Positive-sense Single-stranded RNA Research Articles

Identifying SNP threshold from P2 sequences for investigating norovirus transmission

Noroviruses are a group of non-enveloped single-stranded positive-sense RNA virus belonging to Caliciviridae family. They can be transmitted by the fecal-oral route from contaminated food and water and cause mainly acute gastroenteritis. Outbreaks of norovirus infections could be difficult to detect and investigate. In this study, we developed a simple threshold detection approach based on variations of the P2 domain of the capsid protein. We obtained sequences from the norovirus hypervariable P2 region using Sanger sequencing, including 582 pairs of epidemiologically-related strains from 35 norovirus outbreaks and 6402 pairs of epidemiologically-unrelated strains during the four epidemic seasons. Genetic distances were calculated and a threshold was performed by adopting ROC (Receiver Operating Characteristic) curve which identified transmission clusters in all tested outbreaks with 80% sensitivity. In average, nucleotide diversity between outbreaks was 67.5 times greater than the diversity within outbreaks. Simple and accurate thresholds for detecting norovirus transmissions of three genotypes obtained here streamlines molecular investigation of norovirus outbreaks, thus enabling rapid and efficient responses for the control of norovirus.

Characterization of Japanese Encephalitis Virus Isolated from Persistently Infected Mouse Embryo Cells.

Japanese encephalitis virus (JEV) has a positive-sense single-stranded RNA genome and belongs to the genus Flavivirus of the family Flaviviridae. Persistent JEV infection was previously shown in pig blood cells, which act as a natural reservoir of this virus. We aimed to determine the pathogenicity factors involved in persistent JEV infection by analyzing the pathogenicity and genome sequences of a virus isolated from a persistent infection model. We established persistent JEV infections in cells by inoculating mouse fetus primary cell cultures with the Beijing-1 strain of JEV and then performing repeated infected cell passages, harvesting viruses after each passage while monitoring the plaque size over 100 generations. The virus growth rate was compared among Vero, C6/36, and Neuro-2a cells. The pathogenicity was examined in female ICR mice at several ages. Additionally, we determined the whole-genome sequences. The 134th Beijing-1-derived persistent virus (ME134) grew in Vero cells at a similar rate to the parent strain but did not grow well in C6/36 or Neuro-2a cells. No differences were observed in pathogenicity after intracerebral inoculation in mice of different ages, but the survival time was extended in older mice. Mutations in the persistent virus genomes were found across all regions but were mainly focused in the NS3, NS4b, and 3'NCR regions, with a 34-base-pair deletion found in the variable region. The short deletion in the 3'NCR region appeared to be responsible for the reduced pathogenicity and growth efficiency.

In vivo rescue of arboviruses directly from subgenomic DNA fragments

Reverse genetic systems are mainly used to rescue recombinant viral strains in cell culture. To a lesser extent, these tools have also been used to generate, by inoculating infectious clones, viral strains directly in living animals. We previously developed the 'Infectious Subgenomic Amplicons' (ISA) method, which enables rescue of single-stranded positive-sense RNA viruses in vitro by transfecting overlapping subgenomic DNA fragments. Here, we provide proof-of-concept for direct in vivo generation of infectious particles following the inoculation of subgenomic amplicons. First, we rescued a strain of tick-borne encephalitis virus in mice to transpose the ISA method in vivo. Subgenomic DNA fragments were amplified using a 3-fragment reverse genetics system and inoculated intramuscularly to animals. Almost all animals were infected when quantities of DNA inoculated were at least 20µg. We then optimized our procedure in order to increase the animal infection rate. This was achieved by adding an electroporation step and/or using a simplified 2-fragment reverse genetics system. Under optimal conditions, a large majority of animals were infected with doses of 20ng of DNA. Finally, we demonstrated the versatility of this method by applying it to Japanese encephalitis and Chikungunya viruses. This method provides an efficient strategy for in vivo rescue of arboviruses. Furthermore, in the context of the development of DNA-launched live attenuated vaccines, this new approach may facilitate the generation of attenuated strains in vivo. It also enables to deliver a substance free of any vector DNA, which seems to be an important criterion for the development of human vaccines.

Whole genome sequence analysis of shallot virus X from India reveals it to be a natural recombinant with positive selection pressure

BackgroundShallots are infected by various viruses like Onion yellow dwarf virus (OYDV), Leek yellow stripe virus (LYSV), Shallot latent virus (SLV) and Shallot virus X (ShVX). In India, they have been found to be persistently infected by ShVX. ShVX also infects onion and garlic in combination with other carlaviruses and potyviruses. ShVX is a member of genus Allexivirus of family Alphaflexiviridae. ShVX has a monopartite genome, which is represented by positive sense single-stranded RNA. Globally, only six complete and 3 nearly complete genome sequences of ShV X are reported to date. This number is insufficient to measure a taxon’s true molecular diversity. Moreover, the complete genome sequence of ShVX from Asia has not been reported as yet. Therefore, this study was undertaken to generate a complete genome sequence of ShVX from India.ResultsShallot virus X (ShVX) is one of the significant threats to Allium crop production. In this study, we report the first complete genome sequence of the ShVX from India through Next-generation sequencing (NGS). The complete genome of the ShVX (Accession No. OK104171), from this study comprised 8911 nucleotides. In-silico analysis of the sequence revealed variability between this isolate and isolates from other countries. The dissimilarities are spread all over the genome specifically some non-coding intergenic regions. Statistical analysis of individual genes for site-specific selection indicates a positive selection in NABP region. The presence of a recombination event was detected in coat protein region. The sequence similarity percentage and phylogenetic analysis indicate ShVX Indian isolate is a distinctly different isolate. Recombination and site-specific selection may have a function in the evolution of this isolate. This is the first detailed study of the ShVX complete genome sequence from Southeast Asia.ConclusionThis study presents the first report of the entire genome sequence of an Indian isolate of ShVX along with an in-depth exploration of its evolutionary traits. The findings highlight the Indian variant as a naturally occurring recombinant, emphasizing the substantial role of recombination in the evolution of this viral species. This insight into the molecular diversity of strains within a specific geographical region holds immense significance for comprehending and forecasting potential epidemics. Consequently, the insights garnered from this research hold practical value for shaping ShVX management strategies and providing a foundation for forthcoming studies delving into its evolutionary trajectory.

Role of N-linked glycosylation in porcine reproductive and respiratory syndrome virus (PRRSV) infection.

Porcine reproductive and respiratory syndrome (PRRSV) is an enveloped single-stranded positive-sense RNA virus and one of the main pathogens that causes the most significant economical losses in the swine-producing countries. PRRSV is currently divided into two distinct species, PRRSV-1 and PRRSV-2. The PRRSV virion envelope is composed of four glycosylated membrane proteins and three non-glycosylated envelope proteins. Previous work has suggested that PRRSV-linked glycans are critical structural components for virus assembly. In addition, it has been proposed that PRRSV glycans are implicated in the interaction with host cells and critical for virus infection. In contrast, recent findings showed that removal of N-glycans from PRRSV does not influence virus infection of permissive cells. Thus, there are not sufficient evidences to indicate compellingly that N-glycans present in the PRRSV envelope play a direct function in viral infection. To gain insights into the role of N-glycosylation in PRRSV infection, we analysed the specific contribution of the envelope protein-linked N-glycans to infection of permissive cells. For this purpose, we used a novel strategy to modify envelope protein-linked N-glycans that consists of production of monoglycosylated PRRSV and viral glycoproteins with different glycan states. Our results showed that removal or alteration of N-glycans from PRRSV affected virus infection. Specifically, we found that complex N-glycans are required for an efficient infection in cell cultures. Furthermore, we found that presence of high mannose type glycans on PRRSV surface is the minimal requirement for a productive viral infection. Our findings also show that PRRSV-1 and PRRSV-2 have different requirements of N-glycan structure for an optimal infection. In addition, we demonstrated that removal of N-glycans from PRRSV does not affect viral attachment, suggesting that these carbohydrates played a major role in regulating viral entry. In agreement with these findings, by performing immunoprecipitation assays and colocalization experiments, we found that N-glycans present in the viral envelope glycoproteins are not required to bind to the essential viral receptor CD163. Finally, we found that the presence of N-glycans in CD163 is not required for PRRSV infection.

Statine-based peptidomimetic compounds as inhibitors for SARS-CoV-2 main protease (SARS-CoV‑2 Mpro)

COVID-19 is a multisystemic disease caused by the SARS-CoV-2 airborne virus, a member of the Coronaviridae family. It has a positive sense single-stranded RNA genome and encodes two non-structural proteins through viral cysteine-proteases processing. Blocking this step is crucial to control virus replication. In this work, we reported the synthesis of 23 statine-based peptidomimetics to determine their ability to inhibit the main protease (Mpro) activity of SARS-CoV-2. Among the 23 peptidomimetics, 15 compounds effectively inhibited Mpro activity by 50% or more, while three compounds (7d, 8e, and 9g) exhibited maximum inhibition above 70% and IC50 < 1 µM. Compounds 7d, 8e, and 9g inhibited roughly 80% of SARS-CoV-2 replication and proved no cytotoxicity. Molecular docking simulations show putative hydrogen bond and hydrophobic interactions between specific amino acids and these inhibitors. Molecular dynamics simulations further confirmed the stability and persisting interactions in Mpro's subsites, exhibiting favorable free energy binding (ΔGbind) values. These findings suggest the statine-based peptidomimetics as potential therapeutic agents against SARS-CoV-2 by targeting Mpro.

Heat shock protein 71 restricts mutation of porcine reproductive and respiratory syndrome virus nsp2 in vitro

porcine reproductive and respiratory syndrome (PRRS), caused by porcine reproductive and respiratory syndrome virus (PRRSV) infection, is an important swine infectious disease that causes substantial losses worldwide each year. PRRSV is a positive-sense single-stranded RNA virus that is highly susceptible to mutation and recombination, making vaccine and drug research for the disease extremely difficult. In this study, the binding of PRRSV nsp2 to HSP71 protein was detected by using the IP/MS technique. And the inhibitory effect of HSP71 on nsp2 antagonistic activity was validated by measuring NF-kB luciferase reporter. According to stress from inhibitory effects, the amino acid variation profile of PRRSV nsp2 under HSP71 stress was further analyzed using second-generation sequencing. Surprisingly, the results indicated that HSP71 pressure limits the random mutations of PRRSV nsp2 and maintains the dominant PRRSV strain within the population. Mutant strain showed weaker antagonistic activity and replication capability in cell. These results imply the binding of HSP71 with PRRSV nsp2 may lead to maintain the stability of highly virulent strains of PRRSV.

Molecular mapping of the broad bean wilt virus 2 resistance locus bwvr in Capsicum annuum using BSR-seq

Key messageBulked segregant RNA seq of pools of pepper accessions that are susceptible or resistant to Broad bean wilt virus 2 identifies a gene that might confer resistance to this devastating pathogen.The single-stranded positive-sense RNA virus Broad bean wilt virus 2 (BBWV2) causes substantial damage to pepper (Capsicum annuum) cultivation. Here, we describe mapping the BBWV2 resistance locus bwvr using a F7:8 recombinant inbred line (RIL) population constructed by crossing the BBWV2-resistant pepper accession ‘SNU-C’ with the susceptible pepper accession ‘ECW30R.’ All F1 plants infected with the BBWV2 strain PAP1 were susceptible to the virus, and the RIL population showed a 1:1 ratio of resistance to susceptibility, indicating that this trait is controlled by a single recessive gene. To map bwvr, we performed bulked segregant RNA-seq (BSR-seq). We sequenced pools of resistant and susceptible lines from the RILs and aligned the reads to the high-quality ‘Dempsey’ reference genome to identify variants between the pools. This analysis identified 519,887 variants and selected the region from 245.9–250.8 Mb of the Dempsey reference genome as the quantitative trait locus region for bwvr. To finely map bwvr, we used newly designed high-resolution melting (HRM) and Kompetitive allele specific PCR (KASP) markers based on variants obtained from the BSR-seq reads and the PepperSNP16K array. Comparative analysis identified 11 SNU-C-specific SNPs within the bwvr locus. Using markers derived from these variants, we mapped the candidate bwvr locus to the region from 246.833–246.949 kb. SNU-C-specific variants clustered near DEM.v1.00035533 within the bwvr locus. DEM.v1.00035533 encodes the nitrate transporter NPF1.2 and contains a SNP within its 5′ untranslated region. The bwvr locus, which contains four genes including DEM.v1.00035533, could represent a valuable resource for global pepper breeding programs.

Reduced insulin/IGF-1 signalling upregulates two anti-viral immune pathways, decreases viral load and increases survival under viral infection in C. elegans.

Reduced insulin/IGF-1 signalling (rIIS) improves survival across diverse taxa and there is a growing interest in its role in regulating immune function. Whilst rIIS can improve anti-bacterial resistance, the consequences for anti-viral immunity are yet to be systematically examined. Here, we show that rIIS in adult Caenorhabditis elegans increases the expression of key genes in two different anti-viral immunity pathways, whilst reducing viral load in old age, increasing survival and reducing rate-of-senescence under infection by naturally occurring positive-sense single-stranded RNA Orsay virus. We found that both drh-1 in the anti-viral RNA interference (RNAi) pathway and cde-1 in the terminal uridylation-based degradation of viral RNA pathway were upregulated in early adulthood under rIIS and increased anti-viral resistance was not associated with reproductive costs. Remarkably, rIIS increased anti-viral gene expression only in infected worms, potentially to curb the costs of constitutively upregulated immunity. RNA viruses are found across taxa from plants to mammals and we demonstrate a novel role for rIIS in regulating resistance to viral infection. We therefore highlight this evolutionarily conserved signalling pathway as a promising therapeutic target to improve anti-viral immunity.

A Viroinformatics Study: B-Cell Polytope Mapping of Envelope Protein to Develop Vaccine Candidate against Four DENV Serotype

Nowadays, dengue virus (DENV) is still become a global problem, even though the virus infection issues have reached half of the population in some countries each year. DENV belongs to the enveloped virus with positive-sense single-stranded RNA (+ssRNA) genus Flavivirus and belongs to the Flaviviridae family. DENV has structural proteins which consist of the envelope protein (E), capsid (C), and membrane (M). There are four serotypes of this virus which are DENV-1, 2, 3, and 4. These four serotypes are transmitted to humans through Aedes sp. The development of this vaccine is still in progress and the challenge of this DENV vaccine candidate design is to overcome the heterotypic infection and the expansion of coverage protection to all virus serotypes. This research uses design simulation for vaccine candidates using B cell epitope in all DENV’s serotypes envelope to trigger the antibody formation through bioinformatics method that consists of protein modeling, immunogenicity, toxicity, and immune stimulation. DENV envelope protein was predicted to have polytope that can be recognized by B cells and act as an antigen, have low similarity with the composing sequence of cell surface receptors on the body, and non-toxic, and then can trigger the population increase of B cell and IgM antibody production with high avidity to neutralize four of the DENV serotypes. We recommend the B cell polytype which consists of A, C, E, and G peptides be examined by the wet-lab approach.

Electrophysiological properties and structural prediction of the SARS-CoV-2 viroprotein E.

COVID-19, the infectious disease caused by the most recently discovered coronavirus SARS- CoV-2, has caused millions of sick people and thousands of deaths all over the world. The viral positive-sense single-stranded RNA encodes 31 proteins among which the spike (S) is undoubtedly the best known. Recently, protein E has been reputed as a potential pharmacological target as well. It is essential for the assembly and release of the virions in the cell. Literature describes protein E as a voltage-dependent channel with preference towards monovalent cations whose intracellular expression, though, alters Ca2+ homeostasis and promotes the activation of the proinflammatory cascades. Due to the extremely high sequence identity of SARS-CoV-2 protein E (E-2) with the previously characterized E-1 (i.e., protein E from SARS-CoV) many data obtained for E-1 were simply adapted to the other. Recent solid state NMR structure revealed that the transmembrane domain (TMD) of E-2 self-assembles into a homo-pentamer, albeit the oligomeric status has not been validated with the full-length protein. Prompted by the lack of a common agreement on the proper structural and functional features of E-2, we investigated the specific mechanism/s of pore-gating and the detailed molecular structure of the most cryptic protein of SARS-CoV-2 by means of MD simulations of the E-2 structure and by expressing, refolding and analyzing the electrophysiological activity of the transmembrane moiety of the protein E-2, in its full length. Our results show a clear agreement between experimental and predictive studies and foresee a mechanism of activity based on Ca2+ affinity.

Genome characterization of a novel narnavirus infecting the plant-pathogenic fungus Ustilaginoidea virens.

Mycoviruses are viruses that infect fungi and oomycetes. They are widespread in all major groups of plant-pathogenic fungi and oomycetes. To date, only the full genome of dsRNA mycoviruses and the contigs of positive-sense single-stranded RNA (+ssRNA) mycoviruses have been reported in Ustilaginoidea virens, which is the notorious causal agent of rice false smut (RFS). Here, we report the molecular characterization of a novel +ssRNA mycovirus, Ustilaginoidea virens narnavirus 4 (UvNV4), isolated from U. virens strain Uv418. UvNV4 has a genome of 3,131 nucleotides (nt) and possesses an open reading frame (ORF) predicted to encode an RNA-dependent RNA polymerase (RdRp) of 1,017 amino acids (aa) sequence with a molecular mass of 116.6 kDa. BLASTp analysis revealed that the RdRp showed 50.34% aa sequence identity to that of the previously described Zhangzhou Narna tick virus 1. Phylogenetic analysis indicated that UvNV4 is closely related to members of the family Narnaviridae. Taken together, these results clearly demonstrate that UvNV4 is a novel +ssRNA virus infecting U. virens.

Implementation of IFPTML Computational Models in Drug Discovery Against Flaviviridae Family.

The Flaviviridae family consists of single-stranded positive-sense RNA viruses, which contains the genera Flavivirus, Hepacivirus, Pegivirus, and Pestivirus. Currently, there is an outbreak of viral diseases caused by this family affecting millions of people worldwide, leading to significant morbidity and mortality rates. Advances in computational chemistry have greatly facilitated the discovery of novel drugs and treatments for diseases associated with this family. Chemoinformatic techniques, such as the perturbation theory machine learning method, have played a crucial role in developing new approaches based on ML models that can effectively aid drug discovery. The IFPTML models have shown its capability to handle, classify, and process large data sets with high specificity. The results obtained from different models indicates that this methodology is proficient in processing the data, resulting in a reduction of the false positive rate by 4.25%, along with an accuracy of 83% and reliability of 92%. These values suggest that the model can serve as a computational tool in assisting drug discovery efforts and the development of new treatments against Flaviviridae family diseases.

Validation of improved automated nucleic acid extraction methods for direct detection of polioviruses for global polio eradication

Polioviruses (PV), the main causative agent of acute flaccid paralysis (AFP), are positive-sense single-stranded RNA viruses of the family Picornaviridae. As we approach polio eradication, accurate and timely detection of poliovirus in stool from AFP cases becomes vital to success for the eradication efforts. Direct detection of PV from clinical diagnostic samples using nucleic acid (NA) extraction and real-time reverse transcriptase polymerase chain reaction (rRT-PCR) instead of the current standard method of virus isolation in culture, eliminates the long turn-around time to diagnosis and the need for high viral titer amplification in laboratories. An essential component of direct detection of PV from AFP surveillance samples is the efficient extraction of NA. Potential supply chain issues and lack of vendor presence in certain areas of the world necessitates the validation of multiple NA extraction methods. Using retrospective PV-positive surveillance samples (n=104), two extraction kits were compared to the previously validated Zymo Research Quick-RNA™ Viral Kit. The Roche High Pure Viral RNA Kit, a column-based manual extraction method, and the MagMaX™ Pathogen RNA/DNA kit used in the automated Kingfisher Flex system were both non-inferior to the Zymo kit, with similar rates of PV detection in pivotal rRT-PCR assays, such as pan-poliovirus (PanPV), poliovirus serotype 2 (PV2), and wild poliovirus serotype 1 (WPV1). These important assays allow the identification and differentiation of PV genotypes and serotypes and are fundamental to the GPLN program. Validation of two additional kits provides feasible alternatives to the current piloted method of NA extraction for poliovirus rRT-PCR assays.

First Report of Hibiscus Chlorotic Ringspot Virus infecting Hibiscus rosa-sinensis in Italy.

Hibiscus chlorotic ringspot virus (HCRSV) belongs to the Betacarmovirus genus of the Tombusviridae family and is a positive-sense monopartite single-stranded RNA virus. HCRSV was first described in a hibiscus variety imported into the United States from El Salvador. The HCRSV natural host range is limited to species belonging to Malvaceae family, in particular Hibiscus rosa-sinensis, H. manihot, H. diversifolius and H. syriacus. In September 2023, leaf mottle and chlorotic spots were observed on the leaves of two H. rosa-sinensis plants located in a public garden of Ercolano (Naples city, Southern Italy). Two leaves, one from each symptomatic plant, were pooled and submitted to double-stranded RNA extraction using a Viral Gene-Spin Viral DNA/RNA Extraction Kit (iNtRON, Korea), followed by cDNA library preparation with the TruSeq Stranded Total RNA (Illumina, USA). Sequencing on the Illumina NovaSeq 6000 platform (Illumina, USA) with 150-bp paired-end reads yielded 22,578,913 raw reads. 21,413,571 clean reads were obtained by quality control on the sequencing data was performed with the software FastQC (v. 0.11.5). Then low quality bases and adapters were removed with the software BBDuk in the BBTools package setting a minimum read quality of 25 and minimum read length of 35 bp. The resulted filtered reads were used to assembly viral genome by using two different algorithms (Metaspades and RNAViral) implemented in SPAdes (v. 3.15.3). Of the total contigs de novo assembled, the two algorithms implemented identified respectively 340 and 559 contigs related to viruses. BLASTn analysis of the contigs identify one coting of 3965 nt covering 97% to 100% of the whole genome sequence of nine HCRSV isolates, with percentage of identity of 87.8-95.2%. No other plant viruses or viroids have been identified during bioinformatic analysis. To confirm the result, a full-length genomic sequence of the Italian HCRSV isolate (named Ita-1), was obtained by reverse transcription polymerase chain reaction (RT-PCR) using specific primers designed on the sequence of the assembled contigs. The PCR products were sequenced using the Sanger method (Microsynth Seqlab, Germany) in both directions. The obtained full-length genomic sequence of the HCRSV isolate (Acc. No. OR981792) was 3910 nt in length. Maximum-likelihood phylogenetic trees inferred from the whole genome sequence showed that Ita-1 clustered closely with HCRSV isolates. The leaf samples were further analyzed using a HCRSV ELISA kit (Agdia, USA). Healthy H. rosa-sinensis leaves were taken as a negative control and buffer solution as a blank control. The results showed a positive reaction for the two symptomatic plants (OD = 1.345 ± 0.010 at 405 nm) relative to the negative (OD = 0.097) and blank (OD = 0.065) controls. Overall, the results of serological and molecular analyses supported that symptoms observed in H. rosa-sinensis were strictly associated to HCRSV infection. Four viruses have been reported in H. rosa-sinensis in Italy so far: eggplant mottled dwarf nucleorhabdovirus (EMDV), hibiscus latent Fort Pierce virus (HLFPV), hibiscus latent ringspot virus (HLRSV), hibiscus latent Singapore virus (HLSV). To our knowledge, this is the first report of HCRSV in H. rosa-sinensis in Italy, where probably infected plants were accidentally introduced. At present, HCRSV has been reported in three continents (Asia, Oceania and North America) and the number of countries where the virus has been detected is likely to increase rapidly as a result of increased surveillance and availability of diagnostic methods. This study will help the management of viral diseases on H. rosa-sinensis in Italy.

First report of Hibiscus latent Singapore virus and Hibiscus latent Fort Pierce virus infecting Lantana camara in China.

Hibiscus latent Singapore virus (HLSV) and Hibiscus latent Fort Pierce virus (HLFPV) both belong to the genus Tobamovirus in the family Virgaviridae. The genomes of both HLSV and HLFPV consist of a linear positive sense single-stranded RNA of about 6.3 kb. HLSV is the causal agent of hibiscus leaf crinkle disease. Infections of HLSV in hibiscus (Hibiscus rosa-sinensis) have so far only been reported in Singapore, Japan and Malaysia (Srinivasan et al., 2002; Yoshida et al., 2018; Yusop et al., 2021). In 2017, leaf curling and chlorosis symptoms of lantana (Lantana camara) plants were found in Chenshan Botanical Garden, Shanghai, China. To detect potential virus(es) in these lantana samples, leaves from one lantana plant were collected and total RNA was extracted with RNAiso Plus (TaKaRa). A cDNA library was prepared by TruSeq RNA Sample Prep Kit (Illumina) after removing ribosomal RNA by Ribo-ZeroTM rRNA Removal Kit (Epicentre). The paired-end sequencing was then performed on an Illumina NovaSeq 6000. A total of 61,085,018 high quality reads were obtained and de novo assembly by StringTie revealed 124,516 contigs (greater than 50 bp, N50=719 bp) with an average length of 537 bp. BLASTx analyses in the National Center for Biotechnology Information (NCBI) database showed that 1 long contig of 6,305 bp, assembled of 1794 clean reads, shared significant nucleotide similarities with the genomic sequence of HLSV, and 1 contig of 6,271 bp, assembled of 3174 clean reads, shared significant similarities with the genomic sequence of HLFPV, yielding an average coverage of the whole genome at 42.65 and 75.83 per million reads, respectively. To obtain the complete genome of the viral RNA in this lantana sample, eleven overlapping regions covering the entire HLSV viral genome, and nine overlapping regions covering the entire HLFPV viral genome were amplified by reverse transcription-PCR (RT-PCR) and sequenced. In addition, the exact 5' and 3' ends of the genomic RNA of each virus were determined by rapid amplification of the cDNA ends (RACE) (Wang et al. 2020). The complete genome of the identified HLSV, deposited in GenBank: MZ020960, is 6,486 nt in length and shows 98.4% nucleotide sequence identity with HLSV Singapore isolate (GenBank: AF395898). Similar to other HLSV isolates, this virus isolate possesses an internal poly(A) tract of 87 nucleotides, which is crucial to virus replication (Niu et al., 2015). The complete genome of the Lantana HLFPV isolate is 6,463 nt (GenBank MZ020961) including a 73 nt internal poly(A) tract, and has 98.4% nt identity to HLFPV-Japan (AB917427). In two other lantana plants from the same site, the presence of HLSV and HLFPV was confirmed by RT-PCR using the primer pairs (5'-GCATCTGCATAACACGGTTG-3'/5'-ACGTTGTAGTAGACGTTGTTGTAG-3' and 5'-GGACCTTGCTAATCCGCTAAAGTTG-3'/5'-GGTCCATGTCCATCCAGATGCAATC-3'). In addition to the HLSV and HLFPV genomes, BLASTx analysis of three contigs of 3,006 bp, 2,845 bp and 2,200 bp, assembled of 1328, 352 and 2280 clean reads respectively, showed high identity to RNAs 1 (MG182148), 2 (DQ412731) and 3 (KY794710) of cucumber mosaic virus. To the best of our knowledge, this is the first report of L. camara as a new natural host of HLSV and HLFPV, and first identification of a mixed infection of HLSV and HLFPV.

Hepatitis E Virus (HEV) Infection Among Immunocompromised Individuals: A Brief Narrative Review.

Hepatitis E virus (HEV) is a single-stranded positive-sense RNA virus that belongs to Hepeviridae family. HEV is the most common cause of acute viral hepatitis worldwide. According to the World Health Organization (WHO), there are estimated 20 million HEV infections worldwide every year, leading to estimated 3.3 million symptomatic cases of HEV infection. The WHO estimates that HEV infection caused approximately 44,000 deaths in 2015, which represents 3.3% of mortality rates due to viral hepatitis. In low-income (LI) countries and lower-middle-income (LMI) countries, HEV is a waterborne infection induced by HEV genotype (gt) 1 and HEV gt 2 that cause large outbreaks and affect young individuals with a high mortality rate in pregnant women from South Asian countries and patients with liver diseases. HEV gt 3, HEV gt 4, and HEV gt 7 are responsible for sporadic infections with zoonotic transmission mainly through the consumption of raw or undercooked meat from different animals. Acute HEV infection is relatively asymptomatic or mild clinical form, in rare cases the disease can be moderate/severe clinical forms and result in fulminant hepatitis or acute liver failure (ALF). Furthermore, HEV infection is associated with extrahepatic manifestations, including renal and neurological clinical signs and symptoms. Pregnant women, infants, older people, immunocompromised individuals, patients with comorbidities, and workers who come into close contact with HEV-infected animals are recognized as major risk groups for severe clinical form of HEV infection and fatal outcome. Chronic HEV infection can occur in immunocompromised individuals with the possibility of progression to cirrhosis.

The Role of Furin in the Pathogenesis of COVID-19-Associated Neurological Disorders.

Neurological disorders have been reported in a large number of coronavirus disease 2019 (COVID-19) patients, suggesting that this disease may have long-term adverse neurological consequences. COVID-19 occurs from infection by a positive-sense single-stranded RNA virus called severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). The membrane fusion protein of SARS-CoV-2, the spike protein, binds to its human host receptor, angiotensin-converting enzyme 2 (ACE2), to initiate membrane fusion between the virus and host cell. The spike protein of SARS-CoV-2 contains the furin protease recognition site and its cleavage enhances the infectivity of this virus. The binding of SARS-CoV-2 to the ACE2 receptor has been shown to downregulate ACE2, thereby increasing the levels of pathogenic angiotensin II (Ang II). The furin protease cleaves between the S1 subunit of the spike protein with the binding domain toward ACE2 and the S2 subunit with the transmembrane domain that anchors to the viral membrane, and this activity releases the S1 subunit into the blood circulation. The released S1 subunit of the spike protein also binds to and downregulates ACE2, in turn increasing the level of Ang II. Considering that a viral particle contains many spike protein molecules, furin-dependent cleavage would release many free S1 protein molecules, each of which can downregulate ACE2, while infection with a viral particle only affects one ACE2 molecule. Therefore, the furin-dependent release of S1 protein would dramatically amplify the ability to downregulate ACE2 and produce Ang II. We hypothesize that this amplification mechanism that the virus possesses, but not the infection per se, is the major driving force behind COVID-19-associated neurological disorders.

First Report of Cucurbit aphid-borne yellows virus infecting five cucurbits in India.

Cucurbits are among the most popular vegetables cultivated globally. They have high economic importance, especially in India, where they are cooked and eaten as vegetables (Dhillon et al. 2016). In February 2023, yellowing symptoms were observed on cucurbitaceous species, viz. Trichosanthes cucumerina (Snake gourd - SG), Luffa acutangula (Ridge gourd - RG), Lagenaria siceraria (Bottle gourd - BG), Luffa aegyptiaca (Sponge gourd - SPG) and yellow chlorotic spots were recorded on Benincasa hispida (Ash gourd - AG) growing in the experimental farm at the Indian Agricultural Research Institute, Regional Station, Pune (Supplementary Figure 1). The average disease incidence ranged from 5% to 30%. A total of 175 leaf samples, including thirty symptomatic and five asymptomatic plants of each cucurbit, were collected and tested by DAS-ELISA using antisera against cucurbit aphid-borne yellows virus (CABYV) (DSMZ, Germany), cucurbit yellow stunting disorder virus (CYSDV) (Arsh Biotech, India), cucumber mosaic virus (CMV), zucchini yellow mosaic virus (ZYMV), and papaya ringspot virus (PRSV) (Agdia, USA). All 150 symptomatic cucurbit samples tested positive for CABYV, while five samples from SG, 14 from RG, two from AG, and 11 from SPG hosts were also positive for PRSV. Asymptomatic samples were negative for all viruses tested. In order to further confirm the presence of the virus, total RNA was extracted from ten samples of each cucurbit host that were positive only for CABYV and the asymptomatic samples using the RNeasy Plant Mini Kit (Qiagen, Germany) as per the manufacturer's protocol. Two-step RT-PCR was carried out using the extracted RNA and CABYV-specific primers, amplifying c. 484 bp of the coat protein gene region (Boubourakas et al. 2006). Amplicons of expected size were obtained in all symptomatic samples, whereas the asymptomatic samples tested negative. Three amplicons obtained from positive samples from each of the cucurbit species were directly sequenced and found to be identical to each other. A representative virus sequence obtained from each cucurbit was deposited in GenBank (Snake gourd - OQ921128, Ridge gourd - OQ921127, Bottle gourd - OQ921126, Ash gourd - OQ921125, Sponge gourd - OQ921129). In BLASTn analysis, the isolates shared from 94.23 to 100% nucleotide identities with the Indian CABYV isolates of various cucurbits and clustered closely with other Pune isolates in the phylogenetic analysis (Supplementary Figure 2). CABYV (genus Polerovirus) is a single-stranded positive-sense RNA virus, and is known to infect and cause severe economic losses in cucurbits worldwide. Previously, occurrences of CABYV have been reported in cucurbits such as watermelon, bitter gourd, cucumber, squash, teasel gourd, and muskmelon in India (Nagendran et al. 2022; Tripathi et al. 2023). It has also been reported to infect a weed species - Abelmoschus moschatus from the same geographical region (Verma et al. 2023). To our knowledge, this is the first report of the natural occurrence of CABYV in snake gourd and ridge gourd worldwide and bottle gourd, ash gourd and sponge gourd in India. The present findings have significant epidemiological importance, as they demonstrate that CABYV is spreading to other cucurbits and occurring widely in India.

First report of tomato brown rugose fruit virus infecting Solanum lycopersicum in Northeast China.

Tomato (Solanum lycopersicum L.) is an important fruit and vegetable crop with high economic value due to its rich vitamins (Friedman. 2002). Over the past five years, due to tomato brown rugose fruit virus (ToBRFV) infection, the tomato production in many countries and regions in Asia, America and Europe have experienced declines in yield and quality (Salem et al. 2023). ToBRFV is a positive-sense single-stranded RNA virus of the genus Tobamovirus in the family Virgaviridae (Salem et al. 2016). In the field, ToBRFV mainly infects solanaceous crops, including tomato and pepper (Zhang et al. 2022). Symptoms on ToBRFV-infected tomato plants mainly include foliar mottle, vein necrosis, and brown mottled rugose fruit (Alfaro-Fernández et al. 2020, Hamborg et al. 2022, Ma et al. 2021). In April 2023, about 150 tomato plants showing leaf curl, brown patch, and rugose surface on fruits were found in a greenhouse grown with about 500 tomato plants in Huludao City, Liaoning province, China. Two leaves and eight fruits from each of 10 symptomatic tomato plants were sampled and subjected to dot enzyme-linked immunosorbent assay (Dot-ELISA) with an antibody against ToBRFV (LV BAO, Chengdu, China); and all samples tested positive. Sap inoculations were prepared from 0.1 g of ToBRFV-positive tomato leaves via homogenization with 0.01 mol·L-1 PBS (phosphate buffered saline, pH 7.2), which were then inoculated mechanically onto 10 tomato cv. Moneymaker and 10 Nicotiana benthamiana plants at four- to six-leaf stage, respectively. At 10 days post inoculation (dpi), the leaf curl symptoms of all tomato plants were shown, which were consistent with those on greenhouse-infected plants. At 5 dpi, the upper leaves of all N. benthamiana plants showed yellowing and curling symptoms. The results of Dot-ELISA assays revealed that these mechanically inoculated plants were positive for ToBRFV. Total RNAs of inoculated and greenhouse-collected samples were extracted using TRIzolTM reagent and analyzed by reverse-transcription (RT)-PCR with specific primers ToBRFV-FD (5' GTCCCGATGTCTGTAAGGCTTGC) and ToBRFV-RD (5' GCAGGTGCAGAGGACCATTGTAA) for ToBRFV detection, respectively. The results showed that a 680-bp fragment was obtained in all tested samples. Then, primers ToBRFV-F1 (5' GTGTATTTTTTACAACATATACC) and ToBRFV-R1 (5' AACCATTGACTCAGAACTC), ToBRFV-F2 (5' TAGCCAAGAATCACGCATG) and ToBRFV-R2 (5' AGCAGCAATAATCACCGTA), ToBRFV-F3 (GAAAGAGTGGGGACGTTACAACATTCATCGGTAAT) and ToBRFV-R3 (TGGGCCCCTACCGGGGGTTCCGGGGGAATTCGAAT) were used to amplify the full-length sequence of ToBRFV using field-collected samples. The methods of primer design are shown in supplemental file 1. The sequence obtained by Sanger sequencing showed 99.86% nucleotide (nt) identity with ToBRFV-SD isolate (accession no. MT018320.1) from Shandong province, China. The full-length sequence of ToBRFV was uploaded to GenBank database with the accession number OR437354. To our knowledge, this is the first report of ToBRFV infecting tomato in Northeast China.