Physalis Research Articles

Synthesis and characterization of multi-responsive iron oxide nanoparticles: Evaluation of antibacterial properties and photocatalytic activity

Cape gooseberry (CG) plant leaf extract-mediated iron oxide nanoparticles (CG-IO NPs) were fabricated for antibacterial research. The ideal concentration of the precursor salt, pH (11) of the reaction mixture, reducing agent to precursor salt ratio, and the production time of iron oxide nanoparticles were 5 mM, 9.0, 3:7, and 25 min, respectively. The iron oxide nanoparticles were tested using ultraviolet–visible absorption spectroscopy, photoluminescence (PL) spectroscopy, transmission electron microscopy (TEM), X-ray photoelectron spectroscopy (XPS), thermogravimetric/differential thermal analysis (TG/DTA), and Fourier transform infrared (FTIR) spectroscopy. FTIR spectroscopy was used to identify functional groups of the compounds, including the carbonyl, CH, and OH bands that reduced and produced nanoparticles. The size and shape of the synthesized CG-IO NPs were determined by TEM and dynamic light scattering, with the median and mean size of 13.9 nm and 15.8 nm, respectively. The thermal stability of the synthesized CG-IO NPs was assessed using TG/DTA in a nitrogen atmosphere. The elements and oxidation states of the CG-IO NP components were examined by XPS. The luminosity of the CG-IO NP was examined using PL spectroscopy. The synthetic CG-IO NPs exhibited strong antibacterial effects against dangerous bacteria, such as Salmonella enterica (S. entirica), Escherichia coli (E. coli), Streptococcus agalactiae, and Staphylococcus aureus. CG-IO NPs assisted in water reclamation by decomposing Malachite Green dye under solar light irradiation.

First report of natural infection by cowpea mild mottle virus on Sesbania cannabina and Physalis angulata in China.

Vigna unguiculata (L.) Walp. (cowpea) is an important economic vegetable in Sanya, Hainan Province, China. But it is easily infected by various viral diseases, especially cowpea mild mottle virus (CPMMV), bean common mosaic virus (BCMV) and cowpea polevirus 2 (CPPV2), causing symptoms such as yellowing, dwarfism and mosaic of leaves, affecting photosynthesis of cowpea. Weeds are perfect intermediate hosts for crop viruses. In the cowpea fields of Sanya, there are a large number of weeds growing nearby, including Sesbania cannabina (Retz.) Poir. and Physalis angulata (L.). S. cannabina, a species of legume, has high nutritional value as the one of the most admired green-manuring plants widely used in crop field for gaining yield and decreasing the quantity of chemical fertilizer (Tiwari et al. 2004). P. angulata, commonly known as husk tomato, is an annual Solanaceaea vegetable crop grown for its fruits (Ramakrishna Pillai et al. 2022). In July 2022, S. cannabina and P. angulata surrounding one hectare of cowpea fields of Sanya with chlorotic and asymptomatic (Figure S1) were collected, and then their total RNAs were individually extracted by the TRIzol Reagent (Life, USA), and two cDNA libraries (one including the RNA samples of S. cannabina, another including the RNA sample of P. angulata) were subsequently constructed using VAHTS Universal V8 RNA-seq Library Prep Kit (Vazyme, China). High-throughput sequencing was performed on a DNBSEQ-T7 platform (BGI, China) with the 150 bp paired-end method. A total of 40,134,299 and 149,473,308 clean reads were de novo assembled by SPAdes 3.15.5 to generate contigs, followed by BLAST-x/n search in viral genomes in GenBank. From the RNA-seq library of S. cannabina, we identified one contig (6255 nt) that exhibited 96.45% nucleotide identity to the CPMMV isolate CPMMV-JS (MT366555), covering 6033 bp out of 6255 bp (6033/6255) of the contig. Additionally, we found seven contigs (ranging in length from 1870 nt to 8336 nt) in the RNA-seq library of P. angulata that showed 78.92% to 84.15% nucleotide identity to the CPMMV isolate Brunt (OK558693), with specific alignment lengths varying from 669/795 to 4244/5337. CPMMV was verified by reverse transcription - polymerase chain reaction (RT-PCR) detection using specific primer (F: 5'-CTGGCCAAGTGGTTTGTTTT-3', R: 5'- AACCGGGTTTACAATCCACA -3') (Wei et al. 2020). PCR products were extracted from an agarose gel, cloned into the pMD19-T Vector (Takara, China), and transformed into Escherichia coli DH5α cells (Sangon Biotech, Shanghai). Two clones for each PCR product were sequenced by Sanger sequencing. The amplified 1865 bp fragments of S. cannabina (PP790744) and P. angulata (PP790743) had 98.07% identity (1727 bp out to 1761 bp) and 97.92% sequence identity (1739 bp out to 1776 bp) to CPMMV-JS (MT366555). Afterwards, we collected S. cannabina and P. angulata with similar symptoms around two cowpea fields (each field covers an area of about one hectare) in three districts of Sanya, namely Yazhou, Tianya, and Haitang, and conducted CPMMV detection. We found that CPMMV was detected in all six samples. CPMMV, including genus Carlavirus and family Betaflexiviridae, was first identified on cowpea in Ghana in the 1970s. Since then, it has been shown to have a very extensive geographical distribution and a wide natural host range. CPMMV principally infects Fabaceae, it is also able to infect hosts from Solanaceaea, Nyctaginaceae, Cleomaceae, Asteraceae and Lamiaceae (Celli et al. 2016; Lamas et al. 2017; Zanardo and Carvalho 2017). To our knowledge, this is the first report of natural infection of the S. cannabina and P. angulata by CPMMV, which may represent additional reservoirs of this virus in the region. Meanwhile, investigating CPMMV in S. cannabina and P. angulata is crucial for developing integrated strategies to prevent its transmission to economically important plants such as cowpea.

Unleashing the power of golden berry leaves to counteract cyclophosphamide's toll with antioxidant, anti-inflammatory, anti-apoptotic, and neurotransmitter boosting effects

Ethnopharmacological relevanceGolden berries (Physalis peruviana) are esteemed for their healing properties and widespread use in traditional medicine, particularly for their neuroprotective benefits. Aim of the studyThis work aims to evaluate the neuroprotective effect of golden berry total leaf extract cultivated in Egypt (TLE) against cyclophosphamide (CP)-induced neurotoxicity and to identify the chemical composition of different organs of P. peruviana from both Egypt and USA. Material and methodsMetabolite profiling of TLE was conducted using ultra-high-performance liquid chromatography combined with quadrupole time-of-flight tandem mass spectrometry (UHPLC-QTOF-MS/MS). In the animal model experiment, CP (100 mg/kg, i.p.) was administered once weekly for four weeks to induce neurocognitive dysfunction. Concurrently, TLE (500 mg/kg, orally) was administered twice weekly throughout the four weeks to evaluate its effectiveness in alleviating CP-induced neuronal deficits. Behavioral assessments, Morris water maze and passive avoidance tests, were conducted, followed by, histological evaluations of brain tissue samples. Additionally, biochemical analyses were performed on hippocampal tissue samples, examining the following markers, acetylcholinesterase activity (AChE), malondialdehyde (MDA), nitric oxide (NO), superoxide dismutase (SOD), reduced glutathione (GSH), catalase (CAT) activity, nuclear factor kappa B (p-NF-κB p65) (Ser536), Interleukin 1β (IL-1β), Interleukin 6 (IL-6), tumor necrosis factor-α (TNF-α), B-cell lymphoma 2 (Bcl-2), and Bax (Bcl-2-associated X) levels. ResultsTLE significantly preserved hippocampal neurons and improved cognitive performance in behavioral tests. TLE achieved these beneficial effects by suppressing AChE activity, diminishing the oxidative stress and restoring redox balance via inhibiting p-NFκB/IL-1β,/TNFα/IL-6 cascades. Leaf extract revealed the highest total phenolic content (TPC) (2.7 ± 6.41 mg GAE/g extract) and total flavonoid content (TFC) (0.37 ± 1.19 mg QE/g) and the strongest antioxidant effects in Ferric Reducing Antioxidant Power (FRAP) and 2,2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) assays with IC50 values of 21.13 ± 1.48 and 18.19 ± 1.29 μg/mL, respectively. UHPLC–QTOF-MS/MS analysis resulted in the tentative identification of 20 metabolites including phenolic acids, flavonoids, hydroxycinnamic acid amides, and alkyl resorcinols. ConclusionsFindings verify for the first time the neuroprotective potential of golden berry leaf, currently discarded as agricultural waste, and highlight its multifaceted mechanism of neuroprotection in CP-induced neurotoxicity, suggesting its suitability as a promising therapeutic agent for neurotoxicity management.

In vitro strategy to enhance the production of bioactive polyphenols and caffeoylputrescine in the hairy roots of Physalis peruviana L.

The Rhizobium rhizogene-transformed root culture from Physalis peruviana L. (P. peruviana) may be a promising and novel source of valuable phenolics, including caffeoylputrescine (CP), which is known for antioxidant, antidiabetic, insect-resistant, disease-resistant, and neuroprotective properties. In this study, to improve the production efficiency of phytochemical components in P. peruviana hairy root cultures, we optimized various culture conditions, including the inoculum size, liquid volume, culture media type, carbon source, sucrose concentration, initial pH, and application of elicitors, to enhance the total phenolic content and CP yield in these hairy root cultures. The findings indicate that the use of sucrose as carbon source resulted in the highest biomass (13.28 g DW/L), total phenolic content (6.26 mg/g), and CP yield (2.40 mg/L). The White medium excelled in enhancing the total phenolic content (9.35 mg/g), whereas the B5 medium was most effective for the biomass (13.38 g DW/L) and CP yield (6.30 mg/L). A sucrose concentration of 5% was best for the biomass (18.40 g DW/L), whereas a sucrose concentration of 4% was ideal for the CP yield. Optimal culture conditions were as follows: an inoculum size of 0.5 g/100 mL, a liquid volume of 100 mL in a 250-mL flask, B5 medium, 4% sucrose, and a pH of 5.5. Among the tested elicitors, methyl jasmonate (MeJA) at 100 µM significantly increased the biomass (21.3 g/L), total phenolic content (23.34 mg/g), and CP yield (141.10 mg/L), which represent 0.96-, 2.12-, and 13.04-fold increases, respectively, over the control after 8 days. The optimized HR culture of P. peruviana provides a promising system to enhance the production of CP for pharmaceutical applications.

Phytochemical study and evaluation of the antidiabetic and antihyperglycemic activities of the fruit extracts of Physalis peruviana L. (Solanaceae)

The aim of the study was to evaluate the antidiabetic and antihyperglycemic activities of Physalis peruviana L. (PP) fruit extracts as well as to determine the structure-activity relationship of some molecules from this plant using molecular docking. Medically, the plant has been used traditionally to treat diabetes and other diseases.The methanolic extract showed the highest yield of 12.01 %, while the lower yield of 2.74 % was observed in the ethyl acetate one. On the one hand, polyphenols (flavonoids, tannins and anthocyanins) were identified in the aqeous extract, while free quinones were not ; on the other hand, steroids and terpenoids were revealed in the organic extract, while bound quinones were absent. The quantitative analysis showed high level of some secondary metabolites (polyphenols, flavonoids, hydrolyzable and tannins), but low level of anthocyanins. Mineralogical analysis showed that the species contains minerals, essential for the organism and for the survival of the plant at significant concentrations (K, P, Ca, Mg, Na, Zn, etc.). The methanolic extracts of the species indicated high antidiabetic activity, comparatively to other extracts. The results of the antihyperglycemic test showed that the methanolic extract significantly inhibited orally induced hyperglycemia in mice. This inhibition was confirmed by molecular docking analyzes by interacting the molecules of the studied plant with two receptors, alpha-glucosidase (PDB id: 3WY1) and the kinase domain of the 5HHW insulin receptor.These experimental results lend credibility to the use of this species in traditional Congolese medicine to treat type 2 diabetes.

Biowaste‐Mediated Synthesis of CeO₂–TiO₂ Nanoparticles: An Efficient Recoverable Nanocatalyst for the Solvent‐Free Synthesis of Antipyrine Derivatives and Their Biological Evaluation

AbstractA facile, efficient, and environmentally friendly protocol for the solvent‐free synthesis of antipyrine‐ linked quinoline derivatives catalyzed by CeO2–TiO2 nanocatalyst under ultrasonication is developed. Antipyrine derivatives are involved in various synthetic processes and exhibit valuable biological activities, such as antibacterial, anti‐inflammatory, antioxidant, and anticancer properties. Biowaste‐ derived CeO2–TiO2 nanoparticles have been synthesized using outer covering calyx leaves extract of Physalis peruviana fruits and utilized for the construction of biologically important antipyrine derivatives by the multicomponent reaction in short reaction time with excellent yield. The nanocatalyst was characterized by FT‐IR, powder X‐ray diffraction (XRD), transmission electron microscopy (TEM), scanning electron microscopy (SEM), and electron dispersion spectroscopy (EDS). The functionalized nanoparticles show excellent reusability without any significant loss in catalytic activity. The hot filtering experiment shows that there is no noticeable leaching or boomerang effect and that the catalysis is heterogeneous in nature. All synthesized compounds underwent screening for antibacterial activity against selected microorganisms, and their antioxidant activity was assessed using DPPH (2,2‐diphenyl‐1‐picrylhydrazyl). Some of the synthesized compounds exhibited promising results in both screenings.

Deciphering the Cape Gooseberry Fruits Mycobiome for Further Safety Improvement Postharvest.

Cape gooseberries are exquisitely flavored fruits; their rapid deterioration reduces their shelf life. Understanding the unique mycobiome of fruit peels is an essential step in identifying the taxa causing postharvest loss. The current study proposes to analyze the fungal communities of cape gooseberry peels collected from an organic orchard at unripe and ripe stages and purchased from open-air market sites, using the ITS2 region metabarcoding. According to the Kruskal-Wallis test, there were no statistically significant differences found in either the phylogenetic or non-phylogenetic alpha diversity indices. Significant differences in fungal communities were observed between the market and orchard groups based on beta diversity results. Ascomycota (85.72-96.76%), Basidiomycota (3.21-13.91%), and Chytridiomycota (0.07-9.35%) were the most common fungal phyla, their abundance varying with the ripening stage and origin. Dothideomycetes in the orchard group and Saccharomycetes in the market group were the two most prevalent classes. Furthermore, we investigate which taxa showed a significant difference in abundance between the two conditions (market vs. orchard) using the analysis of compositions of microbiomes with bias correction (ANCOM-BC) test. Regardless of the phase, the orchard samples exhibited a notable increase in the mean absolute abundance of various beneficial fungal taxa, including Tilletiopsis washingtonensis and Articulospora proliferata, whereas the market samples demonstrated a high abundance of harmful yeasts and molds such as Meyerozyma guilliermondii, Candida railenensis, and Botrytis caroliniana. Although it is unclear how these microorganisms augment at the market sites and might impact the fruit quality after harvest, from a fruit safety perspective, it is essential to comprehend the diversity and variation of the mycobiome composition at different ripening stages to further develop strategies to improve food safety postharvest.

Estimación de la huella hídrica agrícola del DR 011, alto río Lerma

In the search for indicators that help measure the impact of human activities on the environment and natural resources, there is one that is very useful as an indicator of demand for global water resources. Estimating the water footprint of agricultural production allowed the identification of crops that can reduce it in favor of increasing water use efficiency. Hoekstra et al. (2011) methodology was used to estimate the water footprint of agricultural products in Irrigation District 011. It was found that of 14 crops in the district, in the average total water footprint in the irrigation modules (dam3 t-1), those of peanuts, beans, and nopal report the highest levels (1.7, 1.6, and 1.8, respectively), while those of lettuce, husk tomato, and carrot crops are the lowest (0.15, 0.29, and 0.25, respectively). Of the water footprint of total agricultural production (dam3), it was observed that corn participates with 43.4%; however, it accounted for 52.8% of total production. The peanut and alfalfa crops in module 05 are economically unaffordable, with high blue water costs per tonne ($8 623.00 and $11 914.00); nevertheless, they occupy 1% of the planted area. The variation of the water footprint of crops among the irrigation modules obtained helps identify the agricultural practices that contributed to increasing yields and optimizing the application of irrigation, consequently providing greater economic benefits to producers.

Rutin and Physalis peruviana Extract: Population Pharmacokinetics in New Zealand Rabbits

Background/Objectives: An extract of calyces from Physalis peruviana with hypoglycemic activity is being considered as a potential herbal medicine. Preclinical pharmacokinetics (PK) studies of the extract in rats, focusing on plasma concentrations of its main compound, rutin, and its metabolites, revealed PK interactions in the extract matrix that improved the absorption of rutin metabolites compared to the pure compound, among other PK effects. This research aimed to study the PK of rutin alone and in the extract and assess potential PK interactions in the extract matrix on the flavonoid and its metabolites in rabbits, a nonrodent species; Methods: Animals received pure rutin or extract orally and intravenously. The PK analysis used noncompartmental and population pharmacokinetics (popPK) methods, and simple allometry was applied to predict human PK parameters; Results: The rutin concentration–time profile fit a two-compartment model with first-order elimination, while its metabolites fit a double first-order absorption model. The extract matrix led to increased absorption, distribution, and elimination of rutin as well as increased bioavailability of its metabolites in rabbits; Conclusions: The popPK model defined the equations for PK parameters describing these findings, and the increased volume of distribution and clearance of rutin was maintained in human predictions. These results will support the development of a new herbal medicine.

Effects of an Extract of Physalis Peruviana Linnaeus on the Expression of Inflammatory Markers in the Caco-2 Intestinal Epithelium-like Cell Line

Objective: Physalis Peruviana Linnaeus (PPL) is an herbaceous species characterized by a wide variety of bioactive compounds to which anti-inflammatory properties have been attributed. This makes this fruit a possible complementary therapy for diseases that involve chronic inflammation, such as inflammatory bowel diseases (IBD). In the present study, the effect of a PPL extract on the expression of inflammatory markers in the Caco-2 cell line was evaluated. Methods: An in vitro gastric digest (50 g PPL pulp) was performed, obtaining an extract that was used to challenge Caco-2 cells for 24 and 72 hours. This extract was characterized by LC-MS/MS. Then, the relative mRNA expression of NF-kB, TLR4, IL-18 and MCP-1 was determined through qRT-PCR and the protein levels of TNF-α, IL-6, IL-8, IL-18 and MCP-1 through Luminex Immunoassay. Results: From the characterization of the extract, compounds with bioactive potential such as isothiocyanates, indoles and coumarins were found. Treatment of Caco-2 cells with PPL extract (80 µg/ml), particularly for 72 hours, produced a reduction of IL-18 and MCP-1 mRNA expression (p < 0.01), in addition to IL-18 (p < 0.01), IL-8 (p < 0.0001) and MCP-1 (p < 0.01) protein levels, however, no effects on NF-kB p65 (p = 0.09) and TLR4 (p = 0.20) mRNA expression were observed. Conclusion: The results obtained in this study open the possibility that the regular consumption of 50 g of PPL could constitute a possible complementary therapy for the treatment of IBD, improving the quality of life of these patients.

Potential of natural stimulants and spirulina algae extracts on Cape gooseberry plant: A study on functional properties and enzymatic activity

Potential of natural stimulants and spirulina algae extracts on Cape gooseberry plant: A study on functional properties and enzymatic activity

Protective and Therapeutic Effects of Medicinal Plants Against Food Additive-Induced Toxicity.

For thousands of years, people have used medicinal plants and in many parts of the world, traditional medicines continue to play a significant role in the standard treatment of a wide range of illnesses. With changes in modern eating patterns, there has recently been an increase in the use of processed foods. Furthermore, the use of food additives has increased in tandem with the production of processed foods. The dosage levels used for these additives are determined using empirical analyses. However, some additives have demonstrated long-term toxic effects on the human body in toxicity tests. Plants are one of the main sources of biologically active substances and in recent years, many studies have focused on the health benefits of phytochemicals and plant-derived extracts in the treatment and prevention of food additive toxicity. This review clarified studies on several medicinal plants, such as &lt;i&gt;Physalis peruviana&lt;/i&gt; L., &lt;i&gt;Jatropha tanjorensis&lt;/i&gt;, &lt;i&gt;Cymbopogon citratus&lt;/i&gt;,&lt;i&gt; Ficus carica&lt;/i&gt;, &lt;i&gt;Rosmarinus officinalis&lt;/i&gt; L. and others. The findings presented here demonstrate these plants' efficiency and success in preventing and lowering the toxicity of food additives through antioxidant activity reducing oxidative stress, and reduction in renal and hepatic toxicity. Therefore, these plant extracts have a preventive and therapeutic effect in reducing toxicity and may be the best option for reducing the toxicity of food additives in the future. Moreover, additional research is required to confirm the biologically active components found in medicinal plants that are effective in reducing this toxicity.

Phenylalanine, Cysteine, and Sodium Selenate Alleviate Chilling Injury in Cape Gooseberry (Physalis peruviana L.) Seedlings by Enhancing Antioxidant Activities and Membrane Stability

Low temperature is a major environmental factor that negatively affects the growth and productivity of plants, such as the tropical fruit Cape gooseberry (Physalis peruviana L.), which is susceptible to cold stress. Therefore, to investigate the effect of the amino acid L-phenylalanine (Phe), L-cysteine (Cys), or sodium selenite (Se) on enhancing antioxidant activities, experiments were conducted on the phenolic compounds, proline content, and membrane stability of Cape gooseberry seedlings under low-temperature stress. The seedlings were exposed for 48 h to a low temperature (4 °C) followed by 24 h of optimal growth conditions. In seedlings treated with Se, we found a high relative water content, good membrane integrity, low ion leakage, and hydrogen peroxide. Additionally, this treatment led to the improvement of photosynthetic pigments and antioxidant activity. The analysis of seedlings under cold stress showed that the Phe enhanced the stomatal conductance and phenol content. Furthermore, low concentrations of Cys resulted in the production of proline and flavonoids, which reduced the negative effects of environmental stress on seedlings and maintained cell membrane integrity. Overall, in this experiment, the use of Se and low concentrations of Cys had a positive effect on the amount of antioxidant compounds, which improved seedling growth under stress conditions.

Sensory Perception Systems and Machine Learning Methods for Pesticide Detection in Fruits

In this study, an electronic tongue (E-tongue) and electronic nose (E-nose) systems were applied to detect pesticide residues, specifically Preza, Daconil, Curzate, Bricol, Accros, Amistar, and Funlate, in fruits such as cape gooseberries, apples, plums, and strawberries. These advanced systems present several advantages over conventional methods (e.g., GC-MS and others), including faster analysis, lower costs, ease of use, and portability. Additionally, they enable non-destructive testing and real-time monitoring, making them ideal for routine screenings and on-site analyses where effective detection is crucial. The collected data underwent rigorous analysis through multivariate techniques, specifically principal component analysis (PCA) and linear discriminant analysis (LDA). The application of machine learning (ML) algorithms resulted in a good outcome, achieving high accuracies in identifying fruits contaminated with pesticides and accurately determining the concentrations of those pesticides. This level of precision underscores the robustness and reliability of the methodologies employed, highlighting their potential as alternative tools for pesticide residue detection in agricultural products.

Oxygen self-doped physalis peruviana calyx husk-derived porous carbon for supercapacitors

Oxygen self-doped physalis peruviana calyx husk-derived porous carbon for supercapacitors

Phenotypic and Biochemical Trait Improvement in Husk Tomatoes (Physalis sp.) through EMS-Induced Mutagenesis

Husk tomatoes are used in salsa and traditional medicine to alleviate illnesses. Market demand requires husk tomato varieties with improved agronomic and physicochemical health benefits. Mutagen application alters plant genomes, creating new traits and genetic diversity. The efficacy of EMS (ethyl methanesulfonate) was examined for morphology, bioactive compounds, and phytochemical improvement. Three husk tomato genotypes representing Physalis philadelphica and Physalis ixocarpa underwent two hours of 1.4% EMS. In addition to yield and yield-related properties, total phenol, antioxidant activity, chlorophyll a and b levels in leaves and fruits, and phytochemical concentrations of Na, Mg, Ca, Mn, Fe, Cu, and K in fruits were measured. Genotype-dependent morphological changes were found. The mutants C1T6 (85 cm) and C1T7 (87.60 cm) were shorter than Control C1 (102 cm). The highest yield was 5.80 g for C1T5; Control C1 produced 3.08. The mutant C2T6 produced the most (5.99 g) compared to its control (2.85 g). Mutants had higher total phenol, antioxidant activity, and leaf/fruit chlorophyll. C1T2 had the highest antioxidant activity (1.19 ng/µL). C2T1 outperformed Control C2 at 1.54 ng/µL phenolic content. C3T2 had the highest Ca content (1822 µg/g), while Control C3 had 861.20 µg/g. Mutations altered phytochemical composition, which can be used to generate nutritionally superior husk tomato varieties. Additionally, scientists will be able to study mutants with advantageous morphological and biochemical traits, enabling extensive research. Furthermore, the mutants will serve as a genetic repository for the progression of breeding procedures.

Cape Gooseberry (Physalis peruviana L.) Volatile Compounds Determination by Vacuum-Assisted Sorbent Extraction (VASE)-Selected Aspects.

Vacuum-Assisted Sorbent Extraction (VASE) is a novel extraction technique that uses vacuum to facilitate the transfer of volatile compounds from the matrix to the sorbent. This technique was explored for extraction of volatiles from cape gooseberry fruit, for both qualitative and quantitative analyses. Selected extraction parameters were tested: sample size, extraction temperature and time, influence of tissue disintegration on release of volatiles, and also addition of Ag+1 ions in the form of AgNO3 to stop enzymatic formation of volatile compounds. For selected conditions (10 g sample, extraction for 30 min. at 40 °C of volatiles from blended fruit) quantitative aspects were explored. Twenty-two compounds of cape gooseberry were tested. The method was characterized with a very good linearity in a range of 10-5000 µg/kg and good reproducibility. The experiments proved the usefulness of VASE in both volatile profiling and quantitative analyses of cape gooseberry and in prospective other fruit.

Genome characterization of a multi-drug resistant Escherichia coli strain, L1PEag1, isolated from commercial cape gooseberry fruits (Physalis peruviana L.).

Foodborne infections, which are frequently linked to bacterial contamination, are a serious concern to public health on a global scale. Whether agricultural farming practices help spread genes linked to antibiotic resistance in bacteria associated with humans or animals is a controversial question. This study applied a long-read Oxford Nanopore MinION-based sequencing to obtain the complete genome sequence of a multi-drug resistant Escherichia coli strain (L1PEag1), isolated from commercial cape gooseberry fruits (Physalis peruviana L.) in Ecuador. Using different genome analysis tools, the serotype, Multi Locus Sequence Typing (MLST), virulence genes, and antimicrobial resistance (AMR) genes of the L1PEag1 isolate were determined. Additionally, in vitro assays were performed to demonstrate functional genes. The complete genome sequence of the L1PEag1 isolate was assembled into a circular chromosome of 4825.722 Kbp and one plasmid of 3.561 Kbp. The L1PEag1 isolate belongs to the B2 phylogroup, sequence type ST1170, and O1:H4 serotype based on in silico genome analysis. The genome contains 4,473 genes, 88 tRNA, 8 5S rRNA, 7 16S rRNA, and 7 23S rRNA. The average GC content is 50.58%. The specific annotation consisted of 4,439 and 3,723 genes annotated with KEEG and COG respectively, 3 intact prophage regions, 23 genomic islands (GIs), and 4 insertion sequences (ISs) of the ISAs1 and IS630 families. The L1PEag1 isolate carries 25 virulence genes, and 4 perfect and 51 strict antibiotic resistant gene (ARG) regions based on VirulenceFinder and RGI annotation. Besides, the in vitro antibiotic profile indicated resistance to kanamycin (K30), azithromycin (AZM15), clindamycin (DA2), novobiocin (NV30), amikacin (AMK30), and other antibiotics. The L1PEag1 isolate was predicted as a human pathogen, matching 464 protein families (0.934 likelihood). Our work emphasizes the necessity of monitoring environmental antibiotic resistance, particularly in commercial settings to contribute to develop early mitigation techniques for dealing with resistance diffusion.

Gray mold disease on bottle gourd caused by Cladosporium tenuissimum in China.

Bottle gourd [Lagenaria siceraria (Mol.) Stand] is a widely cultivated succulent crop species. In December 2022, a serious bottle gourd disease occurred in the protected vegetable planting base of Xingguo County, Ganzhou City, Jiangxi Province, China, with 85% of the 2,100 plants having gray mold disease-like symptoms, including gray spots on the infected fruit. They quickly expanded at suitable temperature and humidity, forming a gray mold layer with inward depressions, which spread to the fruit stem causing watery rot, and the flesh turned black and started to rot. To isolate the pathogen, fruits of the diseased plants were surface-disinfected with 75% ethanol for 30 s, immersed in 0.1% HgCl2 for 1min, rinsed thrice with sterile water, and cultured on a potato-dextrose agar (PDA) medium at 28°C. Mycelia from the diseased tissue were subcultured on fresh PDA medium to obtain pure cultures. After incubation at 25°C for 7 days, olive-green colonies (~2.5mm·d-1) developed. Cultures developed numerous elliptical and limoniform conidia measuring 2.69~9.79 μm to 2.10~5.92 μm (average 5.62×3.12 μm) (n=20). The morphological characteristics of the pathogen resembled those of Cladosporium spp. Fungal genomic DNA was extracted, and the internal transcribed spacer (ITS), partial translation elongation factor-1 alpha (TEF-1α), and actin (ACT) regions were amplified with primers ITS1/4, TEF-728F/986R, and ACT-512F/783R, respectively, and sequenced (Bensch et al. 2012; Jo et al. 2018). Basic Local Alignment Search Tool analysis (BLAST) revealed that the ITS (accession no. OQ186729), ACT (OQ240962), and TEF-1α (OQ240963) sequences of isolate hjt4 shared the highest similarity (99-100%) with those of Cladosporium tenuissimum (accessions no. OM232068, OM256530, OM256526) (Duccio et al. 2015). A phylogenetic tree of the isolate hjt4 and its close relatives within Cladosporium was constructed using the MEGA X neighbor-joining method. The pathogen was identified as C. tenuissimum based on morphological and molecular characteristics. A specimen (JXAU-H2022982) was deposited at the Herbarium of the College of Agronomy, Jiangxi Agricultural University. To confirm its pathogenicity, seven-day-old healthy bottle gourd fruits were disinfected with 75% ethanol, 1 mm-deep wounds were made with sterilized scalpels, and the plants were inoculated with PDA plugs (0.8 cm in diameter) containing actively growing mycelia of isolate hjt4. Plants inoculated with sterile PDA plugs served as controls. Each group contained three fruits, and the experiment was performed in triplicate. All fruits were incubated in a biochemical incubator at 28°C. After 3 days, the fruit surface shrank, and the flesh turned to a black colour and rotten, which rapidly spread to the branches. Control fruits did not develop any symptoms. Reisolated colonies showed the same morphological traits as those of the inoculation isolates, whereas no target colonies were isolated from the control fruits. The pathogen was previously reported to cause leaf blight disease in Coriandrum sativum (Zhou et al. 2022) and sooty spots on Cape gooseberry (Miyake et al. 2022), among others. To our knowledge, this is the first report of gray mold disease caused by C. tenuissimum on bottle gourd in China. The findings provide an important foundation for monitoring and controlling the spread of this disease.

Analisis In Silico : Aktivitas Antiinflamasi dan Prediksi Toksisitas Senyawa Metabolit Sekunder Daun Ciplukan (Physalis peruviana L.)

The way of life back to nature, including in the field of health, forms the habit of using plants as traditional medicine. Traditional medicine is indicated to be able to cure a variety of diseases. As with the leaves of Ciplukan (Physalis peruviana L.) by the people of Desa Wanasuka Kecamatan Pangalengan Kabupaten Bandung is considered to be used as a traditional medicine for inflammatory diseases such as rheumatism, asthma, and gastritis (maag) due to side effects and toxicity produced relatively small when compared with modern medicine. The aim of this study is to identify the potential of the secondary metabolite compound found in the leaves of the Ciplulan (Physalis peruviana L.) as a candidate for anti-inflammatory drugs. These research methods are molecular methods of docking through physical chemical properties testing, pharmacokinetic profiles of test compounds through site Pre-ADMET (Absorption, distribution, metabolism, excretion, and toxicity) and Lipinski Rule of Five. The results of this study showed that the binding affinity of caffeic acid compounds with PTGS2 receptors (PDB ID: 5F19) showed a more negative result compared to the comparative drugs Aspirin and Ibuprofen -7.4. There was a molecular interaction similar to Aspirin, in which the addition of amino acid residues from ASN 382 and TYR 385 produces a strong irreversible inhibition of PTGS2 (PDB ID: 5F19) and is predicted to inhibit prostaglandin H synthase and indicate that caffeic acid is capable of producing irreverible inactivation of PTGS2 (PDB ID:5F19). So potentially a candidate for a safer anti inflammatory drug for the body. Because it has almost the same or close potential as Aspirin against inflammatory diseases.