Peanut In China Research Articles

Prevention of Cadmium Contamination by Microbial Inoculant and Its Potential Mechanism

Cadmium is the main heavy metal contaminant of food in the world. The extent of cadmium pollution in peanut in China remains unclear. To determine the cadmium pollution level in peanut, samples from the main producing regions in China were assessed. The findings revealed that the cadmium pollution level in Chinese peanuts was relatively low. Moreover, the Aflatoxin Rhizobia Couple B. amyloliquefaciens, B. laterosporu, B. mucilaginosus, E. ludwiggi (ARC-BBBE) microbial inoculants on cadmium contamination in peanut were evaluated. The fertilization methods were categorized into conventional fertilization and conventional fertilization supplemented with 60 kg/hectare of microbial inoculant ARC-BBBE as the base fertilizer. The cadmium contents in the soil and peanut plant parts were detected and analyzed. The results demonstrated that the microbial inoculant ARC-BBBE significantly reduced the total cadmium content in peanut, as well as the available cadmium and exchangeable cadmium in soil. Furthermore, the pH and urease and alkaline phosphatase activities in soil were significantly enhanced, suggesting that the microbial inoculant ARC-BBBE decreased cadmium content in soil and reduced the cadmium uptake by plants through a combination of the action of the bacteria itself and the secretion of extracellular substances. This ultimately achieves the goal of reducing the cadmium content in peanut seeds.

Occurrence of Watermelon silver mottle virus in Peanut in China.

Watermelon silver mottle virus (WSMoV), a member of the genus Orthotospovirus of the family Bunyaviridae, was first identified in watermelon in Okinawa prefecture, in Japan (Iwaki et al. 1984). Subsequently, it was reported in a variety of solanaceae and cucurbitaceae crops such as tomato, pepper, and watermelon (Jones et al. 2005). WSMoV is naturally transmitted by vector thrips, and cause chlorotic, ring spots, and crinkling in the hosts (Yeh et al. 1992; Jones et al. 2005). So far, no confirmed reports exist regarding the WSMoV infecting peanut (Arachis hypogaea L.). In a field survey conducted in Yunnan Province, China during July 2022, young peanut plants were observed that were severely stunted (Fig. S1A). The leaves of five symptomatic peanut plants were randomly collected and used to identify potential pathogens via high throughput sequencing (HTS) analysis. Total RNA was extracted using TRIzol® Reagent (Invitrogen, CA, USA) according to the manufacturer's instructions. Approximately 10 μg of total RNA was purified using magnetic beads (Thermo Fischer Scientific, U.S.A.). A TruSeq RNA sample prep kit (Illumina, San Diego, CA, USA) was utilized for constructing the RNA sequencing library and transcriptome sequencing was performed on an Illumina HiSeq4000 platform (LC Sciences, USA) with a paired-end 150 bp manner. After RNA-seq, 35962944 raw reads were generated as paired-end data. Following quality control, a total of 34026806 clean reads were retained and subsequently assembled into contigs using Trinity software (version 2.8.5). The BLASTn analysis showed that three contigs mapped to the L, M, and S RNA segments of the WSMoV isolates, respectively (accession no. AY863200.1; no. AB042650.1; no. U75379.1). The lengths of three contigs were 8913 bp, 4921 bp, and 3558 bp, and the breadth coverage were 99.97%, 100%, and 100%, respectively. The sequences for L, M and S RNA segments of the WSMoV isolate from Yunnan were submitted to NCBI with the accession number OR123869-OR123871. Specific primers were designed for the nucleocapsid protein (NP) on WSMoV S RNA (5'-ATGTCTAACGTTAAGCAGCT-3'; 5'-TTACACTTCTAAGGAGGTGCT-3'; 828 bp) and the RNA-dependent RNA polymerase (RdRP) on WSMoV L RNA (5'-CTATATGTGCAGGGGGCTGG-3'; 5'- ACCCCTCAATTATGCTCGGC -3'; 948 bp) to verify the presence of WSMoV in peanut plants by RT-PCR. The expected PCR products were successfully amplified from each of the symptomatic tested plants, while not in negative controls (Fig. S1, B and C). Furthermore, the extracted total RNA was subjected to small RNA sequencing, and the results showed the detected small RNAs present a major peak at 21 nt and 22 nt (Fig. S1D). This further confirmed the natural infection of WSMoV in stunted peanut plants. RDRP, an important conserved protein in RNA viruses, which is in the L RNA segment of WSMoV, was selected to construct the phylogenetic tree. The results showed that the WSMoV isolate from Yunnan (OR123869) clustered separately from previously reported isolates (Fig. S2). Numerous economically important crops infected with WSMoV in China have experienced severe economic losses (Rao et al. 2011; Tang et al. 2015). Our data has provided the first confirmation of WSMoV naturally infecting peanuts in China, increasing our knowledge of the virus's host range. Further research is needed to determine this virus's specific vectors, the scope of its spread, and its impact on China's peanut production.

First Report of Leaf Spot Caused by Paramyrothecium foliicola on Peanut in China.

Peanut (Arachis hypogaea) is an important economic and oil crop in China. In September 2022, leaf spots wereobserved on peanut in Luoyang city, Henan province, China (34°49'N, 112°37'E). The disease occurred on about 30% ofthe peanutleaves in only one 0.5-acre field. Symptoms appeared primarily as brown spots, that varied in shape, and appeared round, oval or irregular. In addition, some disease patches exhibited a concentric ring pattern. Small pieces (5×5 mm) of five diseased leaves were surface disinfected in 3% NaClO for 2 minutes, rinsed three times in sterile distilled water, dried on sterilized filter paper, and cultured on potato dextrose agar (PDA) at 25°C for 3 days. Five isolates with uniform characteristics were obtained and subcultured by transferring hyphal tips to fresh PDA. The colonies of the isolates were circular and the margins were clean. The colonies showed white coloration, and after 5-7 days of incubation on PDA plates, concentric rings with dark green sporodochia appeared on the surface of the colonies. The conidiophores branched repeatedly. The conidiophore stipes unbranched, hyaline, 10.0 to 23.2×1.5 to 3.3 μm (n=50). The conidia were rod-shaped or long oval and single-celled, measuring 4.6 to 8.6×1.4 to 3.1 μm (n=100). Based on these characteristics, the five isolates were identified as Paramyrothecium foliicola (Lombard et al 2016). Genomic DNA was extracted from the representative isolates LH-1-1 and LH-1-2. The internal transcribed spacer (ITS), RNA polymerase II second largest subunit (RPB2), calmodulin (CmdA), and translation elongation factor 1-alpha (tef1) loci were amplified and sequenced using the following primer pairs: ITS1/ITS4 (White et al. 1990), RPB2-5F2/RPB2-7cR (O'Donnell et al. 2007), CAL-228F/CAL-2Rd (Carbone & Kohn 1999), and EF1-728F/EF2 (O'Donnell et al. 1998), respectively. BLASTn analysis revealed that the sequences of ITS (OR352397.1 and OR417392.1), RPB2 (OR413573.1 and OR420678.1), CmdA (OR413572.1 and OR420677.1), and tef1 (OR413574.1 and OR420679.1) had 99 to 100% (553/558 bp, 721/721 bp, 597/598 bp, and 384/389 bp) similarity to P. foliicola (MN593634.1, MN398038.1, OM801785.1, MK335967.1). A phylogenetic tree based on the Maximum Likelihood method also confirmed that the two isolates converge on the same branch as P. foliicola. Pathogenicity tests were performed using leaves of 60-day-old peanut plants (cv. Zhonghua 8). Briefly, uninfected healthy leaves (non-wounded) were inoculated with 30-µl drops containing a spore suspension (5×105 conidia/ml) of LH-1-2, and peanut leaves inoculated with sterile distilled water served as controls. All treatments were incubated in an incubator at 25℃ and high relative humidity with a 12:12 hour light-dark cycle. After 5-7 days, inoculated leaves showed symptoms similar to those observed in the field, while no symptoms were observed on control leaves. The pathogenicity tests were repeated three times. The fungus was reisolated from the infected leaves and identified as P. foliicola based on morphological and molecular characteristics, thus fulfilling Koch's postulates. P. foliicola has previously been reported to cause leaf spot of tomato and mung bean, stem canker of cucumber (Huo et al. 2022; Sun et al.2020; Huo et al. 2021). To our knowledge, this is the first report of P. foliicola causing leaf spot on peanut in the world. Identification of this pathogen will be helpful in monitoring peanut diseases and developing disease control strategies.

Diverse Bradyrhizobium spp. with Similar Symbiosis Genes Nodulate Peanut in Different Regions of China: Characterization of Symbiovar sv. Arachis.

A total of 219 rhizobial strains isolated from peanut grown in soils from six peanut croplands in Zhengyang county, Henan Province, were typed by PCR-RFLP of IGS sequences. Their phylogenetic relationships were refined on representative strains using sequence analyses of 16S rRNA genes, housekeeping genes (atpD, recA, glnII) and symbiosis genes (nodA, nodC and nifH). The 219 rhizobial isolates were classified into 13 IGS types, and twenty representatives were defined within eight Bradyrhizobium genospecies: B. guangdongense covering 5 IGS types (75.2% of total isolates), B. guangzhouense (2 IGS types, 2.7% total isolates), B. zhengyangense (1 IGS type, 11.3% total isolates) and five novel genospecies (5 IGS types, 0.9 to 3.2% total isolates). All representative strains had identical nodA, nodC and nifH sequences except for one nifH sequence. With this one exception, these sequences were identical to those of the type strains of Bradyrhizobium species and several Bradyrhizobium genospecies isolated from peanut in different regions of China. The nodC sequences of all strains showed < 67% similarity to the closest strains on the Genbank database indicating that they are representative of a novel Bradyrhiobium symbiovar. This study has shown that (1) diverse Bradyrhizobium spp. with similar symbiosis genes nodulate peanut in different regions of China. (2) Horizontal transfer of genes involved in nodulating peanut is common between Bradyrhizobium species in soils used to grow the crop in China. (3) The strains studied here are representative of a novel Bradyrhizobium symbiovar that nodulates peanut in China. We propose the name sv. arachis for this novel symbiovar indicating that the strains were isolated from Arachis hypogaea. Results here have practical implications in relation to the selection of rhizobial inoculants for peanut in China.

First Report of Nigrospora aurantiaca Causing Leaf Blight Disease of Peanut in China.

In June 2021, a previously unreported leaf blight disease of peanut (Arachis hypogaea) was observed on field-grown peanut (Jinhua19) in Laixi city, Shandong province of China. Approximately 5% of plants showed disease symptoms in the fields we investigated. The symptoms first appeared as yellow round or irregular spots on leaves, and then the spots became brown. As the disease progressed, spots became larger and even converge, which later produced leaf chlorosis and abscission. Symptomatic leaves were cut into small pieces, surface disinfested with 70% ethanol for 30s, 1% NaClO for 60s, rinsed three times in sterile water, dried on sterile filter papers, placed on potato dextrose agar (PDA) media, and incubated at 25°C in darkness. Fungal cultures were initially white, with red pigment, then turned gray, and eventually turned black, and aerial hyphae were dense. Conidia were spherical or slightly ellipsoidal, black, smooth, and 8.6 to 11.5 × 8.7 to 14.5μm (n=50). Morphological characteristics of the isolates matched the description of Nigrospora aurantiaca (Wang et al. 2017). Molecular identification was performed by sequencing beta tubulin gene (TUB) with Bt2a/Bt2b and translation elongation factor 1-alpha (TEF) with EF1-728F/EF1-986R (Wang et al. 2021) of a representative isolate ZHX11. TUB (OK489789) and TEF (OK489790) of ZHX11 obtained 100% (401/401 nucleotides) and 99.64% (279/279 nucleotides) similar to those of N. aurantiaca (MN329935, MN264010), respectively. Alignment was conducted separately for each gene set using Clustal W algorithm implemented in MEGA 7.0 (Kumar et al. 2016), and multi-gene (TUB and TEF) phylogenetic analyses using Neighbor-Joining (NJ) method showed that the isolate was N. aurantiaca. To complete Koch's postulates, nine 2-week-old peanut (Zhonghua 12) seedlings were sprayed with conidia suspensions (106 conidia mL-1 in 0.05% Tween 20 buffer). The same number of seedlings were only treated with 0.05% Tween buffer as controls. The experiment was repeated three times. Plants were incubated in a growth chamber (30°C in the day and 25°C at night, a 12-h photoperiod and 80% RH). Ten days after inoculation, typical symptoms were observed on inoculated leaves but not on the controls. N. aurantiaca was reisolated from the diseased leaves but not from the controls. N. sphaerica was observed on peanut in China (Liu et al. 2020). To our knowledge, this is the first report of N. aurantiaca causing leaf blight on peanut in shandong province, China. These findings will help to develop better preventive measures in accordance with the emergence of the new disease.

Occurrence of root rot caused by Fusarium fujikuroi and Fusarium proliferatum on peanut in China.

Root rot of peanut, caused by Fusarium spp., is a devastating disease in most peanut cultivation regions. In this reported outbreak, Fusarium root rot of peanut has been observed in Henan province, China in July 2021. About 20% of peanuts in a field (0.66 ha) were affected. Early symptoms comprised the wilt of the lower leaves, and the darkening of the vascular tissue of roots, which turned brown. Progressively, the whole plant wilted, the roots rotted, and the plant ultimately died. Pathogenic species were isolated from plants showing symptoms of root rot in the field. A total of 206 Fusarium isolates were generated, and 16 isolates were preliminarily identified as Fusarium fujikuroi based on morphological characteristics. Isolates were obtained and grown on PDA plates. Isolates developed floccose white aerial mycelia with reddish-pink coloration in the medium in 2 weeks on the benchtop. Macroconidia were 3-5 septate, measuring 27.5 to 48.8 × 2.6 to 3.8 μm (avg. 36.7 × 3.6 μm, n=50). Microconidia were abundant in chains, mainly asepatate, oval to kidney-shaped, 4.0 to 11.6 × 2.5 to 4.1 μm (avg. 5.8 ×3.1 μm, n=50). DNA was extracted from mycelium and the following genes were amplified and sequenced: the internal transcribed spacer (ITS) region using ITS1/ITS4 primers (White et al.1990) (Genbank assessions MZ831304 to MZ831308), the partial calmodulin gene (CAM, primer CL1/CL2A, O'Donnell.)(Genbank assession MZ856333 to MZ856337) and the partial translation elongation factor (EF-1α) using primer EF1/EF2 (Geiser et al.)(Genbank assession MZ856338 to MZ8564342). FUSARIUM-ID analysis showed 98.18% to 100% similarity with sequences of the F. fujikuroi species complex. The phylogenetic analysis was conducted using a neighbor-joining algorithm based on the ITS, CAM, and EF-1α gene sequences. The isolates were clustered with F. fujikuroi clade (Supplementary Fig.1). Koch's postulates were conducted using a sand-cornmeal-inoculum-layer method (Bilgi et al.). Briefly, 400 ml plastic boxes were filled with 15g of sterilized premium-grade coarse vermiculite, followed by a 15 g of inoculum prepared as sand-cornmeal mixture inoculum. The inoculum for each F. fujikuroi isolates was prepared by infesting a pre-sterilized sand-cornmeal mixture with three 5 mm plugs of cultures. Three F. fujikuroi isolates and PDA plugs were inoculated to serve as positive control and non-inoculated control treatments, respectively. The completed colonization of the sand-cornmeal mixture was finished by incubating at 25 ℃ for 7-10 days. Eight pre-germinated seeds of cv. Luhua No.1 was then covered with another 8 g of vermiculite. Peanuts were grown at 25 °C with 85% relative humidity under a light/dark cycle of 14h/10h. After 14 days of incubation, the inoculated plants showed typical symptoms of root rot similar to those in the field: pre-emergence damping-off, reddish-brown lesions on the tap, and lateral roots. F. fujikuroi was successfully re-isolated from inoculated plants but not from the controls and identified as described above. F. fujikuroi was reported to cause bakanae disease of rice (Amatulli et. al.), and root rot of soybeans (Zhao et. al.). To the best of our knowledge, this is the first record of F. fujikuroi causing root rot of peanut in China.

First Report of Fusarium ipomoeae causing Fusarium wilt on Glycine max in South Korea.

Soybean (Glycine max L.) is one of the most important crops worldwide. In South Korea, three species of Fusarium have been reported as causal pathogens of Fusarium wilt of soybean (KSPP, 2021). From 2017 to 2018, wilted soybeans were observed in two soybean fields in Daegu (36.62°126.91°) and Yesan (35.89°128.44°), South Korea. The incidence rate was about 2 to 5% of the total 0.1ha, respectively. The diseased soybeans were yellowed from the lower leaves or dried up, and the inside of the root and stem were turned brown. Fragments (each 5 mm × 5 mm) of the symptomatic vascular tissue were surface-sterilized with 1% NaOCl for 1 min, and then rinsed twice in sterilized distilled water. The seven pieces each from two diseased plants were placed on water agar and incubated at 25°C for 5 days. Two single spore isolates were cultured on carnation leaf agar at 25°C for 14 days under near ultra violet/dark conditions for 12 hours. Macroconidia of two isolates were mostly 3- to 5-septate, dorsiventral curvature, hyaline, apical cell hooked to tapering, basal cell foot-shaped, and measured 51.3 - 62.2 × 3.7 - 4.7 μm (DG43821) and 63.8-74.8×3.1-4.4 μm (YS37232). Microconidia were not observed. Chlamydospores were produced in chains or pairs, subglobose and thick walled. The color of the aerial mycelium was pinkish white and the reverse of the colony was brownish orange on potato dextrose agar. Based on morphological and cultural characteristics, the two isolates were identified as belonging to Fusarium incarnatum-equiseti species complex (Leslie and Summerell 2006). To confirm the accurate species identification of the two isolates, DNA sequencing of the internal transcribed spacers and intervening 5.8S (ITS), partial translation elongation factor 1-alpha (TEF) and RNA polymerase II largest subunit (RPB2) genes was carried out using primer sets of ITS1/ITS4, EF1 / EF2 and 7cf / 11ar, respectively (O'Donnell et al. 2010). The nucleotide sequences obtained of two isolates were deposited in GenBank with accession numbers of MW375694, MW375695, MW382963, MW382964, MZ364324 and MZ364325. Identities of the ITS region, TEF and RPB2 gene sequences of the two isolates were 490/492, 482/483, 632/633, 631/632, 870/870 and 931/931 with those of ex-type strain F. ipomoeae LC12165 (MK280832, MK289599 and MK289752) in GenBank, respectively. Thus, based on molecular characteristics, the two isolates were confirmed as F. ipomoeae. A pathogenicity test of the two isolates was conducted using root-dip inoculation on seedlings of one soybean cultivars, Pyeongwon. A spore suspension was prepared by flooding 10-day-old cultures on PDA with sterilized distilled water. Fifteen soybean seedlings at the VC stage per each isolate were inoculated by dipping the roots in the spore suspension (1 × 106 conidia/mL) for 2 hours. Inoculated plants were transplanted into pots containing sterilized soil and maintained in the greenhouse at 28±3°C with 14 h/10 h light/dark. An equal number of plants inoculated with sterilized distilled water served as controls. Five days after inoculation, withered symptoms were observed on two or four of the inoculated seedlings, and by 10 days after inoculation, all inoculated plants had withered and died. No symptoms were observed in the non-inoculated control soybeans. The pathogen was consistently re-isolated from only inoculated plants, thus fulfilling Koch's postulates. To our knowledge, this is the first report of F. ipomoeae causing Fusarium wilt on soybean in South Korea, as well as worldwide. This pathogen has been reported on peanut in China as a causal agent of leaf spot (Xu et al., 2021). Understanding the host range of this pathogen and the distribution of F. ipomoeae affecting legume crops in South Korea is important, to ensure an effective management of Fusarium wilt on soybeans.

First report of Cladosporium tenuissimum causing leaf spot of Arachis hypogaea in China.

Peanut (Arachis hypogaea L.), one of the most important oilseed crops in tropical and subtropical regions of the world (Kumar and Kirti 2011), is widely cultivated for its high protein and oil content in seeds. In August 2019, about 30% of A. hypogaea plants were found infected by leaf spot in the peanut-growing regions of Shandong Province, China. Disease symptoms appeared as the irregular and brown necrotic lesions on leaves that were 0.5 to 5.0 mm in diam. Twenty symptomatic plants were randomly sampled from peanut planting areas in Weihai and Yantai City. Small pieces (3 mm2) were cut from lesions, dipped in a 0.5% NaClO for 10 min, rinsed three times with sterilized distilled water, dried, placed onto potato-dextrose agar (PDA), and incubated in the dark at 25°C for 10 days. Three typical Cladosporium-like strains were isolated from diseased leaves of peanut. The colonies were grey to olivaceous green, reverse olivaceous black and woolly. The conidiophores were solitary, macronematous, unbranched or branched, straight or flexuous, cylindrical, slightly swollen at the apex, smooth. Conidiogenous cells were integrated, terminal and intercalary, with numerous loci on nodulose swelling. Ramoconidia were cylindrical, oblong, fusiform, 8.0 to 19.5×2.0 to 4.5 µm, aseptate or 1 septum, pale brown. Conidia were catenate, in densely branched chains, ellipsoid, ovoid, limoniform, aseptate, 4.0 to 11.5×2.5 to 5.5 µm, smooth, with conspicuous hila. The conidia easily break off from the chains. The morphological characteristics of these isolates matched the descriptions of Cladosporium tenuissimum (Bensch et al. 2010). For the molecular identification, the partial actin (act) and translation elongation factor 1-alpha (tef1) genes were amplified and sequenced using the respective primers ACT-512F/ACT-783R and EF1-728F/EF1-986R (Carbone and Kohn 1999). The representative sequences, deposited in GenBank (act: OL332701, OL332702 and OL332703; tef1: OL322090, OL322091 and OL322092), exhibited 99.6% and 100% identical to C. tenuissimum ex-type isolate CBS 125995 (HM148687 and HM148442). Phylogenetic analysis was done by Neighbor-Joining (NJ) analysis based on act+tef1 sequences. These three isolates were identified as C. tenuissimum by morphological and molecular characteristics. Pathogenicity of each C. tenuissimum isolate was tested on peanut in the greenhouse at 28°C with 75% relative humidity. Twenty plants of A. hypogaea were inoculated with the conidial suspension (1.0 × 105 conidia/ml) on the leaf surface. Ten plants were mock inoculated with sterile water as controls. Within 2 weeks, inoculated plants exhibited dark necrotic lesions on leaves which were similar to the symptoms observed in the field, while the mock inoculated plants remained symptomless. The fungal pathogen which was reisolated from inoculated rather than mock inoculated leaf tissues was identical to the original pathogen on the basis of morphological and molecular analysis, confirming Koch's postulates. To our knowledge, this is the first report of leaf spot caused by C. tenuissimum on peanut in China. The C. tenuissimum infection poses a serious threat by reducing the yield and quality of peanut in Shandong Province. This research is especially valuable to enhance epidemiological studies and implement effective control strategies.

First Report of Lasiodiplodia pseudotheobromae Causing Collar Rot of Peanut in Shandong Province, China.

In August 2019, a collar rot of peanut was observed in several fields in Qingdao, Shandong province, China. Disease survey was conducted in several peanut fields. Less than 5% plants exhibited various symptoms, including brown or black stem rot, pod rot, leaf chlorotic, wilted, and even dead. Symptomatic stems were cut into small pieces, surface disinfested with 70% ethanol for 1 min, 1% NaClO for 2 minutes, rinsed three times with sterile water, and dried on sterile filter papers. Pieces then were plated on potato dextrose agar (PDA) media and incubated at 25°C in darkness. Fungal cultures were initially white, then turned gray, and eventually turned black, and aerial hyphae were dense, fluffy. Conidia were ellipsoidal, initially hyaline, unicellular, 14.3 to 21.1 × 8.7 to 13.2 µm (n = 50), and mature conidia showed dark brown, with a central septum, and longitudinal stripes. Molecular identification was performed by sequencing ITS with ITS1/ITS4 (White et al., 1990) and beta tubulin gene with Bt2a/Bt2b (Glass and Donaldson, 1995) of a representative isolate ZHX9. ITS and beta tubulin regions (OK427342 and OK489788) of ZHX9 obtained 99.62 and 100% similar to L. pseudotheobromae (KF766193 and EU673111), respectively. Phylogenetic analysis was done using Neighbor-Joining (NJ) analysis based on those gene sequences. The microorganism we have isolated was identified as L. pseudotheobromae based on molecular analysis and morphological characteristics. For pathogenicity assay, twelve ten-days-old peanut (Zhonghua No.12) seedlings were each inoculated with one mycelial plug (8 mm in diameter) by placing the inoculum on the base of the stem. Twelve plants were each inoculated with a plug of non-colonized PDA as controls. Plants were incubated in a growth chamber (30°C in the day and 25°C at night, a 12-h photoperiod and 80% RH). Necrotic lesions were observed on stems of all inoculated seedlings 5 days after inoculation, whereas control plants remained asymptomatic, and L. peudotheobromae was consistently re-isolated from symptomatic stem. In Asia, peanut collar rot caused by L. teudotheobromae has been reported in India, Indonesia, North Vietnam (Nguyen, et al., 2006) and China (Guo, et al., 2014), but collar rot caused by L. pseudotheobromae has not been reported. To our knowledge, this is the first report of L. peudotheobromae causing collar rot on peanut in China. These results will provide crucial information for studying on epidemiology and management of this disease.

First Report of Turnip Mosaic Virus in Peanut (Arachis hypogaea) in China.

Peanut (Arachis hypogaea L.) is an important source of edible oil in China but its yield and quality in agricultural production are affected by a number of diseases including those caused by viruses. The four viruses most commonly reported to affect the production of peanut worldwide are peanut stripe virus, cucumber mosaic virus, peanut stunt virus and peanut bud necrosis virus (Srinivasan et al. 2017; Xu et al. 2017). During a disease survey in June 2020, virus-like disease symptoms including mosaic and necrotic spots were observed in field peanut plants in Yuyao county, Zhejiang, China (Supplementary Fig S1). These symptoms differed from those caused by the four major peanut viruses (Dunoyer et al. 2020; Srinivasan et al. 2017; Takahashi et al. 2018; Xu et al. 2017). To identify the putative viral agent(s) associated with the virus-like disease in these plants, leaves from six plants in the same field were collected, pooled and subjected to high throughput RNA-Seq sequencing (HTS). The TruSeq RNA Sample Preparation Kit (Illumina, California, USA) was used to construct cDNA library according to the manufacturer's instructions. An Illumina NovaSeq 6000 platform (Illumina) with PE150 bp and CLC Genomic Workbench 11 (QIAGEN) was used for sequencing and data analysis. After data collection and analysis, a total of 18,592 contigs were generated from de novo assembly of the clean paired-end reads (35,935,936). After comparing with sequences deposited in GenBank using BLASTn, four assembled contigs (ranging from 4,969 to 8,937 nt in length) were found to share 94.9%-95.9% identity to the turnip mosaic virus (TuMV, genus Potyvirus). No other virus sequences were detected in the data. To confirm the presence of TuMV and to obtain its full-length sequence, total RNA was extracted from a single plant selected from initial sample pool by using the plant RNA extraction KIT (Aidlab, Beijing, China). Five primer pairs (Supplementary Table 1), which were anticipated to result in overlapping amplicons covering all but the 5'-end of the genome, were designed based on the TuMV contig sequences and the complete nucleotide sequence of TuMV was subsequently amplified by the reverse transcription polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE) using the commercial SUPERSWITCH™ 5'RACE cDNA Kit (Tiosbio, Beijing, China). All the PCR products were subsequently cloned into pEASY®-T5 Zero (TransGen Biotech, Beijing, China), and three clones of each fragment were randomly selected and sequenced by Sanger sequencing at Ykang (Ykang, Hangzhou, China). The complete sequence of the TuMV isolate (designated isolate Ningbo) was deposited in GenBank under accession number MZ062212. BLASTn analysis showed that TuMV-Ningbo shared a sequence identity of 96.0% with a Brassica isolate of TuMV in China (HQ446216) and 95.9% with a Brassica isolate in the Czech Republic (LC537547). Phylogenetic analysis grouped the three into a cluster (Supplementary Fig S2), suggesting Ningbo as a member of the world-B Group (Kawakubo et al. 2021). A western blot analysis of leaf sap using a TuMV CP antibody prepared by our laboratory (unpublished data) confirmed the presence of TuMV in all of the samples used for the HTS analysis. Peanut and Nicotiana benthamiana plants growing in the green house were also mechanically inoculated with peanut leaf sap obtained from one of samples. Seven days after inoculation, mosaic and leaf curing symptoms were observed on inoculated plants and the infection of TuMV was subsequently confirmed by RT-PCR (primers TuMV-CP: 5'- GCAGGTGAAACGCTTGATGC -3' and 5'- CAACCCCTGAACGCCCAGTA-3') and western blot assay. In contrast, no symptoms nor TuMV were detected in the mock-inoculated plants. TuMV is an important pathogen of brassica crops and is known to have a worldwide host range. However, to our knowledge, this is the first report of TuMV infection in peanut in China and the finding suggests that the threat of TuMV should be considered when interplanting peanuts and cruciferous vegetables, as in common in this region of China.

The Relationship Between Aspergillus flavus in Peanut Soil and Aflatoxin Contamination of Peanut in China

The Relationship Between Aspergillus flavus in Peanut Soil and Aflatoxin Contamination of Peanut in China

Genome Resource for Peanut Web Blotch Causal Agent Peyronellaea arachidicola Strain YY187.

Peyronellaea arachidicola is the causal agent of peanut (Arachis hypogaea L.) web blotch. Here, we report an assembled draft genome sequence of P. arachidicola strain YY187 obtained from the symptomatic leaf of peanut in China. The genome size is 47.3 Mb, consisting of 26 contigs (N50 = 2.2 Mb) with G+C content of 56.37%. This genome will provide a valuable foundation for further research on genetics and comparative genomics of P. arachidicola.

Phenotypic identification of peanut germplasm for resistance to southern stem rot

Southern stem rot, caused by Sclerotium rolfsii Sacc., is a destructive soil fungal disease of peanut in China and other countries. To evaluate resistant germplasm, a total of 256 peanut accessions were investigated on their resistance to southern stem rot in 3 environments by artificial inoculation. Variance analysis indicated that disease index was significantly influenced by environment, genotype and genotype ​× ​environment interactions. Peanut accessions of var. vulgaris type exhibited higher resistance to southern stem rot. Disease index was significantly negatively correlated with linoleic acid content, while positively correlated with oleic acid content. Six resistant accessions were identified, including Hua 28, Shandongzai, ICG 6326, Quanhua 7, Quanhua 9 and Guihua 836, with their disease indexes under 40 and mortality were less than 30% in the three environments. The identified resistant accessions showed the great potential to be applied in resistant peanut breeding, and would be good genetic resources for enhancing the resistance to southern stem rot.

First Report of Bacterial Wilt Disease of Tomato, Pepper and Gboma Caused by the Ralstonia solanacearum Species Complex in Togo.

Tomato (Solanum lycopersicum), pepper (Capsicum annum), and gboma (Solanum macrocarpon) are major vegetables in Togo, with many people depending on these crops for their livelihood. In December 2018, during the dry season with temperatures between 21°C to 35°C, tomato ('Petomech'), pepper ('Gboyebesse') and gboma (local landrace) showing wilt symptoms without foliar yellowing were collected from two locations, Tchouloum and CECO-AGRO sites in the Sotouboua Prefecture of Togo, ~300 km from the capital city of Lome. Disease incidence ranged between 10% to 50% in multiple fields. Cut stems of most wilting tomato, pepper and gboma plants produced bacterial ooze in water and vascular discoloration was visible in longitudinal stem sections. Ground cut stem tissue tested positive with Rs ImmunoStrips specific to the Ralstonia solanacearum species complex (RSSC) (Agdia Inc., Elkhart, IN, USA). Collected samples were stored at ambient temperature and cultured within 36 hr. Culturing sap from cut stems plated on modified SMSA medium (Engelbrecht 1994) yielded colonies with typical RSSC morphology: slow-growing, irregular, mucoid, and white with red centers. Genomic DNA was extracted from thirteen isolates: two from gboma, five from tomato and six from pepper. The expected 280-bp band was amplified from all 13 genomic DNAs following polymerase chain reaction (PCR) using the 759/760 RSSC-specific primer pair (Opina et al. 1997). PCR with the 630/631 primers, which identify the Race 3 biovar 2 RSSC subgroup, did not yield a product from any Togo isolate (Opina et al. 1997). The phylotype multiplex PCR identified all Togo isolates as belonging to the phylotype I subgroup, also called R. pseudosolanacearum (Prior et al. 2016; Fegan and Prior 2005). Phylotype control DNAs were from strains GMI1000 (phylotype I, Asia), K60 (phylotype II, Americas), CMR15 (phylotype III, Africa), and PSI07 (phylotype IV, Indondesia). Comparative genomic analysis of the partial endoglucanase (egl) gene, amplified with the Endo primer pairs (Poussier et al. 2000), revealed all Togo strains belonged to sequevar 17, a group known to cause bacterial wilt of peanut in China. (Xu et al. 2009). The egl sequences are in NCBI GenBank accessions MT572393 to MT572405. Koch's postulates were completed by inoculating 28-day-old bacterial wilt-susceptible 'Bonny Best' tomato plants by soil soak (Khokhani et al. 2018). Briefly, soil around each unwounded plant was drenched with 50 ml of a 108 CFU/mL suspension of bacteria grown from a single colony. Five plants were inoculated with each of four randomly selected Togo strains. RSSC phylotype I strain GMI1000 served as a positive control and water treated plants as negative controls. Plants were kept in a 28°C growth chamber with a 12 hr photoperiod. All RSSC inoculated plants were fully wilted within a week; symptoms resembled to those observed in the field. Water treated control plants did not wilt. Culturing sap from all inoculated plants on SMSA medium yielded colonies with typical RSSC morphology that tested positive with the Rs ImmunoStrips. This is the first identification of RSSC in Togo. These results will guide development of disease management strategies and regionally appropriate breeding of vegetable lines with resistance to the phylotype I RSSC strains present in Togo.

Survey of aflatoxin B1 and heavy metal contamination in peanut and peanut soil in China during 2017–2018

Peanut, as a nutritious, healthy and delicious food, is susceptible to contamination by aflatoxin B1 (AFB1) and heavy metals, which has an adverse impact on the healthy development of peanut industry in China. This research was to evaluate the contamination of AFB1 and heavy metals (cadmium, chromium, lead, tin, copper and zinc) in peanut, to analyze the difference of AFB1 and heavy metal contamination in peanut in the four main peanut producing regions (Northeast area, Yellow River basin, Yangtze River basin and Southeast coast), and to analyze and discuss the difference of heavy metal content in peanut kernel, peanut shell and peanut soil. The results showed that the mean concentration of AFB1 in peanut was 1.08 μg/kg, and the detection rate of AFB1 was 33.80%. There was no significant difference in AFB1 contamination of peanut between 2017 and 2018. The most serious AFB1 contamination region was the Yangtze River basin, followed by the Southeast coast, the Yellow River basin and the Northeast area. The average levels of cadmium (Cd), chromium (Cr), lead (Pb), tin (Sn), copper (Cu) and zinc (Zn) in peanut kernel were 0.18, 0.44, 0.03, 0.01, 9.24 and 31.42 mg/kg, respectively. There was a significant difference in the mean content of heavy metals (Cr, Sn, Cu and Zn) in peanut kernels between 2017 and 2018. The mean content of Cd in peanut kernel was the highest in Northeast area, and there was no significant difference in the mean content of Pb in the four main peanut producing regions. The average concentration of other heavy metals (Cr, Sn, Cu and Zn) in peanut kernel in south of China (Yangtze River basin and Southeast coast) was higher than that in north of China (Northeast area and Yellow River basin). Due to the different bio-accumulation ability of peanut kernel and peanut shell to different heavy metal, the average levels of heavy metals in peanut kernel and peanut shell were different. The ability of peanut kernel to bio-accumulate Cd, Cu and Zn was stronger than that of peanut shell, and the ability of bio-accumulate of Cr, Pb and Sn was weaker than peanut shell. There was a significant positive correlation between heavy metal pollution of peanut and heavy metal content in soil. In conclusion, the situation of AFB1 and heavy metal contamination in peanut in China was not optimistic, and the pollution of peanut in south of China was more serious than that in north of China. Therefore, the control and prevention of AFB1 and heavy metal in peanut should be strengthened.

Quantitative Estimation of the Nutrient Uptake Requirements of Peanut

Understanding the characteristics of the balanced nutrient requirements for peanut to achieve target yields is paramount when formulating fertilizer management strategies to increase yields and avoid fertilizer loss. Nutritional requirement estimation models can provide effective alternatives for the estimation of the optimum crop balanced nutrient requirements under varied agricultural conditions which are less time consuming and expensive. In the present study, the quantitative estimation of the optimum crop balanced nutrient requirements of peanut in China were obtained using quantitative evaluation of fertility of tropical soils (QUEFTS) model. The database covered the main agro-ecological region for peanut crops in China between 1993 and 2018. The predicted results of the QUEFTS model indicated that nutrient uptake requirements increased linearly with increasing pod yields until the yields had reached approximately 60% to 70% of the potential pod yields. It was found that with the increasing pod yields during the nutrient linear absorption stage, the plants had required 38.4 kg N, 4.3 kg P, and 14.0 kg K in total to produce 1000 kg of pods, and the corresponding internal efficiencies were 26.0 kg N/kg, 235.0 kg P/kg, and 71.6 kg K/kg, respectively. In addition, the balance rates of the removal nutrient in the pods were determined to be 29.4 kg N, 2.9 kg P, and 4.9 kg K per 1000 kg of pod yield, or approximately 76.5%, 67.4%, and 34.7% of N, P, and K in the total plants, respectively. This study’s field validation experiments verified the applicability and accuracy of the QUEFTS model. Therefore, it was considered to be an effective alternative for the estimation of the optimal balance N, P, and K uptake requirements for peanut crops. These findings will potentially be helpful when making future decisions regarding fertilizer recommendations for peanut crops in China.

First Report of Aspergillus niger Causing Root Rot of Peanut in China.

Peanut (Arachis hypogaea) is one of the most important oil crops and food legumes worldwide. China sows approximately 3.5 million hectares each year and produces 40% of the world's peanuts. Fungal diseases are among the main biotic stresses affecting peanut production. Root rot is a serious disease caused by several fungi. Pythium spp., Fusarium spp., and Rhizopus spp. are some of the root rot fungi that have been reported in China. In 2012 and 2013, root rot symptoms were observed in several fields in Laixi District, Qingdao City, Shandong Province, China. The first symptoms appeared in July. Initial symptoms of the disease were brown spots on the stem base and root. Affected plants were stunted, with leaf chlorosis, reduced growth, or sudden wilting. As disease progressed, the infected tissues showed brown discoloration and rot, and abundant dark brown and black powdery spores were visible on the surfaces of affected parts. Eventually, affected plants collapsed and died. To isolate the causal organism, roots and stems were cut into sections, which were surface-disinfected with 70% ethanol solution (v/v) for 20 s, soaked in 0.1% mercuric chloride solution for 50 s, rinsed with sterilized water three times, dried, placed on Czapek's Dox agar supplemented with chloramphenicol (100 μg/ml), and incubated at 28°C for 7 days. Fungal colonies were white initially and then covered with a dense layer of dark brown or black conidial heads. The conidial head was radiate; vesicles were nearly spherical and covered with irregular metulae and phialides. Conidia were globose or subglobose (3.0 to 5.5 μm in diameter), dark brown to black, with rough cell walls. Total genomic DNA was extracted from mycelia using the EasyPure Genomic DNA Kit (TransGEN, Beijing, China). The rDNA-ITS region was amplified using PCR with the universal fungal primers ITS1 and ITS4 (2). The purified products were separately sequenced in both directions using the same primer pair. The sequences (GenBank Accession No. KJ848716) obtained were 99% similar to the ITS sequence of isolates of Aspergillus niger. This, together with the morphological characters (1) described above, suggested that the microorganism we had isolated was A. niger. Koch's postulates were completed in the laboratory by inoculating peanut. Thirty Huayu20 peanut seeds were placed in a 500-ml sterile pot with 300 g of autoclaved soil. Twenty days after seedling emergence, 15 peanut plants were wounded with a needle and inoculated with 5 ml of conidia suspension (106 ml-1). The same number of peanuts were similarly wounded and inoculated with 5 ml of sterile distilled water to serve as controls in the same pot. All peanuts were kept in a randomized complete block design at 30°C under a 12-h photoperiod. After 7 days, disease symptoms similar to those observed in the field appeared in all inoculated but not in non-inoculated peanuts. The tests were repeated three times in the greenhouse. Koch's postulates were satisfied after re-isolating the A. niger from inoculated peanuts using the method described above. To our knowledge, this is the first report of A. niger causing root rot in peanut in China.

Comparison of gene expression profiles in cultivated peanut (Arachis hypogaea) under strong artificial selection

With 9 figures and 1 tableAbstractOver the past five decades, cultivated peanut in China has been subjected to strong artificial selection in breeding programmes. To investigate the impact of artificial selection on expression diversity, we compared gene expression profiles in pod and leaf of five widespread cultivars in Southern China. In terms of tissues, hierarchical clustering analysis revealed that expression data of pod and leaf generated different dendrograms owing to artificial selection. K‐means analysis also showed that there were 16 gene expression patterns in leaf, while only eight in pod. In considering cultivars, a cultivar specificity index (τ) was employed to characterize expression patterns, which suggested that genes having 0.15 &lt; τ &lt; 0.85 constituted &gt;80% of all expression patterns. Additionally, the diversity of gene expression in pod among cultivars of the ‘YY7’ pedigree decreased from 23.8% to 3.9%. Taken together, nucleotide polymorphisms in regulatory elements owing to artificial selection led to low‐expression polymorphisms in both tissues and cultivars, contributed to the narrow genetic diversity and might be a driving force behind the breeding of cultivated peanut.

Cylindrocladium black rot caused by Cylindrocladium parasiticum newly reported on peanut in China

Cylindrocladium black rot caused by <i>Cylindrocladium parasiticum</i> newly reported on peanut in China

First Report of Capsicum chlorosis virus in Tomato in India

CaCV is as an economically important virus infecting tomato and pepper in Australia and Thailand and recently peanut in China. To our knowledge, this is the first report of CaCV in tomato in India. Both PBNV and CaCV can produce similar symptoms in tomato warranting further studies on crop improvement strategies against these two tospoviruses in vegetable and legume crops in India. This report highlights the need for continuous monitoring on the prevalence of CaCV in India and other countries in the Asia-Pacific region. Accepted for publication 10 October 2007. Published 4 December 2007.