Polymerase Chain Reaction-single Strand Conformation Polymorphism Analysis Research Articles

Comparison of merits of DNA sequencing, PCR-SSCP and MFP assays in the detection of drug resistance in Mycobacterium leprae

Purpose: To compare the merits of conventional Mouse Foot Pad (MFP) assay, Polymerase Chain Reaction-Single Strand Conformation Polymorphism (PCR-SSCP) analysis, and Direct-DNA sequencing in identification of drug resistance in M. leprae.
 Methods: A total of 41 leprosy cases were investigated for drug resistance using MFP assay, whereby growth results were obtained in 23 cases. The DNAs extracted from these samples were amplified in polymerase chain reaction (PCR) using specific primers in order to determine the drug resistance-loci. Furthermore, PCRSSCP analysis was carried out using PCR amplicons, while gel electrophoresis was performed to identify any shift in mobility in any one of the DNA strands, as well as the pattern of mutation.
 Results: A total of 5 isolates exhibited the highest degree of resistance R100, whereas 4 isolates showed intermediate level of resistance R10. In contrast, the least resistance was seen in R1. There were no mutations in 4 out of 10 strains which were dapsone-resistant, i.e., 1 HR, 2 IR and 1 LR. Moreover, there was no mutation in 305 bp sequence of the rpoB gene. DNA sequencing sensitivity was 60 %, whereas the sensitive isolates tested in the experiments exhibited no mutation, resulting in 100 % specificity.
 Conclusion: These results indicate the advantages of molecular techniques over conventional MFP technique. The study has revealed that PCR-SSCP analysis, a rapid, specific and less expensive method, has greater potential for use in routine testing of the susceptibility of M. leprae to rifampicin and dapsone, than the other tests.

P53 Gene Mutation in Blood of Zebu Cattle with Squamous Cell Carcinoma of the Horn

Horn cancer is one of the most important diseases in Zebu castrated male cattle. The objective of this study was to investigate the presence of p53 gene mutation in the blood of affected cattle and its value for early diagnosis and prognosis. The study was conducted on blood samples from 20 affected cattle and six healthy control cattle from Western India. Plasma samples were evaluated for the presence of p53 gene mutation using the polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP) technique and the results were correlated with the stage of cancer. Five of the 20 cases had stage I neoplasms, nine stage II and six stage III, based on histopathological examination. PCR-SSCP analysis revealed an aberrant pattern of DNA migration on polyacrylamide gel electrophoresis of DNA extracts from blood samples of six animals with stage II and stage III cancer. No mutation was identified in blood from cattle with stage I cancer or from healthy control cattle. These results suggest that PCR-SSCP detection of p53 gene mutation in blood has potential diagnostic and prognostic value, and indicate the need for further large-scale investigation.

Variation in lactoferrin gene affects milk lactoferrin content and somatic cell count in murrah buffaloes

Lactoferrin plays an important role in antimicrobial defence and is a potential candidate gene for mastitis resistance. In the present investigation, polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) studies were carried out in Murrah (Bubalus bubalis) buffaloes to detect single nucleotide polymorphisms (SNPs) of lactoferrin gene and to analyse the association between the observed polymorphisms with milk lactoferrin content and Somatic cell count (SCC). PCR-SSCP analysis revealed a total of 07 different variants in the partial coding region of the lactoferrin gene. PCR-SSCP analysis of exon 10 of lactoferrin gene revealed three and that of exons 4 and 5 revealed two unique patterns each, while all other exons exhibited monomorphic pattern. Comparison of nucleotide sequences of lactoferrin gene of the Murrah buffaloes with taurine reference sequence revealed a total of 14 point mutations, 09 of which were found to be in coding region. Conceptualized translation of nucleotide sequence revealed 07 amino acid changes. SSCP variants of exon 10 (P less than 0.01) had significant effect on milk SCC. The SSCP variants of exon 4 and exon 5 had significant (P less than 0.05) effect on lactoferrin content. The SCC and lactoferrin content in Murrah buffaloes was highest in 4th and above parity group. Stage of lactation had highly significant (P less than 0.01) effect on both milk SCC and lactoferrin content. There was a high and significant (p less than 0.01) correlation (0.741) between SCC and lactoferrin content in milk. The observed association between SSCP variants in lactoferrin gene with milk SCC and milk lactoferrin content can be used as prognostic markers for selection of animals for high lactoferrin content and low somatic cell count, as well as a marker of susceptibility/resistance to mastitis in Murrah buffaloes

Association of IGF1 Gene Polymorphism with Growth Rates in Madras Red Sheep

Insulin-like growth factors (IGFs), formerly called somatomedin, are members of a family of insulin related peptides. Insulin-like growth factors 1 (IGF-1) plays a key role in mammalian growth, lactation and metabolism, by stimulating anabolic processes such as cell proliferation, skeleton and hair growth and protein synthesis. The aim of this study was to investigate the association of IGF1 (exon1) gene polymorphism with growth rates in Madras Red sheep. Blood samples were collected from 66 animals maintained at Post Graduate Research Institute in Animal Sciences, Kattupakkam and 70 animals from farmers’ flock in the breeding tract of Madras Red sheep and DNA was isolated using high salt method. The animals were genotyped by Polymerase Chain Reaction – Single Strand Conformation Polymorphism (PCR-SSCP). In the PCR reaction the primers used were 5’ ATTACAGCTGCCTGCCCCTT 3’ and 5’ CACATCTGCTTACACCTTACCCG 3’. A 265 bp long IGF1 (exon1) gene PCR product was genotyped for polymorphic pattern using SSCP method. The PCR-SSCP analysis of exon1 IGF-I revealed three distinct patterns viz., AA, AG and GG and the genotype frequencies were in the order of 0.963, 0.022 and 0.015. In the present study, no significant effect (P>0.05) was observed between genotypes on all age groups in Madras Red sheep.

Association analysis of novel polymorphisms in 2', 5'-oligoadenylate synthetase gene with reproductive traits in indigenous and cross-bred cattle of Indian Origin.

2', 5'-Oligoadenylate synthetases (OAS) are important components of an interferon-mediated antiviral pathway. No polymorphisms in exonic regions of bovineOAS1gene have been identified and associated with reproduction traits. The objective of the study was to detect and evaluate the effects of mutations in exonic region of bovine OAS1 gene with reproduction traits in cattle. DNA samples collected from 250 individual cows of two Indian dairy breeds (Sahiwal and Frieswal) of cattle were used in the study. The genetic variants of the OAS1 gene were identified with polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP) and sequence analysis using seven set of primer pairs. The PCR-SSCP analysis revealed polymorphism in the fragments comprising of exon 2, exon 5 and first fragment of exon 6 while the fragments of exons 1, 3, 4 and second fragment of exon 6 were monomorphic in Sahiwal and Frieswal cattle. The mutations in the amplified region comprising of exon 2 were found to have significant association with age at first breeding and calving, service period, dry period and pregnancy rate. Significant associations were found between SNPs in the exon 5 and service and dry periods of the animal, whereas the genetic variants in the first fragment of the exon 6 showed significant association with age at first breeding and calving. To our knowledge, this study demonstrated for the first time that the polymorphisms in OAS1 gene were associated with reproductive traits and it can be chosen as a candidate gene for improvement of reproductive performance of cattle.

Associations of polymorphisms in the prolactin receptor gene with growth trait in Japanese quail (Coturnix coturnix japonica)

Prolactin receptor (PRLR), as an important regulatory gene about growth and differentiation, might be a condition gene for reproductive traits. The prolactin receptor is a specific receptor for prolactin (PRL), which is an anterior pituitary peptide hormone involved in various physiological activities and is essential for reproductive improvement. In chickens, the PRLR gene is on the Z chromosome. In the present study, the polymorphism of exon 2 of PRLR gene in Japanese Quail (Coturnix coturnix japonica) was investigated. Blood samples of 180 Japanese Quail were collected randomly. DNA was extracted from blood samples and amplified. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) analysis of the exon 2 of PRLR gene. PCR-SSCP analysis of the exon 2 region revealed two banding patterns. Two different SSCP patterns, representing two different genotypes, were identified. The frequencies of the observed genotypes were 0.939 and 0.061 for AA and BB. Allele frequencies were 0.939 and 0.061 for A and B. Observed heterozygosity (Hobs) value was 0.0. The chi-square test showed significant (P<0.05) deviation from Hardy-Weinberg equilibrium for this locus in studied population. The effect of these genotypes on weight gain was investigated, and the BB genotype was found to be associated with body weight at 46 days. This was the first study on polymorphism of PRLR gene in Japanese quail.

Sequence characterization and polymorphism detectionin AQP7 gene of Murrah buffalo

Aquaporin 7 (AQP7) gene is a member of aqua-glyceroporins which transports glycerol and water to spermatids. The present study aimed to investigate the polymorphisms within exons 2, 3, 4, 5 and their flanking intronic regions in AQP7 gene of Murrah bulls. Genomic DNA was extracted from 69 Murrah bulls blood samples and was subjected to polymerase chain reaction- single strand conformation polymorphism (PCR-SSCP) analysis. PCR-SSCP analysis revealed a total of eight different variants for amplicons of exons 4 and 5. Amplicon of exon 4 revealed three different patterns viz. E4P1, E4P2 and E4P3 with the frequency of 0.30, 0.22 and 0.48, respectively. Analysis of exon 5 revealed five unique SSCP patterns viz. E5P1, E5P2, E5P3, E5P4 and E5P5, with the frequency of 0.10, 0.37, 0.20, 0.20 and 0.13, respectively. Sequence analysis showed 16 single nucleotide polymorphisms, 7 of which were observed in coding region. Amplicons of exons 2 and 3 showed monomorphic patterns. However, compared to the reference sequence of taurine cattle one transition (C6878T) in exon 3 and 4 transitions (G2099A, C2116T, A2117G, G6848C) in intron 2 were observed for all the bulls under study. The genetic variability identified in the AQP7 gene may serve as potential genetic marker(s) for semen quality traits in buffalo.

Response of soil microorganisms to radioactive oil waste: results from a leaching experiment

Abstract. Oil wastes produced in large amounts in the processes of oil extraction, refining, and transportation are of great environmental concern because of their mutagenicity, toxicity, high fire hazardousness, and hydrophobicity. About 40% of these wastes contain radionuclides; however, the effects of oil products and radionuclides on soil microorganisms are frequently studied separately. The effects on various microbial parameters of raw waste containing 575 g of total petroleum hydrocarbons (TPH) kg−1 waste, 4.4 of 226Ra, 2.8 of 232Th, and 1.3 kBq kg−1 of 40K and its treated variant (1.6 g kg−1 of TPH, 7.9 of 226Ra, 3.9 of 232Th, and 183 kBq kg−1 of 40K) were examined in a leaching column experiment to separate the effects of hydrocarbons from those of radioactive elements. The raw waste sample (H) was collected from tanks during cleaning and maintenance, and a treated waste sample (R) was obtained from equipment for oil waste treatment. Thermal steam treatment is used in the production yard to reduce the oil content. The disposal of H waste samples on the soil surface led to an increase in the TPH content in soil: it became 3.5, 2.8, and 2.2 times higher in the upper (0–20 cm), middle (20–40 cm), and lower (40–60cm) layers, respectively. Activity concentrations of 226Ra and 232Th increased in soil sampled from both H- and R- columns in comparison to their concentrations in control soil. The activity concentrations of these two elements in samples taken from the upper and middle layers were much higher for the R-column compared to the H-column, despite the fact that the amount of waste added to the columns was equalized with respect to the activity concentrations of radionuclides. The H waste containing both TPH and radionuclides affected the functioning of the soil microbial community, and the effect was more pronounced in the upper layer of the column. Metabolic quotient and cellulase activity were the most sensitive microbial parameters as their levels were changed 5–1.4 times in comparison to control ones. Changes in soil functional characteristics caused by the treated waste containing mainly radionuclides were not observed. PCR-SSCP (polymerase chain reaction – single strand conformation polymorphism) analysis followed by MDS (metric multidimensional scaling) and clustering analysis revealed that the shifts in microbial community structure were affected by both hydrocarbons and radioactivity. Thus, molecular methods permitted to reveal the effects on soil microbial community not only from hydrocarbons, which significantly altered functional characteristics of soil microbiome, but also from radioactive elements.

Detection of SNPs in the Cathepsin D Gene and Their Association with Yolk Traits in Chickens

CTSD (Cathepsin D) is a key enzyme in yolk formation, and it primarily affects egg yolk weight and egg weight. However, recent research has mostly focused on the genomic structure of the CTSD gene and the enzyme’s role in pathology, and less is known about the enzyme’s functions in chickens. In this paper, the correlations between CTSD polymorphisms and egg quality traits were analyzed in local Shandong chicken breeds. CTSD polymorphisms were investigated by PCR-SSCP (polymerase chain reaction single strand conformation polymorphism) and sequencing analysis. Two variants were found to be associated with egg quality traits. One variant (2614T>C), located in exon 3, was novel. Another variant (5274G>T), located in intron 4, was previously referred to as rs16469410. Overall, our results indicated that CTSD would be a useful candidate gene in selection programs for improving yolk traits.

PCR-SSCP analysis of leptin gene and its association with milk production traits in river buffalo (Bubalus bubalis)

Leptin gene has been found to be associated with various economic traits including milk production and fat quality in dairy animals. In the present study, we investigated genetic variations in intron 1 region of leptin gene in riverine buffaloes (Bubalus bubalis) using polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and sequencing methods and associated them with milk traits. The study revealed three SSCP variants A, B and C among a total of 301 buffaloes from nine breeds. The frequency of variant C was found invariably high among all the breeds except in Marathwada buffalo. Variant A was found to be absent in Chilika, Nili-Ravi, Nagpuri and Pandharpuri breeds and also had the lowest frequencies in Mehsana, Jaffarabadi, Murrah and Toda breeds. Sequencing of SSCP variants revealed a total of five polymorphic sites, with three haplotypes. Statistical analysis revealed significantly high fat percentage at 150 days in SSCP variant B in Mehsana buffaloes. However, the associations of SSCP variants of leptin gene with total milk yield, 305 days milk yield and total fat yield were found to be non-significant. The present study is the first report on association analysis of leptin gene polymorphisms with milk production and milk quality traits in river buffalo.

Absence of Mutations on the SNF5 Gene in Hematological Neoplasms with Chromosome 22 Abnormalities

Background: The relation with SNF5 mutation and chromosome 22 abnormalities is not clear in hematological neoplasms. Methods: To elucidate the relevance of the SNF5 gene on 22q11.2, karyotypes were reviewed in 283 hematological neoplasms. Loss of heterozygosity (LOH) on 22q was analyzed in 21 plasma cell myelomas without chromosome 22 abnormalities. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) on the SNF5 gene was analyzed in 8 hematological neoplasms with 22q- or -22, and 8 chronic myelogenous leukemias (CMLs) in blast crisis. Fluorescence in situ hybridization (FISH) was performed in 1 myelodysplastic syndrome (MDS) case with -22,del(22)(q11.2 q13). Results: 22q- or -22 was observed in 36 patients. LOH on 22q was detected in 1 of the 21 myelomas. Mobility shifts were found by PCR-SSCP analysis in 2 CMLs, whereas sequence analysis showed polymorphisms. FISH analysis revealed the SNF5 gene was not deleted in the MDS case. Conclusion: These results suggest that alterations of the SNF5 gene are rare in hematological neoplasms with chromosome 22 abnormalities. Haploinsufficiency may contribute to the development of these neoplasms.

790 CLINICAL IMPLICATIONS OF P53 GENE MUTATION IN BLADDER CANCER

You have accessJournal of UrologyBladder Cancer: Basic Research I1 Apr 2010790 CLINICAL IMPLICATIONS OF P53 GENE MUTATION IN BLADDER CANCER Uttam Mete, Saurabh Pandya, Anuradha Chakraborti, Nandita Kakkar, and Arup Mandal Uttam MeteUttam Mete More articles by this author , Saurabh PandyaSaurabh Pandya More articles by this author , Anuradha ChakrabortiAnuradha Chakraborti More articles by this author , Nandita KakkarNandita Kakkar More articles by this author , and Arup MandalArup Mandal More articles by this author View All Author Informationhttps://doi.org/10.1016/j.juro.2010.02.1439AboutPDF ToolsAdd to favoritesDownload CitationsTrack CitationsPermissionsReprints ShareFacebookTwitterLinked InEmail INTRODUCTION AND OBJECTIVES Aims of our study were to assess frequency of P53 gene mutations in patients with transitional cell carcinoma of urinary bladder and to find out its correlation with standard clinical and histological parameters for tumor recurrence and progression. METHODS Tumor tissue samples of 54 patients with transitional cell carcinoma(TCC) of urinary bladder obtained by TURBT or radical cystectomy were examined histopathologically. P53 mutations were assessed by DNA isolation and PCR-SSCP ( polymerase chain reaction- single strand conformation polymorphism) analysis. Data were analysed by Fisher's two tailed t-test, Pearson's chi-square test and non-parametric testes where necessary. Uni and multi variate analysis was performed with P53 mutations as dependent variable. RESULTS 27 patients had presented with primary tumors (18 superficial, 9 invasive), remaining 27 patients had recurrent disease. Out of 54 patients 15 (27.8%) had p53 mutations detected in exons 5,6 and 7. P53 mutations were more in invasive tumor as compared to superficial tumor {8/39 (20%) vs 7/15 (47%)}. Progression of disease was associated with higher frequency of p53 mutations {5/13 (38%) vs 1/14 (7%)}. There was significantly higher number of mutations with increasing size of tumor (P=0.001) higher grade (P=0.003) and stage of tumor (0.028). CONCLUSIONS P53 mutations are associated with disease progression and aggressive behavior. Therefore patients having tumor with P53 mutations should be followed up closely. This molecular prognosticator may play a role in the clinical routine management of patients with bladder tumor. Further studies should explore their potential clinical significance taking into their cost-effectiveness. Chandigarh, India© 2010 by American Urological Association Education and Research, Inc.FiguresReferencesRelatedDetails Volume 183Issue 4SApril 2010Page: e309 Advertisement Copyright & Permissions© 2010 by American Urological Association Education and Research, Inc.MetricsAuthor Information Uttam Mete More articles by this author Saurabh Pandya More articles by this author Anuradha Chakraborti More articles by this author Nandita Kakkar More articles by this author Arup Mandal More articles by this author Expand All Advertisement Advertisement PDF downloadLoading ...

A non-radioactive PCR-SSCP analysis allows to distinguish between HPV 16 European and Asian-American variants in squamous cell carcinomas of the uterine cervix in Colombia

Human Papillomavirus type 16 (HPV 16) DNA is regularly found in around 50% of all cervical carcinomas. Variants of this type have been found associated with different risks for cervical cancer development. Presence of HPV 16 variants in Colombia has not been previously reported. The aims of this study were to assess the feasibility of non-radioactive PCR-SSCP (polymerase chain reaction single-strand conformation polymorphism) analysis for determination of variability of ORF of E6, variability in the enhancer sequence of the LCR, and for establishment of the distribution of HPV 16 variants in invasive squamous cell carcinoma of the uterine cervix in Colombian women. Biopsies from 59 patients at the Instituto Nacional de Cancerología (INC) in Bogotá (Colombia) were collected. HPV detection was performed using universal primers. HPV 16 variants were detected by non-radioactive single-stranded conformational polymorphism (SSCP) analysis and direct sequencing. HPV 16 was detected in 57.6% of the tumors. The European branch was identified in 88.2% of the samples with the E-G350 class being the most prevalent variant (41.1%). The Asian-American branch was identified in 8.8% of the samples. Within this group it was possible to distinguish between c and a classes. It was not possible to determine the branch in 2.9% of the cases. A nucleotide transition (G to A) at position 7521 was the most prevalent variation (80%) found in the enhancer sequence of the LCR region. A non-radioactive PCR-SSCP analysis allowed us to distinguish between European and Asian-American branches of HPV 16, and to distinguish among classes in squamous cell carcinomas of the uterine cervix in Colombia. This method is an excellent alternative that can be used as a screening tool for identification of HPV 16 variants.

Genetic Variation in the κ-Casein Gene (CSN3) of Chinese Yak (Bos grunniens) and Phylogenetic Analysis of CSN3 Sequences in the Genus Bos

Variants of κ-casein (CSN3) have been extensively studied in cattle and 13 alleles have been identified at the protein and DNA levels to date. Evolution of some of these alleles and a possible common ancestor remain unclear. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) analysis of CSN3 exon IV in domesticated yak revealed a 2-allele polymorphism showing migration patterns different from known cattle variants. The PCR products of both yak CSN3 SSCP alleles were sequenced. All yak had nucleotide sequences coding for Thr in AA position 136 (identical to bovine CSN3*A) and Ala in position 148 (identical to bovine CSN3*B). The sequencing results were confirmed by PCR-RFLP analysis using HindIII and TaqI. A 12-bp insertion in the coding region, representing a repeated nucleotide and AA motif, was found in 1 yak allele. The duplication corresponds to the codons for AA 147 to 150 (Glu-Ala-Ser-Pro) or 148 to 151 (Ala-Ser-Pro-Glu), which are repeated identically. In 21 yak samples genotyped by PCR-SSCP analysis, frequencies for the insertion variant and the short variant were about 68 and 32%, respectively. The loss of the insertion may have led to the ancestral CSN3 allele from which all currently known variants of CSN3 in the genus Bos evolved. This is the first report of polymorphisms in the yak CSN3 gene and may be helpful for future studies on genetic variation within and between yak populations or on associated traits.

Improvement of the sensitivity and resolution of PCR-SSCP analysis with optimized primer concentrations in PCR products

Polymerase chain reaction single-strand conformation polymorphism (PCR-SSCP) is a widely utilized screening method for detection of mutations. In this method, the target sequence of interest is amplified by PCR and separated as single-stranded molecules by electrophoresis in a nondenaturing polyacrylamide gel (Orita et al. 1989). However, the sensitivity and resolution of PCR-SSCP can be influenced by many parameters, including size and GC content of the PCR product (Li et al. 2003); gel temperature during electrophoresis (Chen et al. 1995); buffer composition (e.g. ionic strength, pH; Kukita et al. 1997); buffer additives, mainly glycerol, formamide, polyethylene glycol (Markoff et al. 1997; Paccoud et al. 1998); gel matrix composition and concentration (Savov et al. 1992), as well as primer concentration in PCR product (Cai and Touitou 1993). It is generally considered that specific PCR amplification is important in detection of mutations by using PCR-SSCP (Orita et al. 1989; Li et al. 2003). Moreover, it has been noted that addition of either forward or reverse primer in PCR product may apparently alter SSCP banding patterns, which is presumably caused by the interaction between primer(s) and single-strand DNAs (ssDNA) (Almeida et al. 1998; Hennessy et al. 1998). Previously, Cai and Touitou (1993) demonstrated that the lowest primer concentration in PCR product affecting SSCP banding patterns is around 6 nM, and that primer-concentration-dependent intermediate SSCP patterns appear in unpurified PCR product amplified with regular amounts of primers (30–150 nM). In the present study, we used two identified PCR fragments of the promoter region in

Relationship between polymorphism of class II transactivator gene promoters and chronic hepatitis B

To investigate the relationship between the polymorphism of class II transactivator (CIITA) gene promoters and chronic hepatitis B (CHB). Genomic DNA was prepared from peripheral blood leukocytes. Promoters I, III and IV of gene were analyzed respectively with polymerase chain reaction single strand conformation polymorphism (PCR-SSCP) in 65 patients with CHB, 26 patients with acute hepatitis B (AHB) and 85 normal controls. No abnormal migration was found in PCR-SSCP analysis of the three promoters in the three groups. Also, no sequential difference was observed at the three promoters among the CHB patients, AHB patients and normal controls. No polymorphism in promoters I, III and IV of CIITA gene exists in CHB patients, ABH patients and normal controls, suggesting that the promoter of CIITA gene might be a conserved domain.

Short Communication: Simultaneous Identification of Five κ-Casein (CSN3) Alleles in Domestic Goat by Polymerase Chain Reaction-Single Strand Conformation Polymorphism

Until now, a total of nine polymorphic sites corresponding to six different alleles have been described at the κ-casein (CSN3) locus in the domestic goat (Capra hircus). A protocol for the rapid and simultaneous genotyping of five goat CSN3 alleles by using polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) technique was developed. Moreover, the developed test was validated by screening the CSN3 variability in four Italian breeds, Garganica, Jonica, Maltese, and Camosciata. Seven different patterns were readily identifiable. These corresponded to five known alleles and two newly identified variants. The G/A substitution at nucleotide position 471, which is not identifiable at the protein level but was found to be very frequent in the typed breeds, is easily detectable by the protocol developed. The PCR-SSCP analysis is a powerful tool for the genetic study of CSN3 variability in domestic goats, allowing both the simultaneous identification of different alleles, and the detection of new variants.

Optimized polymerase chain reaction-based single-strand conformation polymorphism analysis of p53 gene applied to Bulgarian patients with invasive breast cancer.

During the last few decades a substantial amount of evidence has accumulated proving that the abrogation of the normal p53 pathway is a critical step in the initiation and progression of tumors. Decoding the genetic mechanisms involved in carcinogenesis requires screening for consistent genetic tumor alterations, including those concerning the p53 gene. Thus, practical, efficient, and inexpensive techniques for accurate determination of p53 mutational status are needed. Polymerase chain reaction/single-strand conformation polymorphism (PCR-SSCP) analysis is considered to be a useful tool to investigate the role of the p53 gene in the development and progression of human cancers. The sensitivity of the method can be increased considerably by varying the experimental conditions. Here we demonstrate a scheme of PCR-SSCP optimization for detection of p53 gene mutations of patients with various cancers. Optimal conditions for PCRSSCP of p53 exons 4-9 are reported. Such PCR-SSCP optimization could allow an increase in the sensitivity and reproducibility of the technique and facilitates screening of large series of patients to assess the clinical significance of p53 mutations in human cancers. Using the optimized PCR-SSCP analysis we screened Bulgarian patients with invasive breast cancer for p53 gene mutations and registered a 33.33% frequency of mutations. To date, there are no data concerning the p53 status of Bulgarian breast cancer patients. Screening for p53 gene mutations enables an accurate and routine determination of the p53 status of patients with cancer and may be applied in clinical oncology to cancer diagnosis, prediction of prognosis and response to treatment.

Polymorphisms of interleukin-4—related genes in Japanese children with minimal change nephrotic syndrome

Background:Minimal change nephrotic syndrome (MCNS) in children frequently is associated with allergy and immunoglobulin E production. T Helper subtype 2 cytokines, such as interleukin-4 (IL-4), may have an important role in the development of atopy. We investigated the associations of gene polymorphisms of IL-4, its receptor (IL-4R), and the signal transducer and activator 6 (STAT6) gene with MCNS. Methods:We analyzed these polymorphisms in Japanese children with MCNS (n = 58) and healthy controls with neither allergic nor renal disease (n = 63). The polymerase chain reaction (PCR) and restriction fragment length polymorphism method was used for the IL-4 promoter gene polymorphism (−590C/T), and PCR single-strand conformation polymorphism analysis was used for the IL-4Rα chain gene (1902A/G) and STAT6 3′ untranslated region (2964G/A) polymorphisms. Results:There was a significant difference between the MCNS group and controls in genotypic distribution of IL-4 promoter gene polymorphism. Frequency of the T allele was significantly lower in the MCNS group than controls. There was no difference between the MCNS group and controls in the IL-4R gene polymorphism. In the STAT6 gene, no significant differences in genotypic and allelic distribution were observed between the 2 groups. However, there were significant differences between patients who did not need cytotoxic agents or who experienced 3 or fewer relapses and controls. Conclusion:These results suggest that genetic variations in the IL-4 and STAT6 genes may be associated with predisposition to MCNS, partially the clinical course of MCNS.

Promoter hypermethylation and post-transcriptional mechanisms for reduced BRCA1 immunoreactivity in sporadic human breast cancers.

Germline mutation of BRCA1 is well known to cause familial breast cancer. Although somatic mutations of the BRCA1 gene are rare in sporadic breast cancers, a high incidence of reduced BRCA1 immunoreactivity has been demonstrated. As one of the mechanisms for this, gene silencing by hypermethylation of the BRCA1 promoter region has been reported. Here, we show the presence of a post-transcriptional mechanism by examining promoter hypermethylation, mRNA expression levels and immunoreactivity of BRCA1 in sporadic human breast cancers Paired samples of 20 invasive ductal carcinomas and one invasive lobular carcinoma were obtained from sporadic breast cancer cases. The BRCA1 protein expression levels were determined by immunohistochemistry using a well-characterized antibody. The methylation status of the BRCA1 promoter region was determined by sequencing after bisulfite modification. The mRNA expression levels were determined by semi-quantitative reverse transcription polymerase chain reaction (PCR). Mutations in the entire BRCA1 coding region were analyzed by PCR single-strand conformation polymorphism analysis. Reduced immunoreactivity was observed in 13 of the 21 cancers. Hypermethylation was observed in five of the 13 cancers with reduced immunoreactivity and mRNA expression was almost absent in these five cancers. In the remaining eight cancers, mRNA expression was not decreased. None of the 21 cancers examined harbored BRCA1 mutations. These findings showed that post-transcriptional mechanisms, such as low efficiency of translation or reduced stability of BRCA1 protein, are also involved in reduced BRCA1 immunoreactivity in sporadic breast cancers.