Positive Bone Marrow Cells Research Articles

Acute myeloid leukemia with t(16;21)(q24;q22), CBFA2T3::RUNX1, in post-treatment setting, a case report

Abstract Introduction/Objective Acute myeloid leukemia (AML) with t(16;21)(q24;q22), CBFA2T3::RUNX1 is an uncommon entity that has been reported in both pediatric and adult patients as de novo AML or secondary to prior chemo/radiation therapy. CBFA2T3::RUNX1 AMLs share similar clinico-pathological features and gene expression profile with RUNX1::RUNX1T1 AML. Methods/Case Report We report a case of AML with CBFA2T3::RUNX1 in a 52 year old female who had history of small cell cervical cancer treated with chemotherapy (4 cycles of cisplatin and etoposide) and pelvic radiation therapy. About 17 months after completion of therapy, she presented with anemia and thrombocytopenia, normal WBC/neutrophil count, eosinophilia and increased blasts (up to 10%) in blood. Bone marrow biopsy shows AML with maturation (FAB-M2), erythropoiesis is present, whereas megakaryocytes are decreased. Flow cytometry analysis shows myeloblasts with aberrant CD19 and CD56 expression; in addition, increased CD117/tryptase positive cells are noted, mostly interstitial and more concentrated around bone trabeculae. By immunohistochemical stains, these cells are at least partially positive for CD25, negative CD2, CD30. Karyotype studies demonstrate t(16;21)(q24;q22) and trisomy 8 in all metaphases. FoundationOne heme NGS studies confirmed CBFA2T3::RUNX1 fusion, and no additional mutations were identified. Patient received induction chemotherapy with Idarubicin/Cytarabine plus GO (Gemtuzumab ozogamicin); day 14 bone marrow showed chemotherapeutic effect and she is now in morphologic remission 5 months after diagnosis. Results (if a Case Study enter NA) NA Conclusion Our case adds to the limited knowledge of CBFA2T3::RUNX1 AMLs. Our case shows morphological and immunophenotypic features similar to AML with RUNX1::RUNX1T1, with unusual presentation of peripheral eosinophilia, and increased CD117/tryptase positive cells in bone marrow, the latter has been reported occasionally in core binding factor AMLs. We emphasize the importance of comprehensive genetic studies in AML patients, lack of adverse genetic abnormalities in our patient indicates favorable risk category regardless of the post-treatment clinical setting.

Mutations in the RNA Splicing Factors U2AF1 and SRSF2 are Context-Dependent in Myeloproliferative Neoplasms

RNA splicing factor gene mutations are recurrently found in BCR::ABL1 negative myeloproliferative neoplasms (MPN). To understand the interactions between spliceosome gene mutations and MPN phenotypic driver mutations ( JAK2, CALR and MPL), we investigated their patterns of co-occurrence or mutual exclusivity in a cohort of 990 MPN patients with comprehensive molecular profiling and clinical information from the Hematologic Malignancies Data Repository (HMDR). As expected, MPN driver mutations ( JAK2, CALR and MPL) were mutually exclusive (N=658, N=168, N=53 respectively, Log2 OR≤-3.5 and Padj. ≤0.005 using pairwise Fisher's exact tests with Benjamin Hochberg multiple testing correction). Additionally, cases with co-occurring mutations in two RNA splicing factors, SF3B1, U2AF1 and SRSF2 (N=44, N=49, N=44) respectively were uncommon (2/135 splicing factor mutated cases) . We further found that U2AF1 and SRSF2 mutations co-occurred with JAK2 (log2 OR=1.7, Padj.=0.009) and MPL (log2 OR=2.1, Padj.=0.006) respectively, but rarely with CALR mutations (N=2 CALR-U2AF1 log2 OR=-2.3 Padj.=0.025, N=2 CALR-SRSF2 log2 OR=-2.2 Padj.=0.048). In contrast, CALR-SF3B1 mutations occurred at the expected frequency (Padj.=0.11). To explore the molecular settings where these mutations co-occur, we investigated the variant allele frequencies (VAFs) of CALR, U2AF1, SRSF2 and concomitant mutations in the CALR-U2AF1 (N=2) and CALR-SRSF2 (N=2) patients. The VAFs for the mutations detected in the first patient with CALR-U2AF1 co-mutation were: CALR 0.26, U2AF1 0.45, and TET2 0.41. Since CALR and splicing factor mutations are typically heterozygous, this suggests the CALR mutation was sub-clonal to the U2AF1 mutation and that U2AF1 and TET2 mutations were likely present in the same cell. In the second CALR-U2AF1 co-mutant case, VAFs were: CALR 0.31, U2AF1 0.27, and TP53 0.16. It is possible that in this case, the CALR and U2AF1 mutations may have occurred in independent clones or may have occurred in the same cell in the absence of other pathogenic mutations. For the two CALR-SRSF2 patients, data from three samples revealed VAFs of 0.23-0.46 for CALR and 0.21-0.58 for SRSF2 mutations. Considering their typical heterozygous occurrence, we inferred those individual cells harbored both CALR and SRSF2 mutations. Notably, in samples with high VAFs (>0.37) for both CALR and SRSF2 in two separate patients, additional high VAF pathogenic mutations were observed: 0.35 for ASXL1 and 0.46 for RUNX1 respectively. As ASXL1 and RUNX1 mutations also typically occur in a heterozygous manner, we hypothesized that when CALR and SRSF2 mutations are present in the same cell, another pathogenic co-mutation may be required for survival of the clone. To test our hypothesis, we FACS-sorted single lineage negative CD34 positive bone marrow cells from the first CALR- SRSF2 co-mutant case into 96 wells plates containing methylcellulose and hematopoietic growth factors (CFU-GEMM). DNA was harvested from single-cell colonies and genotyped for the following mutations using polymerase chain reaction (PCR) followed by gel electrophoresis and Sanger sequencing: CALR c.1154_1155insTTGTC p.K385fs*, SRSF2 c.284G>T p.P95H, ASXL1 c.1926_1927insG p.G642fs*, EZH2 c.2188_2212delAAAAAACAGCTCTTCGCCAGTCTGG p.F729fs*. Bulk NGS VAFs were 0.46, 0.38, 0.35, and 0.17, respectively. Out of 73 colonies analyzed, 71 colonies had the CALR insertion 5 mutation detected (see figure). Among these 71 CALR-mutated colonies, SRSF2 was found to co-occur in 35 colonies. Interestingly, all 35 colonies were accompanied by an ASXL1 mutation, and 29 of them had an additional EZH2 mutation. These findings support our hypothesis that CALR and SRSF2 mutations may co-occur in the same cell in the presence of another pathogenic mutation. Our findings offer molecular insights into the context-dependent behavior of splicing factor mutations in MPN. While they can co-occur with JAK2 and MPL mutations, U2AF1 and SRSF2 mutations are largely mutually exclusive with CALR mutations. In addition, our findings generate two main biological hypotheses: (i) a synthetic lethal relationship may exist between CALR mutations and SRSF2 or U2AF1 mutations, and (ii) this synthetic lethality may be overcome by the presence of additional pathogenic mutation(s) in the cell. Validation studies are ongoing to address these hypotheses. AM and AEM contributed equally.

Impact of Glycine-Serine Linker on Target Antigen Binding and Subsequent CD37CAR-T Performance

Introduction/Objectives: Gene-modified therapy expressing CD19-chimeric antigen receptor (CD19CAR) has shown promising outcomes in B-cell malignancies. However, some patients experience relapses due to poor CAR-T persistence and antigen escape. Various approaches have been studied to address these issues, including a novel signaling domain; CD28/CD40 to potentiate CAR-T effectiveness, linker modification to improve antigen-binding affinity, and new target identification such as CD37 in mature T-/B-cell malignancies. Consequently, we developed the third-generation CD37CAR incorporating the dual T- and B-cell costimulatory molecules; CD28/CD40 with two different single-chain variable fragment (scFv) linkers to improve CAR-T efficacy against CD37 + malignancies. Methods: The two different scFv linkers, GSTSGSGKPGSGEGSTKG (18aaL) and GGGGSGGGGSGGGGSGGGGS (GS4L), were fused into the CD37CAR; V L-linker-V H-H-CD28TM-CD28/CD40-CD3z-tEGFR backbone. CAR genes were subcloned into retroviral packaging cells to produce viral particles and transduced into primary CD3 + cells. The CAR +-Tcells were enriched using biotinylated anti-EGFR mAbs and further expanded with anti-CD3/CD28 microbeads. The cells were then used for subsequent experiments compared with untransduced T-cells. The in-silico studyinvestigated the structural behavior and binding characteristics of scFv at the atomistic level. Results: All CD37CAR genes were successfully transduced into primary CD3 + cells with significantly higher transduction efficiency in the glysine-serine linker (CD37.GS4L) CAR than CD37.18aaL. We initially evaluated the influence of linkers on CAR-T proliferation by stimulating once with gamma-irradiated Raji cells and found the robust CD37.GS4L CAR expansion regardless of IL-2. Short- and long-term co-culture assays against various CD37 + malignancies were then performed to examine tumoricidal activity. The overnight specific cytolysis demonstrated greater tumor eradication in CD37.GS4L CAR-T cells against Ramos (burkitt's lymphoma), Jeko-1 (mantle cell lymphoma; MCL), MM1S, KMS12BM (multiple myeloma), Hut78 (cutaneous T-lymphocyte), SNU449 (hepatocellular carcinoma), NCI-H522 (lung adenocarcinoma), primary-MCL and primary-chronic lymphocytic leukemia at various E:T ratios. In addition, we observed significant tumor suppression against Raji cells (burkitt's lymphoma) in CD37.GS4L CAR throughout the 12-day long-term cytotoxicity assay. Concerning the possibility of fratricide, CTV-labeled CD3 + were co-cultured with CARs and found that CD37.18aaL CAR revealed significant autologous T-cell killing compared to others. In terms of cytokine secretion, similar levels of IL-2, IFN-g, perforin, and granzyme B positive cells were noted after being stimulated with target cells. To replicate the effects of prolonged antigen exposure in humans, three consecutive weeklytarget cell stimulations revealed substantial expansion with significant preservation of central memory T-cells and less expressed exhaustion phenotypes in CD37.GS4L CAR compared to CD37.18aaL. Furthermore, the potential anti-tumor efficiency in vivo was studied using Raji-bearing NSG mice model. CD37.GS4L CAR-T effectively suppressed tumor cell growth and prolonged overall survival with persistent T CM positive cells in mice's spleen, liver, and bone marrow on day 60 compared to tEGFR-T and CD37.18aaL CAR-T (Figure 1). Additionally, the preliminary results of MM1S- and HUT78-inoculated mice models illustrated greater in vivo cytotoxicity in CD37.GS4L CAR-T than tEGFR-T. Regarding the in-silico study, molecular dynamic simulation and docking were evaluated. The scFv-specific CD37.GS4L CAR displayed more flexibility with higher binding affinity compared to CD37.18aaL CAR with ∆G = -11.1 kcal/mol, K d = 1.4 x 10 -8 molar, and ∆G = -9.7 kcal/mol, K d of 1.5 x 10 -7 molar, respectively. Conclusions: The considerable flexibility and affinity of CD37.GS4L CAR augment the CAR-T function in terms of proliferation, persistence, and tumoricidal activity. The glysine-serine linker could facilitate scFv activity and maximize CAR-T effectiveness.

Cancer-Associated Stromal Cells Promote the Contribution of MMP2-Positive Bone Marrow-Derived Cells to Oral Squamous Cell Carcinoma Invasion

Simple SummaryBased on its invasiveness, oral squamous cell carcinoma (OSCC) shows two different subtypes: less-invasive verrucous squamous carcinoma (VSCC) or highly invasive squamous cell carcinoma (SCC). The stromal component influences OSCC progression and invasion. On the other hand, bone marrow-derived cells (BMDCs) are recruited into tumors and involved in tumor development. We hypothesized that stromal factors might also affect the relation of BMDCs and tumor invasion. We established the OSCC models transplanted with stromal cells from VSCC and SCC, and we compared the potential stromal factors of VSCC and SCC for the involvement of BMDCs in tumor invasion. Our study showed that stromal factors IL6 and IL1B might promote the contribution of MMP-2 positive BMDCs to OSCC invasion.Tumor stromal components contribute to tumor development and invasion. However, the role of stromal cells in the contribution of bone marrow-derived cells (BMDCs) in oral squamous cell carcinoma (OSCC) invasion is unclear. In the present study, we created two different invasive OSCC patient-derived stroma xenografts (PDSXs) and analyzed and compared the effects of stromal cells on the relation of BMDCs and tumor invasion. We isolated stromal cells from two OSCC patients: less invasive verrucous OSCC (VSCC) and highly invasive conventional OSCC (SCC) and co-xenografted with the OSCC cell line (HSC-2) on green fluorescent protein (GFP)-positive bone marrow (BM) cells transplanted mice. We traced the GFP-positive BM cells by immunohistochemistry (IHC) and detected matrix metalloproteinase 2 (MMP2) expression on BM cells by double fluorescent IHC. The results indicated that the SCC-PDSX promotes MMP2-positive BMDCs recruitment to the invasive front line of the tumor. Furthermore, microarray analysis revealed that the expressions of interleukin 6; IL-6 mRNA and interleukin 1 beta; IL1B mRNA were higher in SCC stromal cells than in VSCC stromal cells. Thus, our study first reports that IL-6 and IL1B might be the potential stromal factors promoting the contribution of MMP2-positive BMDCs to OSCC invasion.

Glycogen synthase kinase 3β/CCR6-positive bone marrow cells correlate with disease activity in multicentric Castleman disease-TAFRO.

Multicentric Castleman disease-thrombocytopenia, anasarca, reticulin fibrosis of bone marrow, renal dysfunction and organomegaly (MCD-TAFRO)-is an emergent phenotype characterized by lymphoproliferation, fluid collection, hemocytopenia and multiple organopathy. Although studies have demonstrated an aberrant blood cytokine/chemokine profile referred to as "chemokine storm", the pathogenesis remains unclear. We aimed to identify pathogenic key molecules, potential diagnostic targets and therapeutic markers in MCD-TAFRO using serum cytokine/chemokine profiles. We performed the targeted cytokine/chemokine multiplex analysis in six cases of MCD-TAFRO with remission or non-remission status. We observed significant changes in serum concentrations of CCL2, CCL5, and Chitinase-3-like-1 in the MCD-TAFRO patients with active state compared to inactive state. Ingenuity pathway analysis revealed that glycogen synthase kinase 3 (GSK3) and CCR6, which is expressed in megakaryocytes, were detected as upstream positive regulators for activating MCD-TAFRO status. More GSK3β+ CCR6+ cells like megakaryocytes were detected in the bone marrow of patients with MCD-TAFRO than in those with systemic lupus erythematosus, MCD-not otherwise specified or autoimmune haemophagocytic lymphohistiocytosis. The cellularity of GSK3β+ CCR6+ cells was correlated with disease activity, including thrombocytopenia and anaemia. In conclusion, GSK3β and CCR6 of bone marrow cells were potentially involved in the pathogenesis of MCD-TAFRO and may act as diagnostic targets and therapeutic markers.

Haploidentical Donor-Derived CAR-T Cells Are Safely and Effectively Co-Infused with the Haploidentical Graft, Depleted of Ab T Cells: Report of Case Series

IntroductionAutologous chimeric antigen receptor (CAR) T cells induce high rate of deep remissions among children with relapsed/refractory B-precursor acute lymphoblastic leukemia (R/R B-ALL). In a significant proportion of patients true cure is achieved only with HSCT as post-CAR-T consolidation. Seeking to combine the cytoreductive and curative power of HSCT with the antigen-specific activity of CAR-T we devised an approach with simultaneous infusion of haploidentical ab T cell-depleted graft and CAR-T cells, derived from the same donor. The approach was offered to patients with R/R B-ALL on a compassionate use basis and here the first experience is summarized.Patients and methodsA total of 11 patients with relapsed/refractory BCP-ALL (n-10) and Burkitt leukemia(n-1), (5 female, 6 male, median age 8,3 y) were treated. Three patients had relapsed BCP-ALL after both haploidentical HSCT and autologous CD19 CAR-T cell, 3 after haploidentical HSCT, 2 after autologous CD19 CAR-T cell, 3 after intensive chemotherapy +/- blinatumomab (n=2).Seven patients had CD19 and CD22 positive leukemic cells in bone marrow (MRD+ n=1, >20% blasts n=6), 2 pts had MRD-level disease with CD22 positive blast cells and 2 pts were in CR2.Peripheral blood mononuclear cells used to produce CAR T cells were provided by the patient's transplant donor.The CliniMACS Prodigy T cell transduction (TCT) process was used to produce CD19 and СD19/22CAR-T cells.Five (45%) pts received treosulfan-based myeloablative preparative regimen, while TBI-based regimen was used in 6 (55%) pts. GvHD prophylaxis included tocilizumab at 8 mg/kg on day -1 and abatacept at 10 mg/kg on day -1, +7, +14, +28.Final product was administered without cryopreservation to the patients: 10 pts received allogeneic CAR T cell with haploidentical (n=10) and match related (n=1) TCRαβ-depleted graft (CD19 CAR- T cell n=1 and CD19/22 CAR- T cell n=10). The CAR-T cell product was administered at a dose of 0,1*10 6/kg of CAR-T cells in all pts. The median dose of CD34+ cells was 8.5 x10 6/kg (range 5-15), αβ T cells - 56x10 3/kg (range 9-172).ResultsPrimary engraftment was achieved in 10 of 11 pts (non-engraftment patient relapsed early), the median time to neutrophil and platelet recovery was 13 and 14 days, respectively.Cytokine release syndrome occurred in 7 patients (63%) and all were grade ≤3. Six patients (54%) had neurologic events (ICANS grade 3, n=1). No aGVHD 3-4 were observed, 4 pts developed grade 2 aGVHD (skin and gut).The median time to CAR-T cell peak expansion was 14 days (7-28). The median time to CAR-T cell persisted was 6 months (2-12) and B cell aplasia was 7 months.All engrafted patients achieved CR (MRD negative) at day +28 after CAR-T cell therapy, one patient died due to Mucormycosis at day +31. One patient relapsed after 2 months after HST. Eight patients are alive in CR with a median follow up 291 days (85-388).ConclusionOur early experience suggests that haploidentical CAR-T cells can be safely infused simultaneously with the hematopoietic stem cell graft on the platform of ab T cell depletion. The infusions did not compromise engraftment and GVHD control, while specific CAR-T toxicity was mild and manageable. We have documented allogeneic haploidentical CAR-T expansion and persistence. Prospective testing of the approach is warranted. DisclosuresMaschan: Miltenyi Biotec: Speakers Bureau.

Dynamin-2 Deficiency Causes Neutropenia and Dysplastic Bone Marrow Changes in an Age and Sex Dependent Manner in Mice

▪The dynamins are a family of ubiquitously expressed proteins with GTPase activity and are known for their role in membrane remodeling and intracellular trafficking. However, their exact role within various hematopoietic lineages is incompletely understood. In humans, most of the clinical cases with cytopenia in Charcot-Marie-Tooth (CMT) disease due to dynamin-2 mutations are associated with neutropenia, and CMT patients may suffer from impaired wound healing. Of interest, pregnancy notably worsens CMT disease, possibly due to hormonal changes. Antiprogesterone treatment was successfully given in a CMT rat model, and similar treatment is being considered for human CMT. We previously reported that inhibiting dynamin (DNM) activity impairs migration capability in mature megakaryocytes.We obtained the conditional deletion of Dnm2 and targeted its deletion in hematopoietic tissues with the vav-cre murine strain. Homozygous deletion of Dnm2 in blood tissues appears embryonic lethal. None of the pups born showed a Vav-cre/Dnm-2 fl/fl genotype, whereas a third of the pups born had a Vav-cre/Dnm-2 fl/wt (Dnm2 het) genotype. Bone marrow cells from the heterozygous female mice (Dnm2 het) had 35% to 50% decreased Dnm2 expression in comparison with age-matched controls (CTRL). Evaluation of the complete blood counts demonstrated that Dnm2 het female mice developed leukopenia which was detected from 40 weeks of age (average granulocyte-monocyte counts: CTRL 532/mm3 vs. Dnm2 het 300/mm3; p=0.0164). Neutropenia was unequivocal at 65 weeks of age (average neutrophil counts, CTRL 700/mm3 vs. Dnm2 het 343/mm3, p=0.016). Dnm2 het showed a trend for higher platelet counts than controls, but this was non-statistically significant. Further analysis of hematopoietic lineage maturation by flow cytometry indicated that lineage-negative cells and granulocyte-monocyte progenitors were decreased in Dnm2 het mice (average bone marrow lineage-negative cells: CTRL 2.8x10E6 vs. Dnm2 het 1.97x10E6, p =0.0056; average granulocyte-monocyte progenitors: CTRL 1.35x10E6 vs. Dnm2 het 0.85x10e6, p=0.01), along with a relative increase of common lymphoid progenitors and of megakaryocyte/erythrocyte progenitors in the bone marrow. Immunohistochemical staining for mature neutrophils with Ly6G showed an overall decreased number of mature granulocytes in the bone marrow of Dnm2 het mice (average Ly6G-positive cells: CTRL 20% vs. Dnm2 het 29%, p=0.0026). A linear pattern of distribution of Ly6G positive bone marrow cells along blood vessels was observed in fewer mice in the Dnm2 het group than in the CTRL group (25% vs. 59%, p=0.02), indicating that the migration pattern within the bone marrow is altered in the Dnm2 het group (see Figure). In addition, Dnm2 het mice developed splenomegaly (average spleen weight: Dnm2 het 146 mg vs. CTRL 99 mg, p=0.006), which was secondary to a marked florid reactive germinal center hyperplasia. Some of the Dnm2 het mice, including 5 mice whose pregnancy occurred in middle-age (p=0.005 when comparing with CTRL or young Dnm2 het mice) and 2 non-pregnant older mice, showed physical signs of distress with markedly reduced activity, poor grooming, ruffled furs, and hunched posture. Both non-pregnant sick mice showed a marked decrease in Ly6G positive mature neutrophils at 0.3% of total marrow cells (Figure), and the bone marrow from one mouse was completely effaced by immature myeloid precursors, consistent with the development of acute myeloid leukemia. In addition, a third of Dnm2 hetmice showed no distress but displayed morphological bone marrow abnormalities including megakaryocytic dysmorphology.In summary, female mice with loss of Dnm2 in the hematopoietic compartment develop persistent neutropenia as they age, with decreased granulocyte progenitor production and with migration defects. These abnormalities are associated with a risk for developing megakaryocytic dysplasia, and acute myeloid leukemia. These findings might also suggest a mechanism for chronic idiopathic neutropenia, which has a predominance in middle-aged women. [Display omitted] DisclosuresNo relevant conflicts of interest to declare.

MTOR Signal Pathway Inhibition Promote the Cytotoxicity of Chemotherapy on SHI-1 Cells

Acute myeloid leukemia (AML) is a malignant hematologic disorder. Although current chemotherapy could improve the survival rate of AML patients, some patient would suffer from relapse and had bad therapeutic response. Nowadays, many studies have found that the abnormal expression of mTOR signal pathway is closely related to the occurrence and progression of AML, but the roles of mTOR inhibitor in AML is not elucidated. So, in this paper, we would investigate whether rapamycin, a mTOR inhibitor, could enhance the cytotoxicity of chemotherapy. Rapamycin or chemotherapy (adriamycin plus cytarabine) could inhibit the proliferation and induce apoptosis of SHI-1 cells (the proliferation inhibition rate and apoptosis ratio were 35.4%±2.94% and 13.33%±0.74% respectively in rapamycin group; Chemotherapy group: 49.9%±4.11%, 13.2%±1.11%). When rapamycin were combined with chemotherapy, the proliferation inhibition rate and apoptosis ratio were significantly increased to 60.3%±3.36% and 30%±1.74% respectively (p<0.05) (Fig.1A, Fig.1B). Western blotting shown that chemotherapy could enhance the expression of Bax, Beclin-1 and ATG5, and inhibit the expression of Bcl-2, caspase-3, nevertheless chemotherapy didn't influence the expression of proteins in the mTOR signal pathway. When mTOR signal pathway were inhibited by rapamycin, the proteins of mTOR signal pathway such as mTOR, p-mTOR, P70S6K1, p-P70S61, 4EBP1, p-4EBP1, and the apoptosis related proteins Bcl-2 and caspase3 of SHI-1 cells were decreased, otherwise, the expression of autophagy-related proteins LC3B/II, Beclin-1, ATG5 and apoptosis-related proteins Bax increased. Rapamycin combined with chemotherapy could significantly inhibit the expression of proteins in mTOR signal pathway and enhance the expression of autophagy and apoptosis-related proteins of SHI-1 cells than that treated by rapamycin alone (Fig.1C). In order to explore whether mTOR pathway inhibition could enhance the cytotoxicity of chemotherapy in AML animal model. 1×107 SHI-1 cells were inoculated into NPG mice via tail vein to construct systemic leukemia NPG mice. On the 19th day after inoculation, the ratio of human CD45 and 33 double positive cells in peripheral blood of NPG mice was 1.3%, then NPG mice were randomly divided into four groups, control group didn't had treatment, chemotherapy group was treated by adriamycin (1mg/kg) once every other day for three times and cytarabine (100mg/kg) once a day for five days, rapamycin group was treated by rapamycin (10mg/kg) once a day for five days, and combination group was treated by combination chemotherapy and rapamycin. On the first day (24th day)after treatment, the ratio of human CD33 and CD45 double positive cells in peripheral blood, bone marrow and spleen of NPG mice in each treatment group were: control group (20.3%, 23.6%, 15.6%), chemotherapy group (13.6%, 14.1%, 5.50%), rapamycin group (2.03%, 2.68%, 3.31%), combined group (0.308%, 2.49%, 1.10%) (Fig. 1D). The weight of spleen in NPG mice of combination group were significantly lighter than the weight of spleen of NPG mice of other three groups. Pathological immunohistochemistry showed that the infiltration of human CD45 positive cells in spleen of mice in the combination group was significantly lower than that of the other three groups (Fig. 1E). The median survival time of NPG mice in the control group, chemotherapy group, rapamycin group and combination group were 30.5 days, 35.0 days, 34.0 days and 39.0 days, respectively. The survival time of NPG mice in combination group was significantly longer than that in chemotherapy and rapamycin group (P<0.05), while there was no significant difference between chemotherapy group and rapamycin group (P>0.05) (Fig. 1F). When NPG mice were dead, more neoplasms were found in the NPG mice in control group, the treatment of rapamycin or chemotherapy could significantly decrease the degree of extramedullary infiltration of SHI-1 cells in NPG mice, and fewer neoplasms were found in the NPG mice of combination group(Fig.1G). In conclusion, our studies verified that mTOR signal pathway inhibition by rapamycin could enhance the cytotoxicity of chemotherapy via inhibiting mTOR signal pathway, promoting cell autophagy and inducing apoptosis. mTOR signal pathway may be a potential target for the treatment of AML. Figure 1 Disclosures No relevant conflicts of interest to declare.

Establishment of Human Acute Monocyte Leukemia Model with Systemic Leukemia in Npg Mice

Although tumor cells are easily to growth in the bodies of immunodeficicent animals such as nude mice and NOD-SCID mice, it's hard for acute leukemia cells to grow in the bone marrow of nude mice or NOD-SCID mice even when mice receive extra immunosuppressive treatment such as splenectomy, cyclophosphamide and irradiation. This study aimed to establish a mice model with systemic leukemia using another highly immunodeficicent NPG mice without immunosuppressive treatment before inoculation. 5-week NPG mice were inoculated with 1x107(Group A) or 5x107 (Group B) SHI-1 cells (a cell line derived from a refractory acute monocytic leukemia patient) via tail vein. One NPG mice in each group was killed by ether randomly at the day 14, 21, 28 after inoculation, other NPG mice were observed the survival time. The leukemic cells engrafted in the NPG mice were detected by the following methods: the blast cells were detected by the blood smear and flow cytometer, the MLL-AF6 fuse gene of SHI-1 cells were detected by PCR amplification, the human CD45 positive cells infiltrated in the organs of NPG mice were detected by histopathological examination and immunohistochemistry. At the day 14 after inoculation with SHI-1 cells, fewer blasts cells were found in the smear of peripheral blood of group B; MLL-AF6 fuse gene could be amplified in the spleen of NPG mice in group A and in spleen and bone marrow in group B (Fig A); histopathological examination had shown that CD45 positive leukemia cell just infiltrated in spleen. At the day 21 after inoculation, more blasts were found in the smear of peripheral blood both in group A and B; MLL-AF6 fuse gene were amplified in the organs of NPG mice such as Spleen, liver, kidney, stomach, lung, heart and bone marrow(Fig A); 5.16% and 0.82% of CD45 and CD33 positive cells were detected in the peripheral blood of NPG mice in group A and B respectively; a green solid neoplasm were found in the kidney of NPG mice in group B, leukemia cells were found in the organ of heart, liver, spleen, stomach, kidney and lung in the NPG mice of both groups by histopathological examination. From the third week, the NPG mice presented anorexia, hunched posture, lethargy and weight loss. For the mice sacrificed in the day 28 after inoculation, the proportion of CD45 and CD33 positive cells in peripheral blood, bone marrow and spleen were 9.60%, 11.4% and 23.20% in group A and were 11.0%,37.80% and 60.5% in group B (Fig B). Green solid tumors were grown in many organs such as kidney, liver, spleen, stomach, heart, lymph node and the soft tissues in the NPG mice killed in day 28 after inoculation and the mice which were dead spontaneous (Fig C); When NPG mice were dead, the weight of spleen in group B is significantly higher than the weight of spleen in group A(P<0.05) (Fig D). The median survival time of NPG in group A and group B is 33 and 30 days respectively. Pathological examination and immunohistochemical staining had shown that leukemic cells could infiltrated to many of the organs of NPG mice and the grade of leukemia infiltration was positively correlated with cells numbers of inoculation and the survival time of NPG mice (Fig E). Altogether, SHI-1 cell could growth in the NPG mice without any pre-immunosuppressive treatment and formed a systemic leukemia in NPG mice as like in acute leukemia patients. This efficient and reproducible model may be a useful tool for the studies of the pathogenesis in acute monocytic leukemia. [Display omitted] DisclosuresNo relevant conflicts of interest to declare.

Rapamycin Promote the Inhibition Rate of Proliferation on SHI-1 Cells and Enhance the Efficacy of Chemotherapy in Npg Leukemia Mice

Acute myeloid leukemia (AML) is a malignant hematologic disease. The remission rate of traditional chemotherapy is about 70-80%. In order to improve the efficacy of chemotherapy, some new drug which could enhance the efficacy of chemotherapy should be explored. Rapamycin is an immunosuppressive agent which can regulate cell proliferation, autophagy and other activities by inhibiting mTOR signal pathway. The studies of rapamycin as an anti-leukemia agent were limited. We had successfully establish a leukemia model in NPG mice with systemic leukemia infiltration using the human acute monocytic leukemia cell line SHI-1 cells. So in this study, the rapamycin and/or chemotherapy were used to treat the SHI-1 cells in vitro and NPG leukemia mice to investigate the efficacy of rapamycin in the treatment of AML. Rapamycin alone could effectively inhibit the proliferation of SHI-1 cells in vitro, and the inhibition rate were 35.4% which lower than the inhibition rate chemotherapy group (49.9%) using cytarabine and adriamycin. The combination with rapamycin and chemotherapy could significantly enhanced the inhibition rate to 60.3% (P<0.05) (Fig A). At day 19 after SHI-1 were inoculated to the NPG mice from tail vein, nearly 1% CD45 and CD33 positive cells were found in the peripheral blood. Then the NPG mice were divided to 4 groups to receive treatment. Control group without any treatment, rapamycin group were intraperitoneally injected with rapamycin (10mg/kg) every day for 5 days, chemotherapy group were intraperitoneally injected with cytarabine (100mg/kg for 5 days) and adriamycin (1mg/kg every other day for 3 times), combined group were treated with rapamycin, cytarabine and adriamycin. At the first day after treatment, one NPG mice were sacrificed randomly in four groups. The weight of the spleen in control group, rapamycin group, chemotherapy group and combination group were 78.6 mg, 48.9 mg, 16.1 mg, 11.7 mg respectively (Fig B). The ratio of human CD33 and CD45 positive cells in peripheral blood, bone marrow and spleen of NPG mice were 20.2%, 23.2% and 16.8% in control group, 2.02%, 2.68% and 3.31% in rapamycin group, 13.6%, 14.2% and 5.50% in chemotherapy group, 0.31%, 2.49% and 1.22% in combined group respectively (Fig C). Histopathological results showed that the degree of leukemia infiltration in the organs of NPG in the rapamycin group, chemotherapy group, and the combined group was significantly less than that of the control group. The median survival time of NPG mice in control group was 30.5 days. The treatment of rapamycin or chemotherapy could significantly prolong the media survival time of NPG mice to 35.0 and 34.0 days (P<0.05). When combined rapamycin with chemotherapy, the life time of NPG mice were significantly extended to 39 days (P<0.05) (Fig D). When NPG mice were died, more neoplasms were grow in the organs such as kidney, liver, stomach, mesenteric, mediastinum, bladder, spine, skin and neck in the NPG mice of control group, the treatment of rapamycin, chemotherapy and combined treatment would significantly decrease the counts of infiltrative organ with leukemia cells (Fig E). Altogether, our studies verified that rapamycin could inhibit the growth of SHI-1 cells and enhance the efficacy of chemotherapy in vitro. In NPG leukemia mice, the treatment of rapamycin alone could gain the efficacy as in chemotherapy group, when combined with chemotherapy, rapamycin had synergistic effect to significantly enhance the efficacy of chemotherapy to prolong the median survival time and decrease the degree of leukemia infiltration in NPG mice. DisclosuresNo relevant conflicts of interest to declare.

Feasibility and Benefit of Molecularly-Informed Enrollment into Personalized Therapies or Early Phase Trials for Patients with Relapsed or Refractory Multiple Myeloma

Background: Treatments of patients with relapsed or refractory multiple myeloma (r/r MM) remains a challenge and there is no molecular-informed personalized therapies available in this context. Cytogenetics and next-generation sequencing (NGS) panels can rapidly identify recurrent molecular abnormalities, thus helping to orient patients (pts) in appropriate targeted therapies or clinical trials. We aimed to evaluate whether selecting pts through tumor genotyping is associated with a better outcome.Methods: From 2013 to 2018, all pts with r/r MM screened for molecular and/or cytogenetics before enrollment in early clinical trials (eaCTs) were included. Molecular screening methods included bone marrow cytogenetics, sanger assays for BRAF screening or next-generation sequencing on sorted CD138 positive bone-marrow cells. The actionable targets and therapies related were BRAF V600E mutation with BRAF inhibitor and t(11;14) with BCL2 inhibitor. The objective were to evaluate the feasibility and potential benefit of using tumor genotyping to orient patients with molecularly-informed multiple myeloma in personalized therapies or eaCTs. The tumor responses rates, median duration of treatments and overall survival (OS) were assessed in molecularly oriented (MO) and non-molecularly oriented (non-MO) pts. Efficacy was evaluated using International Myeloma Working Group Uniform Response Criteria.Results: Forty-six pts with r/r MM were enrolled, mean age was 66 y (range 52-81), median of previous lines of therapies was 3 (range 1-8). Prior systemic therapies included immunomodulatory agents (n=46, 100%), alkylating agents (n=43, 94%) or proteasome inhibitors (n=44, 95%), and 28 (62%) pts had previously received auto stem-cell transplant. Identification of potentially actionable targets was found in 13 (28%) pts, including 8 (17%) pts with t(11;14) and 5 (11%) pts with BRAF V600E mutations. Eight (17%) out of the 46 pts were treated in molecularly oriented (MO) personalized therapies or eaCTs, and 38 (83%) pts were treated in non-MO therapies or eaCTs. The MO pts received BRAF inhibitor alone or in combination with MEK inhibitor (n=5), or BCL2 inhibitor given in combination with bortezomib and dexamethasone (n=3). The overall response rate was 75% (4 VGPR, 1 PR and 1 CR) in MO pts versus 11% (4 PR) in non-MO pts (p<0.0001). The median decrease of serum monoclonal component was -94% (range: -99; -55) in MO pts versus -4% (range: -72; +967) in the non-MO pts (p<0.0001). The median durations of treatment were 7.3 [CI95: 0.5-29.0] months and 2.3 [CI95: 1.7-8.0] months in MO and non-MO pts, respectively (p=0.009). The median OS were not reached in MO pts and 43 months in non-MO pts (p=0.76; HR=0.8 [CI95: 0.2-3.4]).Conclusions: Molecular-oriented treatments of relapse or recurrent multiple myeloma can be associated with higher responses rates and prolonged durations on therapy. Accelerating the use of prospective genomics tumor molecular portraits may increase the chances of precision medicine for patients with relapse or recurrent multiple myeloma. DisclosuresLe Bras:Amgen: Consultancy. Belhadj:Amgen: Consultancy, Honoraria; Janssen: Consultancy, Honoraria; Takeda: Consultancy, Honoraria; Celgene: Consultancy, Honoraria. Soria:Medimmune: Employment. Ribrag:Amgen: Research Funding; Gilead: Consultancy, Honoraria; Infinity: Consultancy, Honoraria; Incyte Corporation: Consultancy; BMS: Consultancy, Honoraria, Other: travel; epizyme: Consultancy, Honoraria; argenX: Research Funding; MSD: Honoraria; pharmamar: Other: travel; Servier: Consultancy, Honoraria; NanoString Technologies: Consultancy, Honoraria; Roche: Honoraria, Other: travel.

Abstract LB-332: Evidence for cutaneous squamous tumors derived from carcinogen-exposed bone marrow

Abstract Cytokeratins are frequently found in the blood and bone marrow of patients with epithelial cancers and are attributed to metastasis. We wondered whether we could find keratin expression in blood and bone marrow in untreated adult mice. To address this problem, we have used classical immunoreactivity, Krt1-14;mTmG transgenic mice together with fluorescence activated cell sorting, and quantitative reverse transcriptase polymerase chain reaction. We have made several novel findings. First, we discovered, rare but distinctive, keratin-14 and keratin-15 immunoreactive cells the size of small lymphocytes in blood and bone marrow of untreated mice. Second, using Krt1-14;mTmG transgenic mice, we found low (8.6 GFP positive cells per 10^6 cells analyzed), but significant numbers (p&amp;lt0.0005) of GFP positive cells in bone marrow of normal adult mice when compared with negative controls. Third, qRT-PCR demonstrated very low but reproducibly detectable expression of keratin-14 mRNA in blood and bone marrow when compared with epidermal keratinocytes: with blood expressing one thousand times, and bone marrow, one hundred thousand times, less than epidermal keratinocytes. Moreover, FACS analysis of fresh bone marrow disclosed a subpopulation of keratin-14 immunoreactive cells that was negative for hematopoietic lineage markers. Furthermore, and even more curious, recipients of bone marrow transplants from DMBA-treated UBC/GFP mice (“toxic bone marrow”) developed GFP-immunoreactive skin tumors upon TPA tumor promotion: four of fifteen mice developed GFP-immunoreactive skin tumors. Of these tumors, four were squamous papillomas, and one was a squamous cell carcinoma. None of the ten control mice receiving normal whole bone marrow developed any skin tumors upon tumor promotion. We conclude from these observations that keratin-14 protein and mRNA are expressed at low, but detectable levels in the blood and bone marrow of mice, and that a subset of “toxic bone marrow” derived cells can be recruited to form epithelial benign and malignant squamous tumors. Building upon these observations should open new avenues of understanding for cutaneous biology, non-melanoma skin cancer, and other epithelia and their cancers. Citation Format: Sonali Lad, Kelly Johnson, Kelsey Boland, Nyssa Readio, Todd Schuster, Yong Li, Derek Gordon, Rebecca J. Morris. Evidence for cutaneous squamous tumors derived from carcinogen-exposed bone marrow [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2018; 2018 Apr 14-18; Chicago, IL. Philadelphia (PA): AACR; Cancer Res 2018;78(13 Suppl):Abstract nr LB-332.

Methylation and expression of mismatch repair gene human mutS homolog 2 in myelodysplastic syndromes.

As a highly heterogeneous disease, the pathogenesis of myelodysplastic syndrome (MDS) has not been well defined. In the present study, human mutS homolog 2 (hMSH2) promoter methylation was detected with methylation-specific polymerase chain reaction (PCR). The function of hMSH2 was analyzed by microsatellite instability (MSI) detection of BAT-26, and hMSH2 expression was evaluated using reverse transcription-quantitative PCR in 60 patients with MDS. The results revealed methylation of the hMSH2 promoter in 18 patients with MDS who have an overall prevalence of 30% (95% confidence interval, 18.4-41.6%). Among the patients with hMSH2 methylation, 2 patients exhibited MSI. It was demonstrated that hMSH2 promoter methylation was increased in MDS with an increase in Revised International Prognostic Scoring System (IPSS-R) risk, and patients with higher hMSH2 promoter methylation had shorter overall survival by Kaplan-Meier analysis (P=0.011). In addition, it was also observed that decreased hMSH2 mRNA expression was associated with high IPSS-R risk group (high/very high vs. intermediate, P=0.003), and hMSH2 mRNA expression in CD34 positive bone marrow cells was lower compared with that in CD34 negative cells of patients with MDS (P=0.029). Methylation of hMSH2 may be valuable for prognostic evaluation and progression prediction of MDS. Furthermore, hMSH2 may serve a key function in the pathogenesis and prognosis of MDS.

Influence of Different Irradiation Protocols on Vascularization and Bone Formation Parameters in Rat Femora.

Aim of the present study was the establishment of an efficient and reproducible model for irradiation of rat femora as a model for impaired osteogenesis and angiogenesis. Four different irradiation protocols were compared: single irradiation of the left femur with 20 Gy and explantation after 4 or 8 weeks (group A, B) and three irradiation fractions at 3-4 days intervals with 10 Gy and explantation after 4 or 8 weeks (group C, D). The contralateral, unirradiated femur served as control. Evaluation included histology, microcomputertomography (μCT), and real-time polymerase chain reaction. Histology showed a pronounced increase of vacuoles in bone marrow after irradiation, especially after 4 weeks (group A and C), demonstrating bone marrow edema and fatty degeneration. Irradiation provoked a decrease of total cell numbers in cortical bone and of hypoxia-inducible factor 1 alpha (HIF1α)-positive cells in bone marrow. The expression of several markers (osteocalcin [OCN], runt-related transcription factor 2 [RUNX2], transforming growth factor beta 1 [TGFβ1], tumor necrosis factor alpha [TNFα], vascular endothelial growth factor A [VEGFA], and HIF1α) was decreased in group A after irradiation. This might suggest a decreased metabolism after irradiation. A significant decrease in small-sized vessels was seen in μCT evaluation in group A and D. Single irradiation with 20 Gy had the most severe and reproducible impact on osteogenesis and angiogenesis after 4 weeks while being well tolerated by all animals, thus making it an excellent model for evaluation of bone healing and vascularization in irradiated tissue.

BCL2L10 positive cells in bone marrow are an independent prognostic factor of azacitidine outcome in myelodysplastic syndrome and acute myeloid leukemia.

Azacitidine (AZA), the reference treatment for most higher-risk myelodysplastic (MDS) patients can also improve overall survival (OS) in elderly acute myeloid leukemia (AML) patients ineligible for intensive chemotherapy, but reliable biological markers predicting response and OS in patients treated with AZA are lacking. In a preliminary study, we found that an increase of the percentage of BCL2L10, an anti-apoptotic member of the bcl-2 family, was correlated with AZA resistance. In this study, we assessed prospectively by flow cytometry the prognostic value of BCL2L10 positive bone marrow mononuclear cells in 70 patients (42 MDS and 28 AML), prior to AZA treatment.In patients with baseline marrow blasts below 30%, the baseline percentage of bone marrow BCL2L10 positive cells inversely correlated with response to AZA and OS independently of the International Prognostic Scoring System (IPSS) and IPSS-revised (IPSS-R). Specifically, OS was significantly lower in patients with more than 10% BCL2L10 positive cells (median 8.3 vs 22.9 months in patients with less than 10% positivity, p = 0,001). In summary, marrow BCL2L10 positive cells may be a biomarker for azacitidine response and OS, with a potential impact in clinical practice.

Dual roles for bone marrow-derived Sca-1 cells in cardiac function.

Recruitment of stem cells from the bone marrow (BM) is an important aspect of cardiac healing that becomes inefficient with age. We investigated the role of young stem cell antigen 1 (Sca-1)-positive BM cells on the aged heart by microarray analysis after BM reconstitution. Sca-1+ and Sca-1- BM cells from young green fluorescent protein (GFP)-positive mice were used to reconstitute the BM of aged mice. Myocardial infarction (MI) was induced 3 mo later. GFP+ cells were more abundant in the BM, blood, and heart of Sca-1+ mice, which corresponded to preserved cardiac function after MI. At baseline, Sca-1+ BM reconstitution increased cardiac expression of serum response factor, vascular endothelial growth factor A, and myogenic genes, but reduced the expression of Il-1β. After MI, inflammation was identified as a key difference between Sca-1- and Sca-1+ groups, as cytokine expression and cell surface markers associated with inflammatory cells were up-regulated with Sca-1+ reconstitution. Mac-3 and F4/80 staining showed that the postinfarction heart was composed of a mixture of GFP+ (donor) macrophages, GFP- (host) macrophages, and GFP+ cells that did not contribute to the macrophage population. This study demonstrates that Sca-1+ BM cells regulate cardiac healing though an acute inflammatory response and also before injury by stimulating formation of a beneficial cardiac niche.-Tobin, S. W., Li, S.-H., Li, J., Wu, J., Yeganeh, A., Yu, P., Weisel, R. D., Li, R.-K. Dual roles for bone marrow-derived Sca-1 cells in cardiac function.

Beetroot (Beta vulgaris) rescues mice from γ-ray irradiation by accelerating hematopoiesis and curtailing immunosuppression

Context: Beetroot [Beta vulgaris Linné (Chenopodiaceae)], a vegetable usually consumed as a food or a medicinal plant in Europe, has been reported to have antioxidant and anti-inflammatory properties. Since the lymphohematopoietic system is the most sensitive tissue to ionizing radiation, protecting it from radiation damage is one of the best ways to decrease detrimental effects from radiation exposure. Objective: In this study, we evaluated the radio-protective effects of beetroot in hematopoietic stem cells (HSCs) and progenitor cells. Materials and methods: Beetroot extract was administered at a dose of 400 mg/mouse per os (p.o.) three times into C57BL/6 mice and, at day 10 after γ-ray irradiation, diverse molecular presentations were measured and compared against non-irradiated and irradiated mice with PBS treatments. Survival of beetroot-fed and unfed irradiated animal was also compared. Results: Beetroot not only stimulated cell proliferation, but also minimized DNA damage of splenocytes. Beetroot also repopulated S-phase cells and increased Ki-67 or c-Kit positive cells in bone marrow. Moreover, beetroot-treated mice showed notable boosting of differentiation of HSCs into burst-forming units-erythroid along with increased production of IL-3. Also, beetroot-treated mice displayed enhancement in the level of hematocrit and hemoglobin as well as the number of red blood cell in peripheral blood. Beetroot diet improved survival rate of lethally exposed mice with a dose reduction factor (DRF) of 1.1. Discussion and conclusion: These results suggest that beetroot has the potency to preserve bone marrow integrity and stimulate the differentiation of HSCs against ionizing radiation.

Patient-Derived Induced Pluripotent Stem Cells Identified SLITRK4 As a Causative Gene of Chronic Myelomonocytic Leukemia

Chronic myelomonocytic leukemia (CMML), the most frequent disease entity of myelodysplastic syndrome/myeloproliferative neoplasm is a clonal hematopoietic malignancy that is characterized by persistent monocytosis, morphologic myeloid dysplasia, and progression to acute myeloid leukemia. The pathogenesis of CMML remains entirely elusive because of the lack of suitable mouse models and the difficulties in the establishment of CMML cell lines.We have previously reported that we established induced pluripotent stem cells (iPSC) from CMML CD34 positive leukemic cells (CMML-iPSC) as a new disease model. Co-cultured with C3H10T1/2 stromal cells in the presence of vascular endothelial growth factor, CMML-iPSC generated CD34 CD43 double-positive hematopoietic progenitor cells (CMML-HPC). CMML-HPC have recapitulated important disease features of parental CMML cells in terms of genetic abnormalities, acceleration of cell proliferation, and aberrant surface markers expression. In addition, a novel human CMML xenograft mouse model has been established through secondary transplantation of human HPCs from CMML-iPSC-derived teratomas. This model produced HPCs that mimicked the properties of CMML in vivo.To identify key molecular abnormalities that contribute to the pathophysiology of CMML, we conducted comprehensive gene expression and DNA methylation profiling analyses of normal and CMML parental CD34 positive cells, iPSC, and their hematopoietic progenies, respectively. Correlation analysis revealed that gene expression and DNA methylation status between normal and CMML iPSC-derived HPC exhibited similar pattern (R2 = 0.92 and 0.96, respectively), although normal and CMML parental CD34 positive cells were quite different (R2 = 0.72 and 0.90, respectively), indicating that reprogramming followed by re-differentiation may enable to obtain more homogenous population of normal and CMML cells that reside in almost the same differentiation stage. These results allowed us to determine the difference in the genetic and epigenetic status between normal and CMML iPSC-derived HPC, which remained through reprogramming and re-differentiation, in order to find out causative genes in the pathogenesis of CMML.Using these combined omics platforms, we identified SLIT and NTRK like family member 4 (SLITRK4) as a candidate gene involving in pathogenesis of CMML, whose expression was enhanced and whose promoters were hypo-methylated in CMML-HPC. In other CMML patients' CD34 positive leukemic cells, the expression of SLITRK4 was up-regulated compared to healthy CD34 positive bone marrow cells and other leukemia cells. In addition, we revealed SLITRK4 had pro-proliferative activity as the knockdown of SLITRK4 inhibited proliferation of leukemic cell lines OCI-AML3. To elucidate whether SLITRK4 exert any biological functions in CMML, we established CMML-iPSC clones harboring hetero-knockout (wt/-) or homo-knockout (-/-) of SLITRK4 gene by CRISPR/Cas9 system. Although SLITRK4 (wt/-) and (-/-) clones did not exhibit any morphological and proliferative difference in CMML-iPSC, the production of HPC from CMML-iPSC was dramatically attenuated in SLITRK4-dependent manner. Therefore, while little has been known about the roles of SLITRK molecules in tumorigenesis, we demonstrated SLITRK4 was indispensable for generation of CMML leukemic cells and suggested the possibility of novel molecular therapy targeting SLITRK4, based on the findings obtained from our combined omics platforms.In summary, we identified SLITRK4 as a novel candidate gene responsible for the pathogenesis of CMML through our combined omics platform using patient-derived iPSC. This platform may provide a potential to trace causative genes in a variety of diseases. DisclosuresKataoka:Kyowa Hakko Kirin: Honoraria; Boehringer Ingelheim: Honoraria; Yakult: Honoraria.

Usp18 Is Required for Normal Stem Cell Maintenance

Stable and permanent hematopoiesis is established from the most primitive long-term self-renewing hematopoietic stem cells (LT-HSC), which can give rise to more differentiated short-term (ST-HSC) and multi-potent progenitors (MPP). Progenitors further differentiate into more committed cells that can generate the mature lymphoid and myeloid lineages. In order to maintain a normal hematopoietic system, HSCs must be properly regulated.We previously cloned Ubiquitin Specific Protease 18 (USP18/UBP43) during analysis of hematopoietic cells of t(8;21) AML fusion protein AML1-ETO knock-in mice (Liu et al, 1999 Mol Cell Biol 19:3029-3038; Schwer et al, 2000 Genomics 65, 44-52). However, its function in hematopoiesis, especially in hematopoietic stem cells, has not been carefully examined.We show here that depletion of Usp18 in C57/BL6 mice leads to death at embryonic days 13.5-14.5 with less fetal liver cellularity. To examine the precise role of Usp18 in vivo, we generated Usp18 conditional knockout mice (Usp18f/f). Survival analyses of Usp18f/- crossed with Usp18f/+Vav-iCre revealed that the embryonic lethality of Usp18 -deficient mice is due to defects in hematopoiesis. To examine the hematopoietic potential of fetal liver cells of Usp18-deficient mice, we conducted a colony forming assay using the E12.5 fetal livers. All types of colonies as well as the number of total cells from colonies were substantially reduced in Usp18-/- fetal liver compared to control, indicating that the blood progenitor cells of Usp18-/- fetal liver are not fully functional. To assess whether Usp18 is required for fetal liver HSC maintenance, we determined the frequency of HSCs in the fetal liver of Usp18+/+, Usp18+/-, and Usp18-/-. We detected the Lin- Sca-1+ c-Kit+ (LSK) cell population, which is HSC-enriched population in fetal livers, in mice of all three genotypes. Recent studies indicate that the most primitive LT-HSC population in fetal livers includes ESAM positive (LSK CD48- CD150+ ESAM+) stem cells (Ooi et al, 2009 Stem Cells 27:653-661; Pietras et al, 2014 JEM 211:245-262). Both the frequency and absolute numbers of the LT-HSC population in Usp18-/- fetal livers were appreciably reduced compared to wild-type. Taken together, we conclude that Usp18 is indispensable for fetal liver HSC maintenance.We then addressed whether Usp18 is required for the HSC maintenance in adult mice by analyzing the frequency of HSCs in UBCER-Cre negative or positive Usp18f/- bone marrow cells. After tamoxifen injections, we observed a significant reduction in the frequency of the LT-HSC population in Usp18f/-UBCER-Cre positive bone marrow cells compared to Usp18f/-UBCER-Cre negative ones. Consistent with these results, Usp18f/-UBCER-Cre positive bone marrow cells were much less competitive than Cre negative cells by competitive bone marrow transplantation assay.Finally, to examine whether the suppression of Usp18 in the leukemic cells provides a survival benefit, we used secondary-transplanted mice receiving Usp18f/fUBCER-Cre positive AML1-ETO9a leukemia cells (5 × 10 5 EGFP+ cells) isolated from primary transplanted mice. The tamoxifen treatment was initiated 3 weeks after transplantation. All the mice in the vehicle injected group (n = 7) succumbed to leukemia within a week after treatment started. However, mice treated with tamoxifen (n = 7) showed a longer survival time. Five of seven mice are still alive after 5 weeks of bone marrow transplantation, demonstrating the critical role of USP18 in maintenance of leukemia stem cells. Collectively, we conclude that Usp18 is essential for hematopoietic stem cell maintenance, and specific modulating activity of USP18 in leukemic cells may be considered as an effective therapeutic approach. DisclosuresNo relevant conflicts of interest to declare.

Novel Acylguanidine Derivatives Targeting Smoothened Induce Antiproliferative and Pro-Apoptotic Effects in Chronic Myeloid Leukemia Cells.

The most relevant therapeutic approaches to treat CML rely on the administration of tyrosine kinase inhibitors (TKIs) like Imatinib, which are able to counteract the activity of Bcr-Abl protein increasing patient’s life expectancy and survival. Unfortunately, there are some issues TKIs are not able to address; first of all TKIs are not so effective in increasing survival of patients in blast crisis, second they are not able to eradicate leukemic stem cells (LSC) which represent the major cause of disease relapse, and third patients often develop resistance to TKIs due to mutations in the drug binding site. For all these reasons it’s of primary interest to find alternative strategies to treat CML. Literature shows that Hedgehog signaling pathway is involved in LSC maintenance, and pharmacological inhibition of Smoothened (SMO), one of the key molecules of the pathway, has been demonstrated to reduce Bcr-Abl positive bone marrow cells and LSC. Consequently, targeting SMO could be a promising way to develop a new treatment strategy for CML overcoming the limitations of current therapies. In our work we have tested some compounds able to inhibit SMO, and among them MRT92 appears to be a very potent SMO antagonist. We found that almost all our compounds were able to reduce Gli1 protein levels in K-562 and in KU-812 CML cell lines. Furthermore, they were also able to increase Gli1 and SMO RNA levels, and to reduce cell proliferation and induce apoptosis/autophagy in both the tested cell lines. Finally, we demonstrated that our compounds were able to modulate the expression of some miRNAs related to Hedgehog pathway such as miR-324-5p and miR-326. Being Hedgehog pathway deeply implicated in the mechanisms of CML we may conclude that it could be a good therapeutic target for CML and our compounds seem to be promising antagonists of such pathway.