Morphology Of Perineal Patterns Research Articles

First Report of Northern Root-Knot Nematode Meloidogyne hapla on Atractylodes lancea in Hubei Province, China.

Atractylodes lancea (Thunb.) DC. is a well-known medicinal plant with high medicinal and economic value, and currently more than 6000 hectares are planted in China. Root-knot nematodes Meloidogyne hapla has been one of the most important pathogens on A. lancea. In September 2019, A. lancea plants exhibiting symptoms of severely stunting and gall formation in the roots associated with root-knot nematode (RKN; Meloidogyne spp.) were detected in a commercial production field in Yingshan, Hubei Province, China (30.96°N; 115.94° E). Females and second-stage juveniles (J2s) collected from roots had the following morphometric characteristics: females (n=20) were pear-shaped, the front part of the worm had a prominent neck, and the stylet was short and obvious. The perineal pattern of females were generally round hexagonal or round-shaped, with a squared-off dorsal arch or a rounded-off arch, some had lateral lines marked (Eisenback et al. 1980). Body length (L) = 750.49 ± 87.02 μm (578.75 - 902.65 μm), maximum body width (W) = 471.97 ± 70.95 μm (318.7 - 586.3 μm), stylet length = 15.18 ± 0.96 μm (13.52 - 17.04 μm), dorsal pharyngeal gland orifice to stylet base (DGO) = 3.07 ± 0.37 μm (2.60 - 3.80μm). The second-stage juveniles (n=20): L = 480.05 ± 42.73 μm (375.3 - 552.5 μm), stylet length =12.59 ± 1.39 μm (10.5 - 16.8 μm), tail length= 53.35 ± 1.55 μm (51.8 - 54.9 μm), hyaline tail terminus =11.45 ± 0.65 μm (10.2 - 12.1 μm). The morphological characteristics matched the original description of M. hapla (Chitwood 1949). Males were not found. Matrix code for the polytomous key proposed by Castillo (Castillo et al. 2021): Female: A23, B43, C213, D1 (A, Body length; B, Stylet length; C, The excretory pore position in the female in relation to the stylet length (EP/ST) ratio; D, Perineal pattern morphology); J2: A3, B3, C34, D324, E32, F3 (A, Body length; B, Stylet length; C, Tail length; D, Hyaline region length; E, The long tail length to the short tail length ratio; F, The long hyaline region length to the short hyaline region length ratio). The DNA, extracted from six single females, was used for species identification, and 28S rDNA D2/D3 universal primers D2A (5'ACAAGTACCGTGAGGGAAAGTTG3') and D3B (5'TCGGAAGGAACCAGCTACTA3') were used (Nunn 1992). The DNA fragment obtained showed that the amplified sequences of the D2/D3 region (GenBank Accession No. MZ 570969, 769bp) shared 100% homology with the sequences of M. hapla (MN752204.1, MN752204.1, MN752204.1). Furthermore, species-specific SCAR primers JMV1 (5'GGATGGCGTGCTTTCAAC3') and JMV hapla (5'AAAAATCCCCTCGAAAAATCCACC3') were used as described by Dong et al. (2015). PCR produced 442-bp sequences. Fragments were sequenced (GenBank Accession No. OM 864510, 442bp) and compared with available sequences on NCBI. Sequences were 99%-100% identical to the M. hapla sequences (GenBank Accession Nos. AJ421708.1, GQ130137.1 and AJ421707.1). To verify the nematode pathogenicity on A. lancea, ten RKN-free A. lancea seedlings were transplanted into plastic pots. After 21 days, the roots of eight plants were inoculated with 1,200 J2s and eggs of M. hapla that were the same isolate collected from the field per plant and two uninoculated plants were used as control. Plants were maintained in a greenhouse at 25°C and 70% relative humidity with a 12-h/12-h light/dark photoperiod. After 70 days, all inoculated plants exhibited stunting and had scarce galling on roots. This is similar to those fieldgrown plants. No galling or symptoms were observed on the control plants. The nematode reproduction factor (RF = final population/initial population) was 2.3. These results had confirmed that the root-knot nematode population on A. lancea was M. hapla. The rhizome yields and quality of the A. lancea infected by M. hapla were seriously affected, which caused severe economic losses. Moreover, the infected plants tended to be more susceptible to some bacterial and fungal diseases, such as root rot disease. To our knowledge, this is the first report of A. lancea as a new host of M. hapla in Hubei Province, China.

Assessment of root-knot nematode, M. incognita and identification of the source of resistance in cauliflower, Brassica oleracea

Root-knot nematodes of genus Meloidogyne are the most devastating plant parasitic nematodes of vegetable crops responsible for severe global economic losses. The objective of the present work was to study the diversity of Meloidogne species in cauliflower growing areas of Punjab and to identify the source of resistance against M. incognita. The root and soil samples were collected from the cauliflower growing areas and associated nematode specie(s) was identified based on perineal pattern morphology and morphometry of adult females. M. incognita sp. was found most prevalent in all the cauliflower growing areas surveyed. A total of thirty genotypes of Cauliflower (Brassica oleracea) was screened against root-knot nematode, M. incognita, in pots. Four genotypes viz., LSMVAR-6, PI1654, LSMVAR-2 and LS-4 were resistant to M. incognita with root galling index (RGI) less than 2.0 and reproduction factor (Rf) less than 1.0. Among others, fourteen genotypes showed hypersusceptible (RGI 2.0- 2.6; Rf 0.57-1.0) and eleven genotypes showed a susceptible reaction. The resistant genotypes identified in the present study may be utilized to incorporate resistance against M. incognita in commercial cauliflower cultivars.

Distribution of Meloidogyne species in carrot in Brazil

ABSTRACT: Root-knot nematodes (RKN - Meloidogyne spp.) are one of the most serious threats to carrot production worldwide. In Brazil, carrots are grown throughout the year, and economic losses due to RKN are reported. Since little is known on the distribution of RKN species in carrot fields in Brazil, we collected plant and soil samples from 35 fields across six states. Based on the morphology of perineal patterns, esterase phenotypes and species-specific PCR, three Meloidogyne species were identified: 60% of the fields were infested with Meloidogyne incognita, M. javanica was reported in 42.9% of the areas, whereas M. hapla was detected in 17.1% of carrot fields. Mixed populations were reported in 20% of the areas with a predominance of M. incognita + M. javanica. The combination of morphological, biochemical, and molecular techniques is a useful approach to identify RKN species.

Distribution and incidence of root-knot nematodes (Meloidogyne spp.) on pepper in Sinaloa, Mexico

Root-knot nematodes (RKNs; Meloidogyne spp.) are a major constraint of pepper (Capsicum annuum L.) crops worldwide. In Mexico, Sinaloa State is one of the main producers of pepper; however, there is little information available on the distribution, prevalence, and incidence of RKN on this crop. Identification of RKN species and estimation of the epidemiological factors are important to design its management strategies. A total of 190 RKN samples from Los Mochis, Culiacan, La Cruz, and Escuinapa areas of Sinaloa were collected from pepper plants at production stage under greenhouse conditions, to analyze the distribution, prevalence, and incidence of RKN. Primary identification of RKN species was based on perineal pattern morphology and confirmed by molecular SCAR marker–based identification. RKNs were found in all the surveyed greenhouses of pepper, confirming their absolute distribution and prevalence in this crop. Meloidogyne enterolobii, Meloidogyne incognita, and Meloidogyne javanica were identified in the four areas. Overall incidence of M. enterolobii, M. incognita, M. javanica, and mix of M. enterolobii + M. incognita was 63.7, 11.7, 12.8, and 11.7%, respectively, indicating that RKNs are a serious threat for pepper and other crops in Sinaloa State. This information will enable pepper growers to design and implement an appropriate control for RKN species.

Association of root-knot nematode (Meloidogyne javanica) in olive plantations in Rajasthan (India) and its natural suppression by Pasteuria penetrans

This study aims to identify the root-knot nematode (RKN) at seven olive plantations in Rajasthan (India), and understand the possible spread of RKN and its bacterial parasite, Pasteuria penetrans through olive planting material (OPM). We identified the RKN as Meloidogyne javanica based on perineal pattern morphology and species-specific SCAR marker. RKN was prevalent at all the locations with high natural incidence (50–90%) of P. penetrans in the females dissected from unstained roots. An artificial exposure of air-dried soil of seven locations to healthy juvenile (J2) of M. javanica showed that the trend was consistent with the natural population. We conclude that root hardening media comprising of dried river sand and nematode-infested soil mixed at the secondary site (Jaipur) in India possibly resulted in M. javanica infection of OPM along with P. penetrans. Our study suggests that P. penetrans proliferated to suppressive levels and kept the nematode population below damaging levels.

Comprehensive report on the prevalence of root‐knot nematodes in the Poonch division of Azad Jammu and Kashmir, Pakistan

AbstractThe present study documents the root‐knot nematodes (RKN) fauna of the Poonch division in Azad Jammu and Kashmir infecting vegetables. An overall prevalence of 40% of RKN was recorded. Of the four districts investigated, maximum prevalence was recorded in district Poonch with 59%, followed by Sudhnuti with 58%. The lowest prevalence of RKN was found in districts Bagh (29%) and Haveli (33%). Out of 15 vegetables investigated, RKN was found on five crops. The highest prevalence of 37.8% was recorded on okra, followed by 31.3% on cucumber and 17.5% on tomato. RKN was less prevalent on eggplant (8.3%) and beans (7.7%). Three RKN species, that is Meloidogyne incognita, Meloidogyne javanica and Meloidogyne arenaria, were found infecting the hosts. M. javanica was found to be the most prevalent followed by M. incognita and M. arenaria. This trend was found in all the districts. Overall prevalence of M. javanica as sole population was 9% and that of M. incognita was 2%. Meloidogyne arenaria was not found in any of the fields as sole population. The prevalence of M. incognita with M. javanica or M. arenaria as mixed populations was 8% and 5%, respectively, and that of M. javanica with M. arenaria was 4%. Similarly, all the three species prevailed as mixed populations in 12% of the fields in the division. The severity of RKN infections, measured as galling index, was found to be variable within each infected field (GI 2–9). Identification of RKN species was based on the morphology of perineal patterns and confirmed by molecular SCAR and CO1 makers based identification. In conclusion, RKN were distributed in the Poonch division and M. javanica was predominant. Cucumber, okra, tomato and eggplant were severely attacked by these nematodes warranting the adoption of stringent control strategies for their management.

First report of root-knot nematodes (Meloidogyne species) infecting Chinese Elm (Ulmus parvifolia) in Florida, USA.

Samples of galled roots, resembling those induced by root-knot nematodes, and rhizosphere soil were collected from potted plants of Ulmus parvifolia cvs. Allee and Drake in Lake County, Florida. Nematode species were identified using both molecular analysis and morphology of perineal patterns. Meloidogyne enterolobii and M. javanica were identified from U. parvifolia cv. Allee. Meloidogyne arenaria and M. javanica were identified from U. parvifolia cv. Drake. This is a first report of these nematode species infecting Chinese Elm in Florida.

Meloidogyne luci, a new root‐knot nematode parasitizing potato in Portugal

In 2013, during a field survey conducted in Portugal on potato, Solanum tuberosum, an unusual esterase (EST) phenotype was detected in a root‐knot nematode (RKN) from potato roots collected in Coimbra. This Portuguese isolate was purified and maintained on tomato, S. lycopersicum, and morphological, biochemical and molecular characteristics were studied. Perineal pattern morphology was highly variable, similar to Meloidogyne ethiopica and not useful for identification. The EST phenotype, from young egg‐laying females, displayed three bands similar to the Brazilian M. luci (L3) and distinct from M. ethiopica (E3). Phylogenetic analyses of mitochondrial cytochrome oxidase subunit I and the mitochondrial DNA region between COII and 16S rRNA genes revealed that the Portuguese isolate grouped with M. luci isolates close to M. ethiopica isolates. However, considering the ITS1‐5.8S‐ITS2 region, the Portuguese isolate grouped with isolates of M. luci, M. ethiopica and M. hispanica, which limits the confidence of this region for M. luci diagnosis, and its differentiation from other species with morphological similarities. The M. luci pathogenicity to potato was also assessed in 16 commercial cultivars and compared with M. chitwoodi, considered to be a quarantine RKN species by EPPO. All potato cultivars were susceptible to both Meloidogyne species with gall indices of 5 and higher reproduction factor values ranging from 12.5 to 122.3, which suggests that M. luci may constitute a potential threat to potato production. In the present study, M. luci is reported for the first time attacking potato in Portugal.

Meloidogyne ethiopica parasitizing melon fields in Rio Grande do Sul State, Brazil

Samples of melon plants with aerial symptoms that represented yellowing of leaves and stunting, and below-ground galls on the roots from two growing areas in the Municipality of Vicente Dutra, Rio Grande do Sul State, Brazil, were obtained. The parasitizing nematode species was identified as Meloidogyne ethiopica based on perineal pattern morphology, esterase phenotypes, and molecular composition (D2–D3 region). This is the first formal record of melon being infected by M. ethiopica in Brazil.

Identification of root-knot nematodes (Meloidogyne spp.) fromgreenhouses in the Middle Black Sea Region of Turkey

Root-knot nematodes are among the main important pests causing serious yield losses in greenhouses worldwide, including Turkey. Accurate identification of these pests is essential for determining appropriate control strategies. Identification of Meloidogyne species based on perineal pattern morphology alone is not viable or reliable due to overlaps and high variability among the species. Therefore, our objective was to overcome the difficulties in identifying 90 populations of root-knot nematodes collected from different greenhouses in the Middle Black Sea Region (Samsun, Tokat, Amasya, Çorum, Ordu, and Sinop provinces), using not only morphological (perineal pattern morphology) but also biochemical (esterase phenotype) and molecular (PCR with species-specific primers) techniques. The results indicated that M. arenaria, M. ethiopica, M. javanica, and M. incognita were identified at 42.2%, 41.1%, 12.2%, and 4.4% of the total populations, respectively. Meloidogyne ethiopica was detected for the first time in Turkey on eggplant (Solanum melongena L.) and nightshade (Solanum nigrum L.), and was only found in greenhouses in the coastal provinces (Samsun, Sinop, Ordu) of the Middle Black Sea Region. Our study confirmed that the E3 esterase phenotype is a useful character for distinguishing M. ethiopica from other Meloidogyne species.

A First Report of Paulownia elongata as a Host of Meloidogyne spp. in Florida.

Paulownia elongata S.Y. Hu (Scrophulariaceae) is a fast-growing tree cultivated for highly prized timber. In April 2007, root-knot nematodes were found to be infecting 5-year-old plants of P. elongata growing on a farm in Levy County, Florida. Symptoms included leaf yellowing, stunted growth, and reduced trunk diameter. Infected roots were severely galled and frequently rotted. Large and coalesced galls were observed on secondary roots and distinct galls were present on tertiary roots. Species identifications were done by morphological characters of females and isozyme phenotypes (esterase and malate dehydrogenase) extracted from young egg-laying females and resolved with polyacrylamide gel electrophoresis in a BioRad Mini Protean III system (BioRad, Hercules, CA). Four species of root-knot nematodes were found to be infecting P. elongata. Morphology of perineal patterns and the isozyme phenotypes were consistent with those of M. arenaria, M. incognita, M. javanica, and M. mayaguensis (1). M. incognita and M. javanica have been described earlier on P. fortunei and P. tomentosa (2), but to our knowledge, this is the first report of P. elongata as a host of these four Meloidogyne spp.