Portable Incubator Research Articles

Portable neonatus incubator based on global positioning system

<p>The role of baby incubator is crucial in assisting premature babies to adjust to their new surroundings. However, the current baby incubator causes challenges when used for emergency first aid. The challenge is often because of its cumbersome size, which makes transportation to referral hospitals difficult. To address this issue, portable neonate incubator based on the global positioning system (GPS) was developed. The results of implementation testing showed that the incubator system effectively monitored longitude and latitude coordinates, as well as the temperature and humidity of the incubator room, and the body temperature of neonates. Weighing approximately 5.8 kg, this incubator was versatile, compatible with both AC and DC voltage power sources, and came equipped with a carrying bag for easy transportation by midwives or medical personnel. Consequently, this development marked an innovative advancement in neonate incubator medical equipment, facilitating the swift tracking of the neonate incubator's coordinate position in case of unexpected events on the way to the hospital.</p>

Self-Diagnosis of SARS-CoV-2 from Saliva Samples at Home: Isothermal Amplification Enabled by Do-It-Yourself Portable Incubators and Laminated Poly-ethyl Sulfonate Membranes.

COVID-19 made explicit the need for rethinking the way in which we conduct testing for epidemic emergencies. During the COVID-19 pandemic, the dependence on centralized lab facilities and resource-intensive methodologies (e.g., RT-qPCR methods) greatly limited the deployment of widespread testing efforts in many developed and underdeveloped countries. Here, we illustrate the development of a simple and portable diagnostic kit that enables self-diagnosis of COVID-19 at home from saliva samples. We describe the development of a do-it-yourself (DIY) incubator for Eppendorf tubes that can be used to conduct SARS-CoV-2 detection with competitive sensitivity and selectivity from saliva at home. In a proof-of-concept experiment, we assembled Eppendorf-tube incubators at our home shop, prepared a single-tube mix of reagents and LAMP primers in our lab, and deployed these COVID-19 detection kits using urban delivery systems (i.e., Rappifavor or Uber) to more than 15 different locations in Monterrey, México. This straightforward strategy enabled rapid and cost-effective at-home molecular diagnostics of SARS-CoV-2 from real saliva samples with a high sensitivity (100%) and high selectivity (87%).

Rapid and sensitive detection of two fungal pathogens in soybeans using the recombinase polymerase amplification/CRISPR-Cas12a method for potential on-site disease diagnosis.

Diaporthe aspalathi and Diaporthe caulivora are two of the fungal pathogens causing soybean stem canker (SSC) in soybean, which is one of the most widespread diseases in soybean growing regions and can cause 100% loss of yield. Current methods for the detection of fungal pathogens, including morphological identification and molecular detection, are mostly limited by the need for professional laboratories and staff. To develop a detection method for potential on-site diagnosis for two of the fungal pathogens causing SSC, we designed a rapid assay combining recombinase polymerase amplification (RPA) and CRISPR-Cas12a-based diagnostics to specifically detect D. aspalathi and D. caulivora. The translation elongation factor 1-alpha gene was employed as the target gene to evaluate the specificity and sensitivity of this assay. The RPA/CRISPR-Cas12a system has excellent specificity to distinguish D. aspalathi and D. caulivora from closely related species. The sensitivities of RPA/CRISPR-Cas12a-based fluorescence detection and lateral flow assay for D. aspalathi and D. caulivora are 14.5 copies and 24.6 copies, respectively. This assay can detect hyphae in inoculated soybean stems at 12 days after inoculation and has a recovery as high as 86% for hyphae-spiked soybean seed powder. The total time from DNA extraction to detection was not more than 60 min. The method developed for rapid detection of plant pathogens includes DNA extraction with magnetic beads or rapid DNA extraction, isothermal nucleic acid amplification at 39 °C, CRISPR-Cas12a cleavage reaction at 37 °C, and lateral flow assay or endpoint fluorescence visualization at room temperature. The RPA and CRISPR-Cas12a reagents can be preloaded in the microcentrifuge tube to simplify the procedures in the field. Both RPA and CRISPR-Cas12a reaction can be realized on a portable incubator, and the results are visualized using lateral flow strips or portable flashlight. This method requires minimal equipment and operator training, and has promising applications for rapid on-site disease screening, port inspection, or controlling fungal pathogen transmission in crop. © 2023 Society of Chemical Industry.

One-Step Reverse-Transcription Recombinase-Aided Amplification CRISPR/Cas12a-Based Lateral Flow Assay for Fast Field Screening and Accurate Differentiation of Four Major Tobamoviruses Infecting Tomato and Pepper.

Several tobamoviruses cause substantial economic losses to tomato and pepper crops globally, especially the pepper mild mosaic virus (PMMoV), tomato brown rugose fruit virus (ToBRFV), tomato mosaic virus (ToMV), and tomato mottle mosaic virus (ToMMV). A fast and accurate detection method is essential for virus identification. An all-in-one reaction method combining a one-step reverse-transcription recombinase-aided amplification (RT-RAA) and CRISPR/Cas12a-based lateral flow assay in one mixture was developed to rapidly screen and accurately differentiate among these four tobamoviruses for field detection in tomato and pepper plants. With a generic RT-RAA primer set and a mix of four specific crRNAs, along with a portable metal incubator and the use of a crude extraction method, this method screened for PMMoV, ToBRFV, ToMV, and ToMMV concurrently in less than 1 h, enabling field workers to take action immediately. The accurate differentiation of these four viruses could be achieved by later adding a single specific crRNA.

A portable and low-cost incubator system enabling real-time cell imaging based on a smartphone

A portable and low-cost incubator system enabling real-time cell imaging based on a smartphone

Phase change materials for portable isothermal incubators as a solution to shorten effective analysis times in microbiological quality control of drinking water.

The microbiological quality control of water for human consumption of parameters relevant as E.coli and total coliforms does not start on the field despite the existence of test methods that could make it possible. One of the things that makes this difficult is the possibility of initiating an effective and reliable incubation at the sampling site. The appearance of isothermal media with phase change materials solves this limitation. When phase change materials combine a relatively high melting heat with a suitable melting temperature adapted to the application temperature, they become excellent materials for thermal protection and for thermal energy storage. Starting the test at the same sampling point means that the effective times to obtain a result are shorter, improving water quality control. On the other hand, operationally, it also allows longer sampling routes. Both aspects are essential for managers responsible for controlling water quality for human consumption. In this work, the evidence that demonstrates the feasibility of this approach is presented.

Liquid storage of porcine in vitro-produced blastocysts; a practical approach for short storage.

Commercial application of embryo transfer in pig breeding is dependent on the storage of embryos. The aim of this study was to assess the embryo quality of in vitro-produced blastocysts after 3 h liquid storage at 37°C in CO2-free medium by evaluating morphology, in vitro developmental capacity and apoptosis. Blastocysts at days 5 and 6 post-fertilization were randomly allocated to the storage group (HEPES-buffered NCSU-23 medium including bovine serum albumin in a portable embryo transport incubator at 37°C) or a control group (porcine blastocyst medium in a conventional culture incubator). Thereafter, blastocysts were evaluated for morphology and stained to assess apoptosis straight after the 3 h storage period or after a further 24 h conventional incubation. There was no significant difference between the storage and control group after 3 h storage and the further 24 h conventional incubation for any of the parameters, nor for apoptosis straight after the 3 h storage. Embryos that reached the blastocyst stage at day 5 showed less apoptosis (6.6% vs 10.9%, P = 0.01) and a trend for a higher rate of developmental capacity (70.6% vs 51.5%, P = 0.089) than embryos reaching the blastocyst stage on day 6. In conclusion, in vitro-produced porcine blastocysts can be stored for 3 h at physiological temperature in transportable incubators using a CO2-independent medium without compromising quality.

Case Report: Presence of volatile organic compounds (VOCs) in the OPU-oocyte searching room and its effect on equine in vitro embryo production

Volatile organic compounds (VOCs) are hydrocarbon-based organic compounds with known detrimental effects on mammalian in vitro embryo development. Only strict air quality monitoring guarantees optimal culture conditions. Our VOC-free laboratory receives bovine and equine oocytes collected by OPU from nine different stations, to produce bovine and equine embryos in vitro by in vitro fertilization (IVF) or intracytoplasmic sperm injection (ICSI) respectively. During fourteen consecutive equine OPU sessions, the mean blastocyst rate obtained from the oocytes collected at one of the stations were the lowest (10.4 %), when compared to the others (31.8 %). The quality of the air was suspected and passive absorption badges were placed for 5 days near where oocytes were searched for and further processed before transport (Old Room). The badges were returned for chromatographic analysis and the results indicated a poor air quality. Alcohol compounds exceeded by two-fold the recommended threshold for offices and living rooms (Ethanol: 335 ppb and Isopropanol: 129 ppb). The oocyte searching room was then moved to a different location within the station (New Room), to allow restricted access and improved air quality conditions. In vitro embryo production rates were monitored for anothereleven OPU sessions after moving the oocyte searching room to the new location. The OPU, ICSI and in vitro culture (IVC) conditions remained the same throughout the experiment. Briefly, oocytes were collected by ovum pick up (OPU) and transported to the laboratory overnight in 5 ml tubes, containing in vitro maturation (IVM) medium (IVF-Bioscience, UK) in a portable incubator at 38.2 ˚C and 5 % CO2. After 32 h of IVM, ICSI was performed on all MII oocytes and injected oocytes were cultured for nine days in Global medium (Cooper Surgical, Denmark), at 38˚C, 5 % CO2 and 5 % O2. The oocyte maturation, cleavage and blastocyst rates obtained from oocytes selected and packed in the Old vs. New Room were analyzed by ANOVA and compared by Fisher's exact test. There was no significant difference between the maturation (51.06 % vs. 48.94 %) and cleavage rates (68.75 % vs. 82.61 %) using oocytes selected and packed in the Old vs. New Room respectively. Blastocyst rates significantly improved after moving the oocyte search room to the new location: 10.42 % (5/48) for Old Room vs. 39.13 % (9/23) for New Room (P<0.01). The present work demonstrates the importance of controlling the conditions in the OPU oocyte collection room, with evidence suggesting an effect of VOCs on in vitro embryo development.

Efficacy Evaluation of NK Cell Activity Measurement in Portable Incubator

Efficacy Evaluation of NK Cell Activity Measurement in Portable Incubator

Portable rapid detection of maize chlorotic mottle virus using RT-RAA/CRISPR-Cas12a based lateral flow assay.

Maize lethal necrosis seriously threatens maize production worldwide, which was caused by coinfection by maize chlorotic mottle virus (MCMV) and a potyvirid. To effectively control maize lethal necrosis, it is vital to develop a rapid, sensitive, and specific detection method for the early diagnosis of MCMV in host plant tissues. We established a rapid detection procedure by combining the one-step reverse-transcription recombinase-aided amplification (one-step RT-RAA) and CRISPR/Cas12a-based lateral flow assay in one tube (one-tube one-step RT-RAA/CRISPR-Cas12a), which can be implemented on a portable metal incubator at 37~42°C. Furthermore, the crude extract of total RNA from plant materials using alkaline-PEG buffer can be directly used as the template for one-step RT-RAA. The developed one-tube one-step RT-RAA/CRISPR-Cas12a lateral flow assay can detect as low as 2.5 copies of the coat protein (CP) gene of MCMV and 0.96 pg of the total RNA extracted from MCMV infected maize leaves. Furthermore, the MCMV infected maize leaves at 5 dpi having no obvious symptoms was detected as weak positive. The crude extraction method of total RNA from plant materials required no complicated device, and all the procedures could be implemented at room temperature and on a portable metal incubator, costing a total time of about 1h. The one-step RT-RAA reagents and CRISPR/Cas12a reagents can be lyophilized for easy storage and transportation of reagents, which makes this method more feasible for the filed detection. This method presents rapidness, robustness and on-site features in detecting viral RNA, and is a promising tool for the field application in minimally equipped laboratories.

A recombinase polymerase amplification lateral flow assay for rapid detection of Burkholderia pseudomallei, the causative agent of melioidosis.

Burkholderia pseudomallei causes a fatal and infectious disease, melioidosis or Whitmore's disease in humans and animals. Melioidosis is present in different parts of the world and is endemic in Southeast Asia and Northern Australia. Accurate diagnosis of melioidosis is difficult due to its common flu-like symptoms, potentially long incubation period and erroneous identification as culture contaminant. Early diagnosis of the disease is essentially required for administration of suitable antibiotics and disease containment. The present study reports a rapid, specific and sensitive recombinase polymerase amplification lateral flow assay for detection of B. pseudomallei. Specific primers and probe were designed and the assay was performed at 41°C for 20min in a portable incubator. End products were detected using ready-to-use lateral flow strips. RPA lateral flow assay could detect ≥ 250fg genomic DNA of B. pseudomallei and ≥ 50 copies of recombinant plasmid harbouring the target DNA sequence. The assay was found to be highly specific and did not cross-react with other bacterial strains. In artificially spiked human blood and urine samples, the detection limit of the assay was 4.8 × 104 and 4.95 × 104CFU/mL of B. pseudomallei, respectively. The detection limit of assay after 6h of enrichment of artificially spiked urine samples was found to be 4.95 × 103CFU/mL of B. pseudomallei. Detection limit in artificially spiked tap water and soil samples was determined to be 7.5 × 102CFU/mL and 3.3 × 104CFU per 5g of B. pseudomallei, respectively.

Comparison of Two In vitro Maturation Media in Their Efficiency for Production of Competent Alpaca Oocytes

Oocyte maturation is the most critical process in in vitro culture, since the oocyte acquires competence for future processes, which involve the resumption of meiosis, epigenetic regulation, polyspermy block, activation of the zygote, exchange of protamines to histones, cleavage, cell polarization, embryonic stem cell proliferation, and implantation. Therefore, the objective of this study was to evaluate the efficiency of two different in vitro maturation media in the production of competent alpaca oocytes matured in vitro. The competency evaluated by morphometry and cytoplasmic and nuclear staining techniques. Alpaca ovaries (n=44) were sourced from slaughterhouse, transported to laboratory in thermoses with saline solution at 33-36ºC and subjected to follicular aspiration and/or dissection. A total of 212 oocytes were obtained. The oocytes were selected, randomized and distributed in one of the two experimental groups: Maturation medium 1 (MM1) and Maturation medium 2 (MM2) with three replicates per experiment. In vitro maturation was carried out in a portable incubator for 40h under 5% CO2 conditions (produced by effervescent granules) and 38.5ºC (by thermostatic bath). Nuclear maturation was assessed using acetate-orcein staining, cytoplasmic maturation using Brilliant Cresyl Blue (BCB) staining and morphometry using ImageJ Software. Nuclear maturation was classified according to the meiotic stage. Cytoplasmic maturation was classified by the presence (BCB+) or absence (BCB-) of BCB staining. Morphometry evaluated the measurements of the diameter and thickness of the zona pellucida and perivitelline space of the oocyte. Nuclear maturation rate was evaluated in Metaphase, observing no significant differences (P=0.088) between MM1 (46.08 ± 5.90 %) and MM2 (54.65 ± 3.00%) in this parameter. The cytoplasmic maturation rate of MM1 (67.78 ± 4.50%) was significantly lower compared to MM2 (77.61 ± 3.58) % (P=0.014). For the diameter of the oocyte, MM1 (133.42 ± 14.56 μm) and MM2 (136.14 ± 15.2 μm) were no different (P=0.397), same for the thickness of the zona pellucida, MM1 (16.84 ± 3.96 μm) and MM2 (16.73 ± 4.98 μm) were no different (P=0.919). For the perivitelline space area, MM1 (11018.91 ± 2465.40 μm2 ) and MM2 (8686.18 ± 3016.88 μm2 ) were significantly different (P=0.0005). In conclusion, the present study shows that the MM2 medium results are better in cytoplasmic maturation and the area of the perivitelline space. The other parameters (nuclear maturation, diameter of the oocyte and thickness of the zona pellucida) were no different between the two maturation media evaluated.

Monitoring on Portable Baby Incubator Based on Microcontroller and Notification Using Short Message Service (SMS)

Portable incubator was one solution to help the premature baby. In general, the baby in the incubator is monitored by the observer manually. This research aimed to apply a microcontroller, temperature sensor, weight sensor, heart rate sensor, and GSM module to monitor and notify the premature babies' condition in portable incubators. The observation can be done by reading the display on LCD and SMS. The hardware used consists of a DS18B20 sensor, Load Cell, Pulse Heart Rate Sensor, Buzzer, LCD, and SIM800L Module. The results showed that the Pulse sensor and DS18B20 sensor could measure and detect the baby's heart rate body temperature and are displayed on the LCD with an average error of 4.354% and 1.437%. The loadcell sensor can detect weight with an error of 2.16%. The duration of sending SMS to Smartphone is 8s for each delivery. SMS was sent if the patient's conditions were weak and critical. Hopefully, these monitoring and notification tools can inform the baby's state in the incubator immediately.

Microcontroller Based Portable Incubator Monitoring Tool with Short Message Service (SMS) notifications

The aim of this research was applied a microcontroller, temperature sensor, weight sensor, heart rate sensor and GSM module to monitoring and notification of the condition of premature babies in portable incubators. The hardware used consists of a DS18B20 sensor, Load Cell, Pulse Heart Rate Sensor, Buzzer, LCD and SIM800L Module. The results showed the Pulse sensor and DS18B20 sensor could measure and detect the baby’s heart rate and baby temperature. The result was on the LCD with an average error of 4.354% for heartrate and 1.437% for temperature. The loadcell sensor can detect weight with an error of 2.16%. The duration of sending SMS to Smartphone is 8s for each delivery. SMS was sent if the baby weak and critical condition.

MicroMI: A portable microbiological mobile incubator that uses inexpensive lithium power banks for field microbiology

Incubation at controlled temperature is a key step in culture based microbiological tests. Access to culture-based microbiological testing requires access to conventional incubators in a laboratory. Portable incubators allow microbiological testing in the field and in resource-limited settings, and can eliminate the challenge of sample transportation, minimising the chance of sample degradation. Recent studies have reported low-cost portable incubator designs suitable for field or off-grid use, but these either need an external power supply (e.g. mains AC or 12 V DC), or rely on passive heating without thermostatic control. Here we report that small inexpensive uninterruptable power supply (UPS) products manufactured for consumer electronics and powered by lithium-ion battery packs allowing thermostatic temperature control in small portable incubators that can maintain precise temperatures with or without external power. We present an open-source design for a Microbiological Mobile Incubator (MicroMI) in two sizes for field use. The MicroMI is built from simple and widely available components and is easy to set up. The open source design can be customised for different numbers of samples. The smallest and most efficient design uses a vacuum insulated food flask that allows longer operation with smaller, lower capacity UPS. The larger flight case design has space for more samples, but depletes the battery faster. The UPS maintains a typical microbiology incubation temperature for up to 24 h without external power- ideal for typical incubation needed for culture methods. The battery capacity, incubator design, and external ambient temperature all affected duration of operation without requiring external power. We validated the MicroMI by conducting classical microbiological tests using agar petri dishes, slant cultures and dip slides, and biochemical tests. We conclude the MicroMI design allows inexpensive lithium battery products to be used to simplify field microbiology and increase access to vital analytical microbiology testing.

Next-Generation Antimicrobial Resistance Surveillance System Based on the Internet-of-Things and Microfluidic Technique.

Antimicrobial resistance (AMR) of foodborne pathogens is a global crisis in public health and economic growth. A real-time surveillance system is key to track the emergence of AMR bacteria and provides a comprehensive AMR trend from farm to fork. However, current AMR surveillance systems, which integrate results from multiple laboratories using the conventional broth microdilution method, are labor-intensive and time-consuming. To address these challenges, we present the internet of things (IoT), including colorimetric-based microfluidic sensors, a custom-built portable incubator, and machine learning algorithms, to monitor AMR trends in real time. As a top priority microbe that poses risks to human health, Campylobacter was selected as a bacterial model to demonstrate and validate the IoT-assisted AMR surveillance. Image classification with convolution neural network ResNet50 on the colorimetric sensors achieved an accuracy of 99.5% in classifying bacterial growth/inhibition patterns. The IoT was used to carry out a small-scale survey study, identifying eight Campylobacter isolates out of 35 chicken samples. A 96% agreement on Campylobacter AMR profiles was achieved between the results from the IoT and the conventional broth microdilution method. The data collected from the intelligent sensors were transmitted from local computers to a cloud server, facilitating real-time data collection and integration. A web browser was developed to demonstrate the spatial and temporal AMR trends to end-users. This rapid, cost-effective, and portable approach is able to monitor, assess, and mitigate the burden of bacterial AMR in the agri-food chain.

Thermal Analysis of Heating–Cooling Mat of Textile Incubator for Infants

Abstract On the medical device market there are several types of stationary and portable incubators that can be used in the care of infants. The prototype of a textile incubator made as part of this work consists of five material layers. The textile incubator is equipped with a functional heating and cooling mat, which is made on the basis of 3D channeled weft-knitted fabric. Its function is to generate heat and maintain it inside the textile incubator or to cool the baby's body while using therapeutic hypothermia. The mat is equipped with hoses transporting the heating or cooling medium. The mat, depending on variable input parameters, can emit heat in the range from 1.15 W to 86.88 W. In case of the cooling function, it can receive heat in the range from −4.32 to −27.96 W. This indicates a large adjustment range of the amount of heat supplied and received, which is a positive feature, and enables programming the heat balance to ensure comfort for the baby. The analysis of temperature measurements on the mat surface confirmed that maximum temperature differences do not exceed 1.6°C.

PrintrLab incubator: A portable and low-cost CO2 incubator based on an open-source 3D printer architecture.

Growth in open-source hardware designs combined with the decreasing cost of high-quality 3D printers have supported a resurgence of in-house custom lab equipment development. Herein, we describe a low-cost (< $400), open-source CO2 incubator. The system is comprised of a Raspberry Pi computer connected to a 3D printer controller board that has controls for a CO2 sensor, solenoid valve, heater, and thermistors. CO2 is supplied through the sublimation of dry ice stored inside a thermos to create a sustained 5% CO2 supply. The unit is controlled via G-Code commands sent by the Raspberry Pi to the controller board. In addition, we built a custom software application for remote control and used the open-source Grafana dashboard for remote monitoring. Our data show that we can maintain consistent CO2 and temperature levels for over three days without manual interruption. The results from our culture plates and real-time PCR indicate that our incubator performed equally well when compared to a much more expensive commercial CO2 incubator. We have also demonstrated that the antibiotic susceptibility assay can be performed in this low-cost CO2 incubator. Our work also indicates that the system can be connected to incubator chambers of various chamber volumes.

31 Effect of vitrification of porcine oocytes on production of ATP and mitochondrial DNA copy number

This experiment evaluated the effects of vitrification at different time points of invitro maturation (IVM) on ATP production and mitochondrial DNA (mtDNA) copy number of porcine oocytes. Treatments included vitrification at 24h of IVM (V24), vitrification at 44h of IVM (V44), and a control group consisting of fresh oocytes after 48h of IVM. Porcine cumulus–oocyte complexes (COCs) were obtained from a commercial vendor and underwent the first 24h of IVM during shipment in a portable incubator. Upon arrival, COCs were randomly allocated into treatments. The oocytes in the V44 and control groups were incubated at 38.8°C and 5.5% CO2 to continue IVM. Before vitrification, COCs were denuded in hyaluronidase by vortexing, followed by 3 washes in holding medium (Hanks’ balanced salt solution–HEPES + 4% BSA). Denuded oocytes were vitrified using a 3-step, dimethyl sulfoxide (DMSO)- and ethylene glycol-based protocol (VitriCool kit, IVF Bioscience), Cryolocks as carriers, and liquid nitrogen as cryogenic agent. All steps were carried out at room temperature. Warming was achieved using the VitriWarm kit (IVF Bioscience) consisting of 4 dilution steps. After warming, the oocytes were washed in holding medium and incubated in IVM medium to complete 48h of maturation (24h for V24 and 4h for V44). All warming steps were performed at 38.5°C. Oocytes destined for ATP production assessment (Control n=26, V44 n=27, V24 n=28) were frozen in 50µL of ultra-pure water, whereas oocytes destined for mtDNA copy number quantification (Control n=32, V44 n=30, V24 n=32) were snap-frozen in ∼1µL of holding medium. Samples were kept at −80°C until further processing. The ATP content of single oocytes was determined using an ATP bioluminescent somatic cell kit (FLASC, Sigma-Aldrich). The assessment of mtDNA copy number in single oocytes was performed by amplifying the porcine Mt-ND4 gene (F atccaagcactatccatcacca, R ccgatgattacgtgcaaccc; NC_000845.1) and quantification was carried out using a Droplet Digital PCR system (Bio-Rad Laboratories). Results for ATP production and mtDNA copy number were analysed through ANOVA with Tukey’s adjustment (SAS 9.4; Sas Institute Inc.). No differences were found in mtDNA copy number among groups (Control 178 004.69±19 207.23, V44 170 483.67±18 127.18, V24 176 767.50±27 211.09; P=0.36). In contrast, all groups differed in ATP content (pg/µL) among each other (Control 26.36±4.99, V44 20.26±6.61, V24 16.54±8.07; P&amp;lt;0.0001). These data indicate that although there was no effect on mitochondrial number, ATP production/storage ability is significantly reduced as a result of vitrification-warming. Vitrification at 44h of IVM followed by a 4-h post-warming incubation showed the highest ATP content among the vitrification treatments.

Installing and Testing the Grashof Portable Incubator Powered Using the Solar Box "Be-Care" for Remote Areas without Electricity

Installing and Testing the Grashof Portable Incubator Powered Using the Solar Box "Be-Care" for Remote Areas without Electricity