Piscicola Geometra Research Articles

Anti-leech activity of asparagus racemosus and anogeissus latifolia roxb extracts against Piscicola Geometra

Piscicola geometra leeches are naturally parasitizing Cobia juveniles. The leeches adhere to cobia by suctioning and biting its surface, thereby facilitating the entry of a secondary infection. The anti-leech action An in vitro technique investigated the anti-leech action against Piscicola geometra using water extracts of Asparagus racemosus seeds and Anogeissus latifolia roxb leaves, preparing a grand total of 800 afflicted cobia leeches. We compared the anti-leech activity of water extracts from Asparagus racemosus seeds and Anogeissus latifolia leaves. We diluted the plant extracts to various concentrations and observed the activity over a duration of 96 hours. The seeds and leaves of Asparagus racemosus exhibited significant anti-leech activity, resulting in 80% of the leeches dying. Anogeissus latifolia leaves exhibited a greater degree of anti-leech action, resulting in the complete killing of leeches. The average duration required for Anogeissus latifolia leaves to immobilise and eliminate the leeches ranged from 8 hours to 96 hours, depending on the different concentrations of Anogeissus latifolia leaves used. This research has shown that the aqueous extract of Anogeissus latifolia leaves has strong potential as a novel anti-leech agent.

The genome sequence of the fish leech, Piscicola geometra (Linnaeus, 1761).

We present a genome assembly from an individual Piscicola geometra (the fish leech; Annelida; Clitellata; Hirudinida; Piscicolidae). The genome sequence is 171.1 megabases in span. Most of the assembly is scaffolded into 17 chromosomal pseudomolecules. The mitochondrial genome has also been assembled and is 15.1 kilobases in length.

Diversity of the Piscicola Species (Hirudinea, Piscicolidae) in the Eastern Palaearctic with a Description of Three New Species and Notes on Their Biogeography

Biodiversity is considered one of the most significant parameters for characterizing aquatic environments. The value of species diversity is taken into account when assessing the ecological state and quality of the ecosystem. However, erroneous taxonomic identification distorts biodiversity signification and, consequently, prevents a clear understanding of ecological signals and traits. In this study, we presented the first data on Piscicola leech species diversity in the vast area of the Eastern Palaearctic. To avoid misidentifications, an integrated approach was applied, combining modern DNA-based and classical morphological methods. Previously, only one species of the genus, Piscicola geometra, was recorded in the whole of Siberia. We discovered three new species: Piscicola sibirica sp. nov., Piscicola khubsugulensis sp. nov. (Eastern Siberia) and Piscicola nordica sp. nov. (European Northeast). The species Piscicola pojmanskae was reduced to synonymy with Piscicola geometra, whose description was updated. Taxonomic adjustments allowed us to ascertain the eastern edge of the Piscicola geometra distribution and to understand the biogeography of the group as a whole. The Piscicola geometra range is limited to Western Siberia, while the widespread Piscicola sibirica sp. nov. and the purely Khovsgolian Piscicola khubsugulensis sp. nov. inhabit Eastern Siberia.

Hirudinea (Annelida) Fauna of Some Wetlands in Bingöl Province

Leeches are important and reliable indicators of water quality and biodiversity in the ecosystem, so the presence of specific leech species is often closely related to basic water conditions and the presence of certain animals. This study was carried out in 2017 and 2018 in order to determine the Hirudinea fauna of some wetlands in Bingöl province. The investigation was conducted on a total of 13 stations. The water parameters of the stations were measured and recorded in situ. The collected specimens were brought alive to the Zoology Laboratory of Bingöl University Biology Department and kept alive under room temperature conditions. The diagnosis of leech samples was made through the living samples, and they were identified at the level of family, genus, and species. During the study, seven species, belonging to six genera and in four families were recorded. These are; Hirudo verbana Carena, 1820, Glossiphonia complanata (L. 1758), Theromyzon tessulatum (O. F. Müller, 1774), Placopdella costata (Fr. Müller, 1846), Erpobdella octoculata (L., 1758), Erpobdella testacea (Savigny, 1820), Piscicola geometra (L., 1761). The locations where the study was carried out are new records for the detected leech species.

The first mitochondrial genome of Codonobdella sp. (Hirudinea, piscicolidae), an endemic leech species from Lake Baikal, Russia and reassembly of the Piscicola geometra data from SRA

In this study, we assembled a complete mitochondrial genome of Codonobdella sp. sample from Lake Baikal, Russia and reassembled third party raw data of Piscicola geometra. Mitogenomes of both freshwater piscine leeches consist of 37 genes, including 13 protein-coding genes (PCGs), two ribosomal genes (12S and 16S), 22 transport RNA genes, and one control region. The complete mitogenome of Codonobdella sp. is 14,486 bp long and A + T biased (75.51%). The complete mitogenome of Piscicola geometra is 14,788 bp long and A + T biased (78.27%).

Haematophagous parasites of some fish species in the Lower Irtysh

The purpose of the research is study of four fish species infected with haematophagous parasites in the rivers of the Lower Irtysh basin. Materials and methods. The work was performed in the rivers of the Lower Irtysh basin in 2017–2020. A total of 390 fish of different sex and age were examined including 47 roach (Rutilus rutilus lacustris, (Pallas)), 41 ide (Leuciscus idus, (Linnaeus, 1758)), 47 pike (Esox lucius, (Linnaeus, 1758)) and 255 Siberian sterlet (Acipenser ruthenus marsiglii (Brandt, 1833)). We took blood from the tail artery, and examined its fresh drop under a microscope, and prepared a thin smear, then dried it in the air and fixed in a mixture of 70% ethyl alcohol and diethyl ether (1 : 1) for 30 minutes. The fixed smears were dried in the air at room temperature and stained with azure and eosin at a dilution of 1 : 10 for 40 minutes. We identified species of the found parasites and calculated the prevalence of infection with standard error of the mean.Results and discussion. We found representatives of the Coccidea and Kinetoplastea classes parasitizing in fish blood. Trypanoplasma acipenseris and Haemogregarina acipenseris were recorded in the Siberian sterlet. The pike was infected with T. schulmani and H. esoci. T. schulmani was found in the blood of the ide and roach. Piscicola geometra is the main host of flagellates and sporozoans that parasitize in fish blood in the basin of the Lower Irtysh. The roach and the Siberian sterlet become infected with parasitic flagellates from the age of 1+. All examined fish were infected in age groups 2+ – 4+. Haemogregarina parasitize in the pike aged 4+ and 5+, and in the Siberian sterlet aged 1+ – 4+ and 6+ – 7+.

Piscicola geometra (Linnaeus, 1761) leech parasitizing two fish species hosts from Greater Zab near Aski-Kalak, Kurdistan-Iraq, morphological and molecular investigations

Samples of two fish species, Cyprinus carpio and Silurus triostegus were collected from Aski-Kalak and inspected for the presence of parasitic leeches from March 2018 to February 2019 with a prevalence of 6.66 and 8.33 and mean intensity 0.10 and 0.11 respectively. Both hosts’ species were regarded as new hosts for this parasite in Iraq since no previous reports in this country. Collected leeches were fixed, preserved, and identified based on morphological and molecular techniques. For molecular identification, amplification and sequencing of 18S rDNA, with forward primer C1, (ACCCGCTGAACTTTAAGCAT, position 25), and reverse primer C3, (CTCTTCAGAGTACTTTTCAAC, position 390) were studied, while morphological identification based on well descried, and distinguished by focusing on color patterns, number vis arrangement of eyes, body annulations, gonopores shape and location, shape, location and size of body parts, in addition to some species-specific characters, criteria’s were documented by photographing and drawing illustrations.

ГОДОВАЯ ИЗМЕНЧИВОСТЬ ПАРАЗИТОВ ACIPENSER RUTHENUS MARSIGLII В НИЖНЕМ ТЕЧЕНИИ ИРТЫША

The article gives the analysis of infestation of Siberian sterlet Acipenser ruthenus marsiglii by parasites in the Lower Irtysh within 2017 to 2019. The annual changes in the species composition of parasites and in quantitative indicators of the fish infestation were revealed. In 2017 there were found 10 species of parasites, of which 4 were specific: Trypanoplasma acipenseris, Haemogregarina acipenseris, Acrolichanus auriculatum, Capillospirura ovotrichuria; in 2018 - 11 species, of which 6 were specific: T. acipenseris, H. acipenseris, Sphaerospora colomani, A. auriculatum, Truttaedacnitis clitellarius, Capillospirura itrichura; in 2019 - 7 species of parasites, of which 4 were specific: T. acipenseris, H. acipenseris, S. colomani, A. auriculatum. Of the broadly specific parasites, 6 species have been recorded: Trichodina acuta, Trichodina nigra, Trichodina sp., Diplostomum chromatophorum, Piscicola geometra, Unionidae gen. sp. In Siberian starlet blood there were registered T. acipenseris and H. acipenseris in all years of research. An increased extensiveness of invasion by these parasites was established. A significant decrease in infection with A. auriculatum trematode was found. The nematode C. ovotrichuria was recorded in sterlet only in 2017 and 2018. High values of infestation with Trichodina acuta, Trichodina nigra, Trichodina sp.were recorded. Myxosporidium Sphaerospora colomani was first recorded in the Ob-Irtysh basin. It has been suggested that the annual changes in the species composition of sterlet parasites are associated with the direct impact of the temperature regime and fluctuations in the level of the Irtysh basin

The parasitofauna of the Siberian sterlet Acipenser ruthenus marsiglii of the Lower Irtysh

In the Ob-Irtysh basin, studies on the parasitofauna of the Siberian sterlet are very limited and confined to the middle of the twentieth century. The decrease in the numbers of sterlet over the past half century may have led to a change in the qualitative and quantitative composition of the parasitofauna. The aim of this work is to study the parasitofauna of the Siberian sterlet in the rivers Irtysh and Tobol. 85 specimens of Siberian sterlet (L = 27.8–51.5 cm, 2+ – 6+) from the Tobol and Irtysh rivers were examined by the method of complete parasitological dissection during the periods from 5 to 21 June and from 14 to 22 July 2017. A comparison of the biodiversity of parasites was performed using the indices: Berger-Parker. 11 species of parasites were found, including four species specific to sturgeons: Cryptobia acipenseris (Joff, Lewashow, Boschenko, 1926), Haemogregarina acipenseris (Nawrotzky, 1914), Crepidostomum auriculatum (Wedl, 1858), Capillospirura ovotrichura (Skrjabin, 1924). Seven broadly specific species: Trichodina sp., Proteocephalus sp. (plerocercoids), Diplostomum chromatophorum mtc. (Vrown, 1931), Echinorhynchus cinctulus (Porta, 1905), Piscicola geometra (Linnaeus., 1761), Ergasilus sieboldi (Nordmann, 1832), Unionidae gen. sp. Cryptobia acipenseris and H. acipenseris were recorded for the first time in the Ob-Irtysh basin. C. acipenseris was found only in three fish from the total number of examined sterlet (3.5%). In the River Tobol the extent of infestation H. acipenseris was higher (22.7%) than in the River Irtysh 11.1%. The carriers of C. acipenseris and H. acipenseris in the Lower Irtysh are allegedly leeches of Piscicola geometra (10.6%). The most common parasites found were C. auriculatum (32.9%) and C. ovotrichura (15.3%). In the River Irtysh, metacercariae of Diplostomum chromatophorum (Vrown, 1931) (metacercariae) were discovered in the lens of the eye in the studied fish. The maximum EI of this parasite was noted in the fish sample near the city of Tobolsk – 12.5% with AI – 1 and IO – 0.12. In the Gornoslinkino area in June and July, the infection level was low (EI 4.3% and 8.3%, respectively). In the June sample of fish from the River Tobol no metacercariae of this species were detected. Single cases of infection of Proteocephalus sp. (plerocercoid), E. cinctulus, E. sieboldi, Unionidae gen. sp. were found. In the River Irtysh the parasitofauna was dominated by C. ovotrichura, in the River Tobol – C. auriculatum. The number of parasite species noted in the Siberian sterlet in the Ob-Irtysh basin according to our own and literary data is greater than that found in sterlet from the River Yenisei: 18 and 11 respectively. Common to the sterlet of the two basins are 8 species of parasites: Cryptobia acipenseris, Diclybothrium armatum, Crepidostomum auriculatum, Capillospirura ovotrichuria, Truttaedacnitis clitellarius, Echinorhynchus cinctulus, Piscicola geometra, Unionidae gen. sp. The fauna of the Ob-Irtysh basin was enriched by the "southern" narrowly specific parasite of sturgeon – H. acipenseris. For many years the infection of C. auriculatum has practically not changed.

Sakarya Büyük Akgöl’den tahta balığı Blicca bjoerkna’da parazit komünitenin kompozisyon ve yapısı

No data on the parasites of Blicca bjoerkna have been reported to date from Lake Büyük Akgöl. Therefore, the current study aimed to investigate the composition and diversity of parasite component and infra-communities in this cyprinid fish from hypereutrophic Lake Büyük Akgöl. A total of 61 B. bjoerkna were examined between July 2016 and June 2017. All fishes were hosts to at least one parasite species from the following taxa: Trichodina sp., Epistylis sp. (Protozoa); Myxobolus sp. (Myxozoa); Dactylogyrus sphyrna, D. cornu, D. cornoides, D. distinguendus and Paradiplozoon homoion (Monogenea); Caryophyllaeus laticeps and Cestoda gen. sp . (Cestoidea); Diplostomum sp., Thylodelphys clavata and Posthodiplostomum cuticola (Digenea); Piscicola geometra (Hirudinea); Glochidium sp. (Mollusca) and Argulus foliaceus (Crustacea). Dominant species in the component community were Diplostomum sp., D. cornoides, and D. cornu . Totally 2063 metazoan parasite individuals were collected . Parasite infra-communities of B.bjoerkna infected 1-10 species and the mean species richness found was 5.3. The mean metazoan parasite diversity (Shannon’s H index) was 2.08 and the Shannon-Wiener Evenness (E) had a mean value of 0.81. Identified parasite species in B.bjoerkna were the first records from Lake Büyük Akgöl.

Murat Nehri ve Kollarında (Doğu Anadolu Bölgesi, Türkiye) Yaşayan Musul İnci Balığı (Alburnus mossulensis)'nın Metazoan Parazitlerinin Mevsimsel Enfeksiyonu

This study was conducted to determine the frequency of metazoan parasitic infections of Mosul b leak ( Alburnus mossulensis ) in Murat River in Eastern Anatolia, Turkey. A total of 182 host fish were investigated, from January 2015 to March 2016. There were 972 metazoan parasites recorded in collected samples. Six species of Monogenea ( Dactylogyrus holciki , Dactylogyrus lenkorani, Dactylogyrus alatus , Dactylogyrus vistulae, Gyrodactylus sp., and Paradiplozoon homoion ), one species of Digenea ( Diplostomum spathaceum ), two species of Cestoda ( Caryophyllaeus laticeps, Ligula intestinalis ), one species of Nematoda ( Rhabdochona denudata ), one species of Hirudinea ( Piscicola geometra ) , and one species of Copepoda ( Eergasilus sp.) observed respectively. According to their prevalence from high to low ranks; Eergasilus sp. (34.6%), D. spathaceum (33%), P. homoion (19.8%), D. holciki (12.1%), C. laticeps (7.1%) D. alatus (6.6%), D. lenkorani (4.9%), R. denudata (4.9%), Gyrodactylus sp. (3.8%), P. geometra (1.6%), D. vistulae (1.1%) and L. intestinalis (0.5%) were calculated. Among these parasites D. lenkorani , D. vistulae, P. homoion, C. laticeps and R. denudata are the first record on Mosul b leak and D. holciki is the first record for Turkey freshwater fish parasites.

Anti-leech activity of Scutellaria baicalensis and Morinda citrifolia extracts against Piscicola geometra

Piscicola geometra leeches are naturally infecting cobia juvenile. The leeches attach to cobia by sucking and biting its surface and provide the gate of second infection. Water extracts of Scutellaria baicalensis root and Morinda citrifolia leaves were used to be tested through In Vitro method to look for the anti-leeches activity against Piscicola geometra. In this study, a total number of 800 leeches from infected cobia were prepared. The anti-leech activity from water extract of S. baicalensis root and M. citrifolia leaves were compared in different dilutions of plant extracts for 96 hours. Significant anti-leech activity was observed with M. citrifolia leaves with 80% mortality of leeches. S. baicalensis root showed higher anti-leech activity with 100% mortality of leeches. The average time was needed for S.baicalensis root to paralyzing and kill the leeches were 8h, 40h, 48h, 72h, and 96h in various dilutions of S. baicalensis root. This study indicated that S. baicalensis water extract had a potent for new anti-leeches agent.

Parasitofauna of the Caspian salmon (Salmo trutta caspius Kessler) at the salmon fish hatcheries of Azerbaijan for the period of their existence

The Caspian salmon is included in the Red List of Azerbaijan with the international status CR (Critically Endangered). The article presents the comparative analysis of the parasitofauna of the Caspian salmon (Salmo trutta caspius Kessler) during the period of its existence (1955–2015) at the hatcheries of Azerbaijan (Chaykend and Chukhur-Gabala salmon fish hatcheries). When comparing the quantitative index of parasitofauna for the first years after the creation of the salmon fish hatcheries (9 species of parasites) and studies carried out by the authors (7 species of parasites), it was revealed that the change was insignificant. However, significant changes in the species composition of the parasitofauna of the Caspian salmon were found. The parasites Chilodonella piscicola, Trichodina truttae, Eubothrium crassum, Rhabdochona gnedini, Cystidicoloides tenuissima, Piscicola geometra found in the first years of the salmon fish hatcheries were not recorded by the authors, and Bunodera luciopercae, Metechinorhynchus baeri, Pomphorhynchus laevis, Glochidium sp. revealed in recent studies were not observed in the early years. The dominant groups of parasites of the Caspian salmon were revealed. A systematic review of all parasites of salmonids found during this period is presented. Three species of parasites were noted for the first time in the territory of Azerbaijan for the Caspian salmon in the salmon fish hatcheries (trematode Bunodera luciopercae, acanthochephala Pomphorhynchus laevis and mollusk Glochidium sp.). The authors specifically noted parasites identified from 2005 to 2015 that are conditionally pathogenic for the Caspian salmon and capable to cause significant damage to the salmon hatcheries: Costia necatrix, Ichthyophthyrius multifiliis, Gyrodactylus derjavini, Metechinorhynchus baeri, Pomphorhynchus leavis, Bunodera luciopercae. The authors note that during the period of parasitological studies of the Caspian salmon in salmon hatcheries in Azerbaijan, pathogenic parasites for humans have not been found.

Parasitological survey of smelt, Osmerus eperlanus (Actinopterygii: Osmeridae), from five estuary sites along the southern coast of the Baltic Sea

Abstract This is the first comprehensive study covering the parasite fauna of smelt, Osmerus eperlanus, from five estuary sites of the southern Baltic Sea in a stretch of almost 500 km. We examined 432 smelt from: the Neman River mouth, the Vistula River mouth, Pomeranian Bay, the Oder River, and Lake Dąbie and recovered 13 species/higher-rank taxa of parasites: Diplostomum spp., Posthodiplostomum cuticola, Eubothrium crassum, Proteocephalus longicolis, Cystidicola farionis, Hysterothylacium aduncum, Corynosoma semerme, Pomphorhynchus laevis, Unionidae gen sp., Ergasilus sieboldi, Argulus foliaceus, Piscicola geometra, and Saprolegniaceae gen sp. Basic infection parameters such as prevalence, intensity of infection, mean intensity of infection, and the dominance index were determined. The findings of the presently reported study constitute a number of new faunistic records. There were two new host records (Posthodiplostomum cuticola and Saprolegniaceae gen sp.), five new host records for Poland (Diplostomum spp., Pomphorhynchus laevis, Piscicola geometra, Argulus foliaceus, and Unionidae gen sp.), and two new host records for Lithuania (Argulus foliaceus and Unionidae gen sp.). We carefully analyzed the relevant information from more than 100 publications on smelt parasites to compare the data with our own findings.

Ecological and faunistic characteristics of the leech fauna in the Bukhtarma Reservoir, Eastern Kazakhstan

The taxonomic diversity of the Hirudinea fauna and its dependence on the ecological conditions in the Bukhtarma Reservoir (Eastern Kazakhstan) have been studied. The morphological analysis has shown that these leeches belong to two orders and three families: Rhynchobdellida (families Glossiphoniidae and Piscicolidae) and Arhynchobdellida (family Erpobdellidae). On the whole, eight leech species from five genera (Alboglossiphonia, Helobdella, Theromyzon, Piscicola, and Erpobdella) have been identified. Among them, there are three glossiphoniid species (A. heteroclite, H. stagnalis, and T. tessulatum), two species of piscicolids (Piscicola geometra and Piscicola sp.), and three species of predatory leeches (E. octoculata, E. vilnensis, and Erpobdella sp.). Possible effects of hydrochemical parameters of the aquatic environment on the species diversity have been analyzed. Correlation has been revealed between the abundance of species and the physical and chemical characteristics of the environment.

Sex versus Gender in Sea Urchins and Leeches Two Centuries after Lamarck 1816

Bi-parental (sexual) reproduction via the fusion of egg and sperm produced by adult female/male individuals in populations of animals and plants is a key process of Life on Earth. Here, the terms “sex” (fertilization) and “gender” (role of male/female individuals as providers of gametes) are described, based on the concepts of Carolus Linnaeus (1707-1778) and Julius Sachs (1832-1897). In 1816, Jean Lamarck (1744-1829) introduced the purple sea urchin (Paracentrotus lividus) as a new species, and six decades later, Oscar Hertwig (1849-1922) used this model organism to elucidate external fertilization at the sub-cellular level. Moreover, Hertwig referred to “gender” to denote male or female P. lividus-individuals (gonochorists). Sexual reproduction and gender-roles are also outlined with reference to the fish leech (Piscicola geometra), a protandrous hermaphrodite characterized by hypodermic insemination and a gender-ration of 50:50. Finally, gender-issues in vertebrate development and evolution are addressed.

First Record of Piscicola geometra (Annelida, Hirudinea) on some Species of Cyprinidae from Euphrates-Tigris Basin in Turkey

First Record of Piscicola geometra (Annelida, Hirudinea) on some Species of Cyprinidae from Euphrates-Tigris Basin in Turkey

Ultrastructural analysis of apoptosis and autophagy in the midgut epithelium of Piscicola geometra (Annelida, Hirudinida) after blood feeding.

Cell death in the endodermal region of the digestive tract of the blood-feeding leech Piscicola geometra was analyzed using light and transmission electron microscopes and the fluorescence method. Sexually mature specimens of P. geometra were bred under laboratory conditions and fed on Danio rerio. After copulation, the specimens laid cocoons. The material for our studies were non-feeding juveniles collected just after hatching, non-feeding adult specimens, and leeches that had been fed with fish blood (D. rerio) only once ad libitum. The fed leeches were prepared for our studies during feeding and after 1, 3, 7, and 14 days (not sexually mature specimens) and some weeks after feeding (the sexually mature). Autophagy in all regions of the endodermal part of the digestive system, including the esophagus, the crop, the posterior crop caecum (PCC), and the intestine was observed in the adult non-feeding and feeding specimens. In fed specimens, autophagy occurred at very high levels—in 80 to 90 % of epithelial cells in all four regions. In contrast, in adult specimens that did not feed, this process occurred at much lower levels—about 10 % (esophagus and intestine) and about 30 % (crop and PCC) of the midgut epithelial cells. Apoptosis occurred in the feeding adult specimens but only in the crop and PCC. However, it was absent in the non-feeding adult specimens and the specimens that were collected during feeding. Moreover, neither autophagy nor apoptosis were observed in the juvenile, non-feeding specimens. The appearance of autophagy and apoptosis was connected with feeding on toxic blood. We concluded that autophagy played the role of a survival factor and was involved in the protection of the epithelium against the products of blood digestion. Quantitative analysis was prepared to determine the number of autophagic and apoptotic cells.

The first record of Piscicola pojmanskae Bielecki, 1994 in the Gulf of Gdańsk (the southern Baltic Sea) with species characteristics distinguishing it from Piscicola geometra (Linnaeus, 1758)

Abstract Specimens of Piscicola pojmanskae were identified in the macrozoobenthos community in Zostera meadows in Puck Bay. The presented paper is the first report on the observation of this species in the Gulf of Gdańsk (the southern Baltic Sea). Leeches are a rare component of the benthic fauna in this brackish water area.

A Report of Ectoparasite Piscicola geometra Linnaeus, 1761 Hirudinea: Rhynchobdellida on Roach Rutilus rutilus Linnaeus, 1758 from Uluabat Lake

An ectoparasite leech Piscicola geometra were found on female roach (Rutilus rutilus) between the anus and lateral line during the biometric measurements for the purpose of monitoring the fish population in Uluabat Lake. P. geometra was previously reported on Carassius gibelio and Tinca tinca from Lake Uluabat. It was understood with this case report that R. rutilus also is a host fish for P. geometra in Uluabat Lake.