV construct alone could produce symptom in Nicotiana benthamiana, a model host for plant virus studies. In N. benthamiana co-inoculation of CroYVMV with CYVMV construct develop more severe symptoms. However, neither the CYVMV construct alone nor the co-inoculation with CroYVMB produce any symptom in Arabidopsis thaliana even with different methods of inoculation. Inoculated Arabidopsis thaliana also did not yield any amplification of the virus as assessed through PCR and rolling circle amplification (RCA). Thus it confirmed that for successful infection in crambe, CYVMV requires betasatellite, while in N. benthamiana, it does not require betasatellite for symptom induction and in Arabidopsis thaliana CYVMV alone or in presence of betasatellite did not replicate and produce any symptom. This study constitutes the first confirmed record of natural infection of a begomovirus in crambe and further confirmed that cognate betasatellite of CYVMV has differential role in infectivity in different hosts.

Functional characterization of βC1 gene of Cotton leaf curl Multan betasatellite

Whitefly-transmitted Begomoviruses having circular single stranded DNA genome cause severe leaf curl diseases in the tropical and subtropical region. The majority of Old World monopartite begomoviruses with DNA A component is associated with a satellite DNA of 1.3kb length referred to as betasatellites. The presence of betasatellite is required to express typical symptoms in the primary hosts. Increased symptom expression in betasatellite's presence is attributed to a 13-15kDa βC1 protein encoded by the βC1 gene on complementary sense strand. The exact mechanism by which the βC1 protein contributes to the symptoms' severity and helper viral DNA's accumulation is not yet understood. Here, we studied the βC1 protein of Cotton leaf curl Multan betasatellite, associated with mono and bipartite begomoviruses. The βC1 protein was expressed in prokaryotic system as 6XHis-βC1 fusion protein and recombinant protein showed size- and sequence-specific DNA binding activity. The host proteins which may interact with βC1 were identified by binding βC1 recombinant protein with heptapeptide in phage display library. The βC1-interacting host proteins predicted belong to metabolic and defense pathways, indicating that βC1 protein has a pivotal role in viral pathogenicity.

A Severe Leaf Curl Disease on Chilies in Pakistan is Associated with Multiple Begomovirus Components.

Chili leaf curl disease is an important limiting factor for chilies in the Indian subcontinent and is associated with begomoviruses (2,3). Field visits of commercially grown chilies in 2007 and 2008 identified a very severe leaf curl disease with 100% incidence and severe yield losses at several locations in Faisalabad District, Punjab, Pakistan. Symptoms of the disease were severe leaf curl with cup-shaped, upward curling, yellowing, and stunted plant growth. To identify the causative agent, symptomatic plant samples were collected from 10 locations and total DNA was extracted with a cetyltrimethylammoniumbromide method. Universal primers that amplify begomovirus DNA A, Begomo F (ACGCGT GCCGTGCTGCTGCCCCCATTGTCC) and Begomo R (ACGCGT ATGGGCTGYCGAAGTTSAGAC), were used in PCR. A PCR product of the expected size (approximately 2.8 kb) was amplified from all symptomatic plants, and no amplification products of the expected size were obtained from healthy or asymptomatic plants, confirming the association of a begomovirus with the disease. When used as a probe in Southern hybridization, a full-length clone of Cotton leaf curl Multan virus detected characteristic viral DNA forms and further confirmed the association of begomovirus with the disease. To identify the begomovirus associated with the disease at the species level, the PCR product obtained with universal primers was cloned into a TA cloning vector and five clones were partially sequenced. Comparison of the DNA sequence of the coat protein gene of clones resulted in identification of two begomovirus species; the first clone (GenBank Accession No. FN179278) showed 94% DNA sequence identity with the bipartite virus Tomato leaf curl New Delhi virus (ToLCNDV), while the second clone (GenBank Accession No. FN252382) showed 97% sequence identity with the monopartite begomovirus Chili leaf curl Multan virus (ChLCMV). Rolling circle amplification was used to clone the DNA B of ToLCNDV from samples showing typical chili leaf curl disease symptoms. Sequence analysis of the DNA B clone (GenBank Accession No. FN179276) in the intergenic region and movement protein gene showed 94% identity with ToLCNDV DNA B. To confirm association of betasatellite with the disease, universal primers (β-01 and β-02) were used for the amplification of betasatellite by PCR (1). DNA sequence analysis of betasatellite (GenBank Accession No. FN179279) associated with the disease showed 90% identity with the previously cloned chili leaf curl betasatellite (1). No evidence for the association of alphasatellite with the disease was found. The multiple infection of a begomovirus complex, consisting of a monopartite virus with a bipartite begomovirus where DNA B is maintained in the presence of betasatellite, presents yet another example of rapid changes in begomovirus complexes that infect important crops in the region. The appearance of chili leaf curl disease at a higher incidence and symptom severity may be attributed to the synergistic action of geminivirus disease complex comprising a monopartite and a bipartite begomovirus along with DNA betasatellite. High yield losses resulting from this severe disease threatens chili cultivation in the area and is forcing farmers to grow other crops.