Potato Spindle Tuber Viroid Isolates Research Articles

Infectivity of highly pathogenic isolates of potato spindle tuber viroid in dahlia

Dahlias that are naturally infected with potato spindle tuber viroid (PSTVd) do not exhibit symptoms. Therefore, if PSTVd isolates that are highly pathogenic in tomato plants infect dahlias, there is a significant risk of PSTVd infecting other plants via dahlias. In this study, we found that almost all highly pathogenic isolates were able to infect dahlia plants, but the symptoms varied depending on the cultivar. When mixed inocula composed of dahlia isolates and highly pathogenic isolates were tested, the dahlia isolates dominantly infected dahlia plants; however, the highly pathogenic isolates also coinfected plants. Our results also suggest that seed or pollen transmission from infected dahlia plants does not occur.

A universal probe for simultaneous detection of six pospiviroids and natural infection of potato spindle tuber viroid (PSTVd) in tomato in China

Several viroid species in the genus Pospiviroid can infect tomato (Solanum lycopersicum) and cause severe diseases, posing a serious threat to tomato production. For simultaneous detection of six tomato-infecting pospiviroids–columnea latent viroid (CLVd), pepper chat fruit viroid (PCFVd), potato spindle tuber viroid (PSTVd), tomato apical stunt viroid (TASVd), tomato chlorotic dwarf viroid (TCDVd), and tomato planta macho viroid (TPMVd)–we developed a universal probe based on a highly conserved 61 nt long sequence shared among them. Compared with their specific probes, the universal probe had a similar, though slightly reduced, detection sensitivity and has the advantages of simple and cost-effective preparation and simultaneous detection of the six pospiviroids. In addition, the universal probe was used in dot-blot hybridization assays for a large-scale survey of viroid(s) in tomato plantings in China. Only PSTVd was detected in a few greenhouse-planted tomato plants. Sequence analysis revealed that these tomato PSTVd isolates may have been introduced from tomato seeds imported from abroad.

Comparison of two highly sensitive methods to detect potato spindle tuber viroid in Dahlia using quantitative-reverse transcription-polymerase chain reaction assays

Potato spindle tuber viroid (PSTVd) belongs to the Pospiviroidae family and is the type species for the genus Pospiviroid. In 2011, PSTVd was first detected in dahlias in Japan. Since that time, unregistered PSTVd isolates have been identified in seven field-grown dahlia cultivars. None of the infected dahlias showed disease symptoms during the early stages of infection, however, growth suppression occasionally occurred during later stages. Therefore, in dahlia, diagnosing PSTVd by the external appearance of plants is difficult, and the threat of new PSTVd isolates spreading to other susceptible hosts still remains. In this study, we developed an efficient inspection method using several dahlia plant tissues and organs including dried bulbs. This developed method will be useful for inspecting seedlings to prevent the invasion of PSTVd at the border.

First report of Potato spindle tuber viroid infecting tree tomato in Kenya in mixed infection with Potato virus Y

First report of <i>Potato spindle tuber viroid</i> infecting tree tomato in Kenya in mixed infection with <i>Potato virus Y</i>

Rasta Disease of Tomato in Ghana is Caused by the Pospiviroids Potato spindle tuber viroid and Tomato apical stunt viroid.

Rasta is a virus-like disease of unknown etiology affecting tomato (Solanum lycopersicum) plants in Ghana. Symptoms include stunting; epinasty, crumpling, and chlorosis of leaves; and necrosis of leaf veins, petioles, and stems. Leaf samples with rasta symptoms were collected from commercial tomato fields in Ghana in October 2012 and applied to FTA cards, and RNA extracts were prepared. Reverse-transcription polymerase chain reaction (RT-PCR) tests with primers for Columnea latent viroid, which causes rasta-like symptoms in tomato plants in Mali, were negative, whereas tests with degenerate viroid primer pairs were inconclusive. However, tomato seedlings (Early Pak 7) mechanically inoculated with RNA extracts of 10 of 13 samples developed rasta-like symptoms. In RT-PCR tests with RNA from leaves of the 10 symptomatic seedlings and primers for Potato spindle tuber viroid (PSTVd) or Tomato apical stunt viroid (TASVd), the expected size (approximately 360 bp) of DNA fragment was amplified from eight and two seedlings, respectively. Sequence analyses confirmed that these fragments were from PSTVd and TASVd isolates, and revealed a single PSTVd haplotype and two TASVd haplotypes. The PSTVd and TASVd isolates from Ghana had high nucleotide identities (>94%) with isolates from other geographic regions. In a host range study, PSTVd and TASVd isolates from Ghana induced rasta symptoms in the highly susceptible tomato cultivar Early Pak 7 and mild or no symptoms in Glamour, and symptomless infections in a number of other solanaceous species. PSTVd and TASVd isolates were seed associated and possibly seed transmitted.

Molecular characterization and eradication of new potato spindle tuber viroid isolates from dahlia plants in Japan

Recently, the distribution of seeds and seedlings has expanded worldwide due to the internationalization of agricultural products. Quarantine-notifiable plant pathogens including viroids are therefore spreading globally, which is a major concern in terms of plant protection. Viroids are the smallest known plant pathogen and have a large host range, causing various disease symptoms after infection. In 2011, the Potato spindle tuber viroid (PSTVd), belonging to the Pospiviroid family, was detected in Akita Prefecture (North Japan). By 2015, unregistered PSTVd isolates had been identified in seven dahlia cultivars (a total of about 5000 plants) when leaves were surveyed in the fields where PSTVd was first detected. The newly discovered PSTVd isolates are very similar to a PSTVd dahlia isolate that was found previously in Japan. None of the infected dahlias showed disease symptoms during the early stages of infection, however, growth suppression occasionally occurred during later stages. At present, PSTVd appears to have been successfully eradicated from Akita prefecture, but the threat of new PSTVd isolates spreading to other susceptible hosts, such as tomatoes and potatoes, still remains.

Occurrence and molecular characterization of Potato spindle tuber viroid (PSTVd) isolates from potato plants in North China

AbstractChina is the largest potato producing country worldwide, with this crop representing the fourth largest staple food crop in China. However, the steady presence of Potato spindle tuber viroid (PSTVd) over the past five decades has a significant economic impact on potato production. To determine why PSTVd control measures have been ineffective in China, more than 1 000 seed potatoes collected between 2009 and 2014 were subjected to PSTVd detection at the Supervision and Testing Center for Virus-free Seed Potatoes Quality, Ministry of Agriculture, China. A high PSTVd infection rate (6.5%) was detected among these commercial seed potatoes. Some breeding lines of potato collected from 2012 to 2015 were also tested for PSTVd infection, revealing a high rate of PSTVd contamination in these potato propagation materials. Furthermore, comparison of the full-length sequences of 71 different Chinese PSTVd isolates revealed a total of 74 predominant PSTVd variants, which represented 42 different sequence variants of PSTVd. Comparative sequence analysis revealed 30 novel PSTVd sequence variants specific to China. Comprehensive phylogenetic analysis uncovered a close relationship between the Chinese PSTVd sequence variants and those isolated from Russia. It is worth noting that three intermediate strains and six mild strains were identified among these variants. These results have important implications for explaining the ineffective control of PSTVd in China and thus could serve as a basic reference for designing more effective measures to eliminate PSTVd from China in the future.

Potato spindle tuber viroid: alternative host reservoirs and strain found in a remote subtropical irrigation area

During 2007–2012, Potato spindle tuber viroid (PSTVd) was detected in volunteer cultivated, wild and native plants during studies to determine whether Pospiviroids occur within the isolated, sub-tropical, Gascoyne Horticultural District (GHD) in central coastal Western Australia (WA). PSTVd was detected infecting volunteer crop plants of tomato, pepper and chilli; introduced weed species Solanum nigrum (blackberry nightshade), Datura leichhardtii (thornapple) and Nicandra physalodes (apple-of-Peru) (Solanaceae), and Conyza bonariensis (flaxleaf fleabane) (Asteraceae); and Australian native species Atriplex semilunaris (annual saltbush), Rhagodia eremaea (thorny saltbush) (Chenopodiaceae), and Streptoglossa sp. (Asteraceae). PSTVd was also detected infecting Physalis angulata (wild gooseberry) in the Ord River Irrigation Area (ORIA), Kimberley region in north-west WA. Comparison of sequences from the three complete and 18 partial RNA nucleotide sequences obtained from 20 GHD and one ORIA isolates with those of published sequences showed that their highest nucleotide sequence identities were to isolate AY962324 belonging to the Chittering strain from south-west WA. On phylogenetic analysis, the three completely sequenced GHD PSTVd isolates grouped within a cluster of isolates from tomato and P. peruviana. These results show that a naturally occurring PSTVd inoculum reservoir is present in the GHD. This reservoir explains the occurrence of repeated PSTVd infections in different years in field crops of tomato, pepper and chilli growing in its market gardens and small farms. These findings have implications concerning PSTVd spread in intensive solanaceous crop field production systems in other subtropical regions of the world.

First Report of Potato spindle tuber viroid Naturally Infecting Field Tomatoes in the Dominican Republic.

In recent years, viroid disease outbreaks have resulted in serious economic losses to a number of tomato growers in North America (1,2,3). At least three pospiviroids have been identified as the causal agents of tomato disease, including Potato spindle tuber viroid (PSTVd), Tomato chlorotic dwarf viroid (TCDVd), and Mexican papita viroid (MPVd). In the spring of 2013, a severe disease outbreak with virus-like symptoms (chlorosis and plant stunting) was observed in a tomato field located in the Dominican Republic, whose tomato production is generally exported to the United States in the winter months. The transplants were produced in house. The disease has reached an epidemic level with many diseased plants pulled and disposed of accordingly. Three samples collected in May of 2013 were screened by ELISA against 16 common tomato viruses (Alfalfa mosaic virus, Cucumber mosaic virus, Impatiens necrotic spot virus, Pepino mosaic virus, Potato virus X, Potato virus Y, Tobacco etch virus, Tobacco mosaic virus, Tobacco ringspot virus, Tomato aspermy virus, Tomato bushy stunt virus, Tomato mosaic virus, Tomato ringspot virus, Tomato spotted wilt virus, Groundnut ringspot virus, and Tomato chlorotic spot virus), a virus group (Potyvirus group), three bacteria (Clavibacter michiganensis subsp. michiganensis, Pectobacterium atrosepticum, and Xanthomonas spp.), and Phytophthora spp. No positive result was observed, despite the presence of symptoms typical of a viral-like disease. Further analysis by RT-PCR using Agdia's proprietary pospiviroid group-specific primer resulted in positive reactions in all three samples. To determine which species of pospiviroid was present in these tomato samples, full-genomic products of the expected size (~360 bp) were amplified by RT-PCR using specific primers for PSTVd (4) and cloned using TOPO-TA cloning kit (Invitrogen, CA). A total of 8 to 10 clones from each isolate were selected for sequencing. Sequences from each clone were nearly identical and the predominant sequence DR13-01 was deposited in GenBank (Accession No. KF683200). BLASTn searches into the NCBI database demonstrated that isolate DR13-01 shared 97% sequence identity to PSTVd isolates identified in wild Solanum (U51895), cape gooseberry (EU862231), or pepper (AY532803), and 96% identity to the tomato-infecting PSTVd isolate from the United States (JX280944). The relatively lower genome sequence identity (96%) to the tomato-infecting PSTVd isolate in the United States (JX280944) suggests that PSTVd from the Dominican Republic was likely introduced from a different source, although the exact source that resulted in the current disease outbreak remains unknown. It may be the result of an inadvertent introduction of contaminated tomato seed lots or simply from local wild plants. Further investigation is necessary to determine the likely source and route of introduction of PSTVd identified in the current epidemic. Thus, proper control measures could be recommended for disease management. The detection of this viroid disease outbreak in the Dominican Republic represents further geographic expansion of the viroid disease in tomatoes beyond North America.

First Reports of Potato spindle tuber viroid on Solanum jasminoides and of Tomato apical stunt viroid on Solanum rantonnetti in Poland.

Potato spindle tuber viroid (PSTVd) has a quarantine status in the EU whereas Tomato apical stunt viroid (TASVd) is listed in the EPPO Alert list. During 2007 to 2012 surveys for the presence of PSTVd in 299 ornamental plants of the family Solanaceae (including Solanum jasminoides, S. rantonnetti, Brugmansia sp. and Petunia sp.) were carried out in Poland. The availability of a Pospiviroid genus-specific primer pair (1), which allows for the detection of the most prevalent viroids in ornamental plants by RT-PCR, has facilitated surveys of ornamental plants for pospiviroids. Fifteen S. rantonnetti and twenty-one S. jasminoides plants were sampled randomly and tested. Samples originated from seven different Polish provinces. Total RNA extraction was performed from plant leaves using Master Pure RNA Purification Kit (Epicentre). The obtained RNAs were further used for RT-PCR amplification using SuperScript One-Step RT-PCR System with PlatinumTaq DNA Polymerase (Invitrogen) kit according to the manufacturer's instructions. The Pospiviroid genus-specific primer set Vir1 5'CTTCAGTTGTTTCCACCGGGTAG 3' /Vir2 5'TTCCTGTGGTGCACTCCTGACC 3' (1), was used to amplify a 262-bp RT-PCR product. In addition, three positive samples were tested using PSTVd specific primers 3H1 5' ATCCCCGGGGAAACCTGGAGCGAAC3' /2H1 5'CCCTGAAGCGCTCCTCCGAG 3' (2,4) that amplified the 360-bp product. The presence of RT-PCR products of the expected size was confirmed in two S. jasminoides samples using both primer pairs. One positive sample of S. jasminoides in the testing season 2007/2008 was collected in Zachodniopomorskie Province. The second sample was collected in 2009 in the Lubuskie region. The obtained products were cloned into pGEM-Teasy vector and sequenced using M13F and M13R primers. The sequence comparison using MEGA5 software (3) revealed that both isolates were identical to each other and shared 98 to 100% sequence identity with other PSTVd isolates described to date. The obtained sequence was deposited in the GenBank database (Accession No. KC707563). In addition, in 20 samples of Solanaceae spp. collected in 2012, the presence of an RT-PCR product of 262 bp, typical for Pospiviroids, was shown in one sample of S. rantonnetti collected in Lubuskie Province. Sequencing of the PCR product identified TASVd, and the sequence has been deposited in GenBank (KC707564). Sap derived from PSTVd- and TASVd-positive samples was used to mechanically inoculate tomato plants (variety Moneymaker). In total, 25 plants were inoculated with PSTVd and 25 with TASVd. After 3 weeks, most of the tomato plants displayed growth reduction and distortion. Inoculated tomato plants were sampled and tested by RT-PCR for the presence of viroids and all obtained products were subjected to sequencing. The obtained sequences were identical with original ones. The viroids detected in the two Solanum sp. appeared to be efficiently transmitted to tomato, as 80% of the inoculated plants tested positive by RT-PCR. These results suggest that ornamental plants might act as a source of inocula for tomato or potato crops even if they do not display any visible symptoms. TASVd-infected S. rantonnetti was introduced to Poland from the Netherlands, while the origin of the PSTVd positive S. jasminoides is uncertain. Official eradication measures were imposed due to the detection of viroids in ornamental plants in Poland.

Molecular properties of potato spindle tuber viroid (PSTVd) isolates of the Russian Research Institute of Phytopathology

The complete nucleotide sequences of more than 100 isolates of Potato spindle tuber viroid (PSTVd) collected from locations in the territory of Russia and the former USSR have been determined. These sequences represent 43 individual sequence variants, each containing 1–10 mutations with respect to the “intermediate” or type strain of PSTVd (GenBank Acc. No. V01465). Isolates containing 2–5 mutations were the most common, and 24 sequence variants are described here for the first time. Twenty one isolates contained a mutation found only in Russian and Ukrainian isolates of PSTVd up till now; i.e., replacement of the adenine at position 121 with cytosine (A121C). Many of these isolates contained two mutations—deletion of one of three adenine residues occupying positions 118–120 plus replacement of the adenine at position 121 with either uracil or cytosine (−A120, A121U/C). Both combinations of mutations were phenotypically neutral, i.e. symptom expression in Rutgers tomato was unaffected. Phylogenetic analysis of the sequences of different PSTVd isolates presented in work together with sequences of other naturally-occurring isolates obtained from Internet databases suggesting that known PSTVd isolates may be divided into four groups: (i) a group of isolates from potato and ornamentals where the type strain of PSTVd (PSTVd.018) may be considered to represent the ancestral sequence, (ii) a second group of isolates from potato and ornamentals where PSTVd.123 play the same role as PSTVd.018 for the first group, and iii) a group of potato isolates where PSTVd.125 is a possible ancestral sequence. The fourth and most divergent group of PSTVd isolates differs significantly from these first three groups. The majority of isolates in this group originate from New Zealand and Australia and infect different solanaceous hosts (tomato, pepper, cape gooseberry, potato, and others).

Fast real‐time detection of Potato spindle tuber viroid by RT‐LAMP

This paper reports the development of a single tube, real‐time, reverse transcription loop‐mediated isothermal amplification (RT‐LAMP) assay for detecting Potato spindle tuber viroid (PSTVd), one of the quarantine pathogens of potato in Europe and North America. The method enables detection of a broad range of PSTVd isolates, and is about 10 times more sensitive than the conventional reverse transcription polymerase chain reaction (RT‐PCR) assay. Its benefits are not only its speed (15–25 min to obtain results) and cost effectiveness (resulting from time saved as well as cheaper consumables), but also its demonstrated ability to be performed in the field, using portable instruments.

Comparison of direct-RT-PCR and dot-blot hybridization for the detection of Potato spindle tuber viroid in natural host plant species

Potato spindle tuber viroid (PSTVd) is an EPPO A2-listed quarantine pathogen and its detection in large scale surveys requires complex decision schemes. In this study, a simple and rapid application of direct-RT-PCR was evaluated together with dot blot hybridization for the detection of PSTVd in dormant potato tubers harvested from primary infected plants, as well as in tomato and solanaceous ornamental plants. In all infected dormant potato tubers tested, both direct-RT-PCR and dot blot hybridization detected two different PSTVd isolates, with direct-RT-PCR being ten times more sensitive than dot blot. Similarly, in infected tomato and Brugmansia spp., PSTVd was detected by direct-RT-PCR with higher sensitivity compared to that of dot blot hybridization. However, in Brugmansia spp., a ten-fold decrease of the typical working concentration of the sap was required for an unequivocal detection of the viroid by direct-RT-PCR. The potential to use direct-RT-PCR for routine PSTVd examination is discussed.

A Three-Dimensional RNA Motif inPotato spindle tuber viroidMediates Trafficking from Palisade Mesophyll to Spongy Mesophyll inNicotiana benthamiana

Cell-to-cell trafficking of RNA is an emerging biological principle that integrates systemic gene regulation, viral infection, antiviral response, and cell-to-cell communication. A key mechanistic question is how an RNA is specifically selected for trafficking from one type of cell into another type. Here, we report the identification of an RNA motif in Potato spindle tuber viroid (PSTVd) required for trafficking from palisade mesophyll to spongy mesophyll in Nicotiana benthamiana leaves. This motif, called loop 6, has the sequence 5'-CGA-3'...5'-GAC-3' flanked on both sides by cis Watson-Crick G/C and G/U wobble base pairs. We present a three-dimensional (3D) structural model of loop 6 that specifies all non-Watson-Crick base pair interactions, derived by isostericity-based sequence comparisons with 3D RNA motifs from the RNA x-ray crystal structure database. The model is supported by available chemical modification patterns, natural sequence conservation/variations in PSTVd isolates and related species, and functional characterization of all possible mutants for each of the loop 6 base pairs. Our findings and approaches have broad implications for studying the 3D RNA structural motifs mediating trafficking of diverse RNA species across specific cellular boundaries and for studying the structure-function relationships of RNA motifs in other biological processes.

First Report of Natural Infection of Greenhouse Tomatoes by Potato spindle tuber viroid in the United States.

In April 2009, a large number of tomato plants (Solanum lycopersicum L.) grown in a commercial greenhouse facility near Los Angles, CA exhibited general plant stunting (short internodes) and foliar symptoms that included distortion, chlorosis, and scattered necrotic spotting. Over time, the leaves began to exhibit a purple color and curling. Diseased plants were often elongated and frail with spindly shoots. The disease resulted in a significant yield loss due to reduced fruit size. Disease symptoms described above are generally different from those of Pepino mosaic virus (PepMV) infection, which causes yellow mosaic or patches on leaves and marbling of fruits. The disease was initially localized in certain areas in a greenhouse despite using a number of cultural management efforts including vigorous scouting, roguing of diseased plants, and strict hygiene and cleaning practices. The disease was also observed in neighboring greenhouses by the spring of 2010. A standard panel of tests for common tomato viruses and viroids were conducted using the appropriate serological or PCR assays. Reverse transcription (RT) PCR analysis of nine symptomatic plants with pospiviroid-specific primers, Pospil-RE and Pospil-FW (3), produced an amplicon of the expected size (~196 bp) while three healthy looking tomato plants did not. Subsequently, full viroid genomic sequences were obtained through RT-PCR with primer sets specific for Potato spindle tuber viroid (PSTVd), 3H1/2H1 (2), as well as for the pospiviroid genus, MTTVd-F and MTTVd-R (1). Sequences obtained from direct sequencing of amplicons or cloned PCR products from one isolate were identical and consisted of a full viroid genome of 358 nt, which was named PSTVd-CA1 (GenBank Accession No. HM753555). BLASTn queries of the NCBI database showed that this isolate had a high sequence identity (98%) to other PSTVd isolates (i.e., EF044304, X52037, and Y09577). The disease was reproducible upon mechanical transmission (1) on three tomato 'Moneymaker' plants, which expressed symptoms that were similar to those on the source plants. Recovery of PSTVd on the inoculated tomato plants was confirmed by RT-PCR and sequencing. Because of its susceptibility to viroid infection, tomato 'Moneymaker' plants are commonly used as indicators for the study of pospiviroids, including PSTVd. Natural PSTVd infection on greenhouse tomatoes has been reported in Europe (3) and New Zealand. Although a number of reports in the United States have been published on naturally occurring PSTVd infections of potatoes, to our knowledge, this is the first report of a natural PSTVd infection on tomatoes in the United States. The exact source of the PSTVd inoculum in the current disease outbreak is unknown, but it could have been introduced from infected potato or ornamental plants (4) or through infected tomato seeds. The disease epidemic might have been enhanced by frequent hands-on activities in greenhouse tomato production and the environmental conditions (high temperature and intense lighting) in the greenhouse that favor symptom expression.

Epidemiological evidence that vegetatively propagated, solanaceous plant species act as sources ofPotato spindle tuber viroidinoculum for tomato

In autumn 2006 in the Netherlands,Potato spindle tuber viroid(PSTVd) infections were detected in 42·3 and 71·9% of professionally grown lots ofBrugmansiaspp. andSolanum jasminoidesrespectively. The infected lots contained 73 985 and 431 374 plants, respectively, demonstrating the presence of many potential viroid sources for tomato (Solanum lycopersicum). PSTVd was identified in cultivars ofBrugmansia × candida,B. × flava,B. sanguinea,B. suaveolensand unspecifiedBrugmansiaspecies/cultivars. Most infected lots ofBrugmansiaspp. originated from a single Dutch nursery; most infected lots ofS. jasminoidesoriginated abroad. Sequence analysis revealed that the PSTVd genomes fromBrugmansiaspp. contained an average of 360 nt, whereas all genomes fromS. jasminoidesexcept one consisted of 357 nt. Furthermore, the collective PSTVd genotypes showed polymorphism at four or more positions, except for two cases in which genotypes fromBrugmansiaspp. andS. jasminoideswere identical. Phylogenetic studies showed that PSTVd genotypes fromBrugmansiaspp. andS. jasminoidesgrouped apart from each other and from PSTVd isolates from potato (Solanum tuberosum) andPhysalis peruviana. The PSTVd genotypes from tomato did not form a separate cluster, but were dispersed over clusters of vegetatively or partly vegetatively propagated plant species, i.e. potato,P. peruvianaandS. jasminoides. Moreover, mechanical inoculation of the predominant PSTVd genotypes fromS. jasminoidesto tomato was successful. These results provide evidence that vegetatively propagated, solanaceous plant species have been sources of infection for tomato crops in the past.

Russian Isolates of Potato spindle tuber viroid Exhibit Low Sequence Diversity.

Potato spindle tuber viroid (PSTVd) is currently widespread in seed potatoes grown in Russia. Characterization of 39 PSTVd isolates collected over a 15-year period from widely separated areas in Russia revealed the presence of 17 different sequence variants, all but one of which were previously unknown. Most variants were recovered only once, but two were more widely distributed; one of these was a mild variant previously isolated in Germany, the second was a novel variant inducing symptoms similar to those of the type strain in tomato. Despite this apparent lack of population diversity, several informative PSTVd variants were recovered. Sequence changes in the pathogenicity and variable domains were particularly common, but previously unknown changes were also detected within the loop E motif in the central domain, a structural motif known to play a key role in PSTVd replication and host range determination.

Streptosolen jamesonii‘Yellow’, a new host plant of Potato spindle tuber viroid

Recent identification of Potato spindle tuber viroid (PSTVd) in various solanaceous ornamental plants in the Netherlands (Verhoeven et al., 2008) has drawn attention to the phytosanitary risks posed by imported mother plants. In this context, one leaf per plant from a total of 100 and 200 plants of Streptosolen jamesonii‘Yellow’ and S. jamesonii‘Orange’, respectively, collected from plants originating in Israel, were tested for PSTVd before entry into the Netherlands. The leaves were tested by real-time reverse transcription-polymerase chain reaction (RT-PCR) (Boonham et al., 2004) in 24 samples consisting of 12 to13 leaves. Isolated RNA was first diluted by an additional 10-fold to reduce inhibition. All 8 samples of the ‘Yellow’ cultivar produced Ct values between 28·0 and 31·3, whereas no amplification was observed for the 16 samples from S. jamesonii‘Orange’. To confirm identification and for subsequent sequencing, positive samples were tested by RT-PCR using PSTVd primers developed by Shamloul et al. (1997). All samples yielded amplicons of the expected size, i.e. approximately 360 nt. Because these primers may also amplify isolates of Tomato chlorotic dwarf viroid, a definite identification of PSTVd was based on the nucleotide sequence. The amplicon sequence (357 nt) was, with the exception of one nt, identical to a previously reported PSTVd sequence from Solanum jasminoides (Verhoeven et al., 2008; NCBI GenBank Acc. No. EF192393) and Solanum rantonetti (Di Serio, 2007; NCBI GenBank Acc. No. EF459700). The sequence of the new PSTVd isolate from S. jamesonii was submitted to NCBI GenBank (Acc. No. EF580923). Streptosolen jamesonii‘Yellow’ is a new host plant species of PSTVd and may act as a symptomless carrier of the viroid.

IDENTIFICATION AND CHARACTERIZATION OF POTATO SPINDLE TUBER VIROID INFECTING SOLANUM JASMINOIDES AND S. RANTONNETII IN ITALY

Potato spindle tuber viroid (PSTVd), a quarantine pathogen included in the EPPO A2 list was identified in plants of Solanum jasminoides and S. rantonnetii in Italy. Molecular characterization of four S. jasminoides and one S. rantonnetii PSTVd isolates showed limited sequence variability. A tissue-printing hybridization method for detecting PSTVd in ornamental Solanaceae was successfully tested and its potential for large scale surveys is discussed. This appears to be the first report of PSTVd in Italy and the first report of PSTVd naturally infecting S. rantonnetii.

Recovery of Four Novel Potato spindle tuber viroid Sequence Variants from Russian Seed Potatoes.

First described in the early 1930s, the limited distribution of potato "gothic" disease made it of little economic significance in European Russia until the early 1970s when meristem-tip culture was widely adopted throughout the former USSR to increase production of virus-free seed potatoes. Shortly thereafter, the yield and quality of Russian seed potatoes began a dramatic decline. Symptoms of potato "gothic" resemble those of Potato spindle tuber viroid (PSTVd) (3), and initial suspicions that in vitro plantlets and seed potatoes might be viroid-infected were later proved correct when Kastalyeva et al. (2) showed that approximately 50 to 70% of in vitro plantlets and tubers collected from different regions of Russia as well as the in vitro germplasm collection maintained by the All-Russian Potato Research Institute (ARPRI) were infected with PSTVd. Measures have since been taken to reduce the incidence of PSTVd infection, and numerous PSTVd isolates were collected from territories of the former USSR; however, none of these isolates have been characterized at the molecular level. Overlapping reverse transcription (RT)-PCR products (1) were generated from four PSTVd isolates maintained in field-grown tubers at the VNIIF using two pairs of primers; PSTVd180F (5'-TCACCCTTCCTTTCTTCGGGTGTC-3') + PSTVd179R (5'-AAACCCTGTTTCGGCGGGAATTAC-3') and PSTVd112F (5'-ACT GGCAAAAAAGGACGGTGGGGA-3') + PSTVd359R (5'-AGGAACC AACTGCGGTTCCAAGGG-3'). Automated sequence analysis of the resulting uncloned PCR products revealed the presence of four previously unknown PSTVd variants (GenBank Accession Nos. EF044302-EF044305). All four tubers were also infected with Potato virus M and Potato virus Y and one tuber also contained Potato virus S. ELISA tests for Potato leaf roll virus were negative. Each isolate appeared to contain only a single 358-359 nt variant differing from PSTVd-intermediate strain (GenBank Accession No. V01465) at 2-5 positions. The three closely related variants originating from Leningradskaya Province (Northwest Russia) contain two to three changes in the variable domain and central conserved region and induced intermediate symptoms in Rutgers tomato. The fourth variant originating from Samarskaya Province (Volga River Region) contains additional changes in the pathogenicity domain and induced mild symptoms. Minor differences among the Leningradskaya variants may represent sequence drift during extended (9 to 11 year) tuber passage. The presence of additional sequence changes in the variant from Samarskaya is consistent with independent origin and/or prolonged separation. Additional studies with a wider range of Russian isolates of PSTVd are currently underway to develop diagnostic methods suitable for future large-scale screening programs.