Papillary Serous Adenocarcinoma Research Articles

Value analysis of preoperative peripheral blood LMR in predicting prognosis of serous papillary ovarian adenocarcinoma

ObjectiveTo analyze the predictive effect of preoperative peripheral blood leukocyte related inflammatory indicators on the prognosis of patients with serous papillary ovarian adenocarcinoma.MethodsA retrospective analysis was conducted on the case data of 83 patients with ovarian cancer undergoing tumor cell reduction surgery admitted to our hospital from January 2017 to December 2020. Pathological findings confirmed serous papillary ovarian adenocarcinoma. Kaplan–Meier method was used to analyze the relationship between lymphocyte to monocyte ratio (LMR) and the patients survival prognosis. Analyzing factors affecting patient prognosis which using a multivariable Cox risk.ResultsThe overall survival (OS) of the patients with serous papillary ovarian adenocarcinoma in high LMR group was higher than that in the low LMR group preoperative. The disease free survival (DFS) of ovarian adenocarcinoma patients in the high LMR group was higher than that in the low LMR group preoperative. That was the low LMR indicating a poor prognosis. Single factor analysis showed that age of onset was correlated with OS and DFS, and the body mass index (BMI) was only correlated with OS. Multivariable analysis showed that the age of onset (HR = 2.571, 95% CI 1.199–5.512, P = 0.015) and BMI (HR = 0.337, 95% CI 0.158–0.718, P = 0.005) were independent risk factors for OS.ConclusionsAlthough the serous papillary ovarian adenocarcinoma patients with preoperative peripheral blood LMR reduction have poor prognosis, the correlation between LMR values and prognosis is not significant. Therefore, it is not recommended to use preoperative peripheral leukocyte related inflammatory indicators as prognostic markers for serous papillary ovarian adenocarcinoma.

Tc-99m-MDP Uptake in Extraosseous Metastases from Ovarian Papillary Serous Adenocarcinoma.

The uptake of Tc-99m-uptake of Tc-99m-methylene diphosphonate (MDP) on bone scintigraphy can be seen at sites other than bone in a varying number of benign and malignant conditions. Extraosseous metastatic calcifications can occur in ovarian papillary serous adenocarcinoma (PSAC). These extraosseous calcifications show Tc-99m-MDP uptake. We report a case of a female in her sixties who had a previous history of PSAC of the ovary. The patient had undergone neoadjuvant chemotherapy (NACT) followed by total abdominal hysterectomy and bilateral salpingo-oophorectomy. She also received adjuvant chemotherapy. Tc-99m-MDP bone scan was performed post chemotherapy because the patient complained of lower backache. The scan showed increased uptake in the lower thoracic and lumbar vertebral regions. However, single-photon emission computed tomography/computed tomography (CT) localizes the uptake to metastatic calcified peritoneal deposits. Further 18F-fluorodeoxyglucose positron emission tomography/CT confirmed widespread peritoneal and omental metastatic disease with increased uptake.

A Phase II Trial of Bevacizumab in Patients with Recurrent/Progressive Solid Tumor Brain Metastases That Have Progressed Following Whole-Brain Radiation Therapy.

Patients with solid tumor brain metastases that progress after whole-brain radiation have limited options. This prospective trial investigated the efficacy, safety, and tolerability of bevacizumab as salvage therapy in this population. Eligible patients received bevacizumab 10 mg/kg intravenously every 2 weeks until progression. The primary endpoint was radiologic response using Response Assessment in Neuro-Oncology (RANO) criteria. The secondary endpoints were progression-free survival (PFS), overall survival (OS), duration of response, and safety. Quality of life (QOL) was studied using the Functional Assessment of Cancer Therapy-Brain (FACT-Br) scale. Twenty-seven patients were enrolled, with twenty-four having evaluable data for response. The majority of histologies (n = 21, 78%) were breast cancer. The remaining histologies were non-small-cell lung cancer (n = 4, 15%), neuroendocrine cancer (n = 1, 3%), and papillary fallopian serous adenocarcinoma (n = 1, 3%). Eighteen patients had radiologic response, with two patients demonstrating partial response (8.33%) and sixteen patients demonstrating stable disease (66.7%). The median duration of response was 203 days. PFS at 6 months was 46%, median PFS was 5.3 m, and median OS was 9.5 m. Treatment was well tolerated, with six patients experiencing grade 3 lymphopenia and hypertension. There was one grade 3 thromboembolism. QOL was not negatively impacted. Bevacizumab is a safe and feasible salvage treatment with durable response and favorable overall survival for patients with progressive brain metastases after whole-brain radiation.

Erythroderma-as a paraneoplastic phenomenon of ovarian adenocarcinoma

About 1% of erythroderma cases have a neoplastic or paraneoplastic etiology. But erythroderma secondary to adenocarcinoma of ovary has not yet been reported in the scientific literature to best of our knowledge. A 54-year-old female patient presented to OPD with complaints of reddish itchy scaly lesions over body since 2 months. Based on history and examination, contact dermatitis was considered as provisional diagnosis. Patient was started on prednisolone, cyclosporine and topical corticosteroids which led to partial improvement of the skin lesions. But the lesions recurred and involved almost entire body surface area after 15 days of stopping the medications by the patient. This instigated further evaluation of the patient. All routine lab investigations were within normal limits. Skin biopsy showed mixed inflammatory infiltrate. USG abdo-pelvis detected right ovarian mass. Serum CA 125 was found to be raised. This leads to the suspicion of internal malignancy. Staging laparotomy was done. Tissue biopsy revealed high grade serous papillary cyst adenocarcinoma of right ovary. Thus, final diagnosis of paraneoplastic erythroderma secondary to ovarian adenocarcinoma was made. Patient responded well to corticosteroids after total abdominal hysterosalphingo-oophorectomy and chemotherapy in due course of time of 4 months. Hence, we conclude, erythroderma patients with unclear etiologies should be thoroughly evaluated. This will lead to timely diagnosis and treatment leading to better prognosis.

586P BRCA1, BRCA2 and RAD51C somatic RNAseq study in ovarian cancer: A description of physiological and pathogenic splicing patterns

Genomic molecular profiling is becoming a key step in the management of advanced ovarian cancer. Currently, the main indication for tumor analysis is on DNA (BRCA1/2 mutations and HRD status); there is no indication for RNA tumor analysis. The aims of this work were to describe physiological splicing profiles of BRCA1, BRCA2 and RAD51C in ovarian tissue and then search for pathogenic splicing of these genes in patients with high-grade serous papillary adenocarcinomas stage III of FIGO classification with good response to neoadjuvant cisplatin. RNAseq (Agilent SureSelect XT HS/capture-based target enrichment and NextSeq 550 Illumina Sequencer) was performed on RNA extracted from ovarian cell lines OVCAR4 and COV318 and five pre-cisplatin frozen ovarian tumors with wild-type BRCA1 and BRCA2 somatic DNA screening. We obtained the Genomic Instability Score with Myriad approach and performed RNAseq on post-cisplatin FFPE ovarian block. We also checked BRCA1 methylation status by digital PCR before their inclusion to describe physiological splicing patterns, in addition to OVCAR4 and COV318. A pathogenic skip of BRCA1 exon 3 was found in one tumor at a high level, comparing to the normal transcript. The loss of exon 3 caused a truncation of BRCA1 protein at codon 27; no variant was identified on DNA. This splicing event explained the high GIS at 66 and the good clinical response to cisplatin. Exon 3 skipping was tumoral as it was absent on the post-cisplatin residual ovarian block. Another tumor was BRCA1 methylated. There were neither enrichment of alternative nor novel splicing event of BRCA1, BRCA2 and RAD51C, specific of ovarian tissue. Physiological splicing profiles were qualitatively and quantitatively close to those reported in lymphoblastoid cell lines. Unlike BRCA2 and RAD51C, five known reported transcripts of BRCA1 were missing in the ovarian tissue. We provided a complete description of physiological splicing profiles of BRCA1, BRCA2 and RAD51C in the ovarian tissue. We also showed that somatic RNAseq analysis in ovarian cancer may modify the therapeutic prognosis by allowing access to targeted therapies.

EGFR and HER2/NEU immunoexpression in ovarian neoplasms in Bundelkhand Region

Introduction: Ovarian Cancers account for the greatest number of deaths from malignancies of female genital tract and it is the fifth leading cause of cancer fatalities in women. Surface epithelial tumours are the most common, followed by germ cell tumours. Objective: To analyse the expression of EGFR and HER 2neu using Immunohistochemisty in different Ovarian tumours with special reference to surface Epithelial tumours. Material and Methods: 52 cases of different ovarian tumours were studied. Cases included total abdominal hysterectomy with bilateral saphingoophorectomy, oophorectomy, and cystectomy specimens. Expression of EGFR (ErbB1) and HER2-neu (ErbB2) was determined by immunohistochemical reactions performed with the Super SensitiveTM IHC Detection system by the BiogenixTM. Tests were performed according to the instructions of each kit. Results: The mean age of presentation for epithelial tumours was found to be 42.48 years. For malignant epithelial tumours mean age of presentation was found to be 51.1 years. EGFR positivity was found in 28.57 % of surface epithelial ovarians tumours, and HER2/neu positivity was seen in 20% of surface epithelial ovarian tumours. As far as malignant serous papillary adenocarcinoma is concerned, we found 33.3% positivity for HER2/neu and 50% positivity for EGFR.

Survival outcomes and prognostic factors of papillary serous adenocarcinoma and papillary squamous cell carcinoma of the uterine cervix

The aim of this retrospective population-based study was to investigate the survival outcomes and prognostic factors of patients with the two cervical carcinomas. A cohort of patients diagnosed with papillary serous adenocarcinoma of the uterine cervix (PSAC) and papillary squamous cell carcinoma (PSCC) between 1973 and 2015 were drawn from the National Cancer Institute's Surveillance Epidemiology and End Results (SEER) database. Overall survival (OS) and cancer-specific survival (CSS) were estimated using the Kaplan–Meier method, and prognostic factors were assessed using Cox proportional hazards survival regression analysis. The 5-year and 10-year OS rates were 38.4 and 33.1% for PSAC and 64.6 and 50.8% for PSCC, respectively. The 2-year and 5-year CSS rates were 60.6 and 45.9% for PSAC and 79.6 and 69.0% for PSCC, respectively. Patients with PSCC survive longer than PSAC patients and have other well-described prognostic factors for improved survival rates, including an early cancer stage, a younger patient age and standardised surgery. Impact statement What is already known on this subject? Papillary serous adenocarcinoma of the uterine cervix (PSAC) and papillary squamous cell carcinoma (PSCC)are both very rare subtypes of cervical carcinomas. What do the results of this study add? This retrospective population-based analysis has evaluated the survival outcomes and prognostic indicators of patients with PSAC and PSCC. What the implications are of these findings for clinical practice and/or further research? Knowing the survival outcomes and prognostic indicators of PSAC and PSCC patients, we can better follow up patients.

Timing of intervention and complications of tunneled peritoneal catheter placement for recurrent malignant ascites in ovarian cancer patients

Objectives: In ovarian cancer patients, recurrent malignant ascites reduces quality of life and is associated with a poor prognosis. There is a lack of guidance in the literature regarding the placement of a tunneled peritoneal catheter in this patient population. We evaluated the outcomes of ovarian cancer patients who underwent tunneled peritoneal catheter placement for recurrent malignant ascites. Methods: We queried the institutional interventional radiology records from 5/2009 to 5/2020 for female patients with ovarian cancer who had a tunneled peritoneal catheter placed for malignant ascites. We evaluated patient characteristics, number of paracentesis procedures recorded prior to placement, complications, and the time between placement and death. Descriptive statistics were performed. Results: 30 patients were identified. The mean age was 68 (range, 42-88). 77% of patients were White and the average BMI was 26. 56.7% of patients had stage IIIC ovarian cancer and the 83.3% had papillary serous adenocarcinoma. Patients had a mean of four lines (range, 0-11) of chemotherapy before undergoing tunneled peritoneal catheter placement. The mean number of paracentesis performed prior to peritoneal catheter placement was two (range, 0-6). There were six minor complications (20%), including two catheter-related infections requiring removal and four instances of catheter dysfunction requiring revision. The median time of catheter placement to death was 44 days (range, 3-151). Conclusions: The complication rate of tunneled peritoneal catheter placement is low, as evidenced by no major complications found in this patient population. The short period from catheter placement until patient death suggests that tunneled peritoneal catheters should be pursued earlier in the disease course if patients have symptomatic, recurrent ascites.

Recurrent liver metastasis in ovarian cancer

The most common sites of metastasis in ovarian cancer is liver, peritoneum, and lymph nodes resulting from hematogenous spread or secondary to liver parenchymal invasion from perihepatic peritoneal metastases. The case was retrieved from routine reporting at our hospital. A 34-year-old female presented with lump in left side of abdomen for six months. Ultrasonography showed Left complex tubo-ovarian mass. Serum level of CA125 was 19.8U/mL. Upfront surgery was done. Histopathology showed malignant lesion, positive for WT1, P53 & CK7 and negative for CK 20. Retroperitoneal lymph nodes and omentum were involved. The cases was diagnosed as epithelial ovarian cancer, high grade papillary serous cyst adenocarcinoma stage III. Three months after surgery repeat contrast enhanced computed tomography showed lung and liver metastasis lymphadenopathy. Patient was given 6 cycles of paclitaxel + carboplatin to achieve complete clinical response (CR). Lesions of lung, liver & lymph node subsided. She spent 33 months of treatment free interval, after which lymph node enlargement was noticed and its fine needle aspiration cytology showed metastasis. Patient was put on to oral metronomic therapy with etoposide, cyclophosphamide, and celecoxib (COX-2 inhibitor) for 8 months, which showed CR. Again after 4 months, lesion in liver reappeared with raised CA 125, suggesting second relapse. The patient is on oral metronomic therapy till date with improved clinical condition. This study highlights the need of early diagnosis, adjuvant chemotherapy with frequent follow up in this case. Liver is an early site for metastasis. Second relapse in also not uncommon.

ULTRASTRUCTURAL AND IMMUNOHISTOCHEMICAL STUDIES OF REACTIVE AND ADAPTIVE TRANSFORMATIONS OF THE GREATER OMENTUM AT TUMOR LESIONS OF THE OVARIES

The greater omentum is an organ in which metastases of malignant neoplasms of the female reproductive system are often formed. The issues of adaptive and reactive transformations of the greater omentum under conditions of a tumor process in the organs of the female reproductive system have been insufficiently studied. The aim of the study was to elucidate morphological and functional ultrastructural and immune-histochemical changes in the greater omentum in women with ovarian tumor lesions. Using the methods of light and electron microscopy, immunohistochemistry and morphometry, the ovaries of 48 women were examined, who were diagnosed with poorly differentiated serous-papillary adenocarcinoma stage II (20 patients, group 1), stage III (28 patients, group 2). In stage III patients, numerous tumor metastases were detected in the greater omentum. The results of the study showed that in the patients of the 2nd group, in the peri-tumor areas of the greater omentum, the vessels of the microvasculature were dilated, in the connective tissue, moderate edema and leukocyte infiltration were observed. Immuno-histochemical markers showed an increase in the number of immunocompetent cells, mainly T-lymphocytes in the tumor and in the peri-tumor areas. In the tumor and in the surrounding areas of the greater omentum, the process of neoplasm of blood capillaries was noted, differences in the density of collagen fibrils in different parts of the serous membrane were revealed, and the presence of numerous holes was shown, the sizes of which were reduced in areas with metastases. The results obtained show the adaptive and reparative capabilities of the structures of the greater omentum during the tumor process in the organs of the female reproductive system, indicate the important role of the greater omentum in providing protective reactions in the abdominal cavity. In response to the invasion of tumor cells, the processes of angiogenesis are activated in the greater omentum, and the number of immunocompetent cells increases in neo-lymphogenesis. The materials of the study indicate a significant plasticity and reactivity of the greater omentum under conditions of a tumor process in the body. However, the presence of a pronounced proliferative activity of tumor cells in tumor metastases indicates that these adaptive capacities are insufficient to resist tumor invasion into the greater omentum.

Abstract PO013: SNP rs1982 in the 3’UTR of placenta-specific protein 1 (PLAC1) is associated with endometrial cancer survival

Abstract Placenta-specific protein 1 (PLAC1) is a small (212aa) secreted protein normally only expressed on the apical surfaces of syncytiotrophoblasts. However, over the past two decades we and other investigators have shown that human cancers and, in particular, cancers of the human reproductive tract, induce PLAC1 expression. In gynecologic cancers, PLAC1 expression has been shown to be associated with risk, histology and TP53 mutation status. A previously unassessed informative SNP rs1982 (A>C) lies in the 3’ untranslated region of the PLAC1 gene. We have begun to explore the utility of this SNP by genotyping a panel of 75 endometrial cancers. The panel is composed of 29 endometrial adenocarcinomas, 10 papillary serous adenocarcinomas, 9 mixed Mullerian tumors, 6 mixed histologies, 2 tumors identified as displaying complex atypia and 1 neuroendocrine tumor. High molecular weight genomic DNA was extracted from these tumors and SNP genotypes determined by directly sequencing a 312bp PCR amplicon generated by the primers: rs1982for: GAGGATTGGTCTCTTCACACAG; rs1982rev: ACAATGTCTGGCCCATACTAAA SNP genotypes were then evaluated against a variety of clinical variables including age, BMI, tobacco use, Charlson Index, co-morbidities, stage, grade, myometrial invasion, recurrence, and death by cancer using both univariate and multivariate logistic regression. Progression-free and overall survival were assessed by Cox Proportional Hazard ratio. Results show that CC homozygotes have increased progression-free and overall survival though neither reached statistical significance. However, several clinical variables were statistically associated with different rs1982 genotypes. Charlson co-morbidity Index was positively associated with presence of the wild-type A allele (OR = 1.61; 1.06 - 2.69; p<0.05), while death from disease was negatively associated (OR = 0.15; 0.03 – 0.64; p<0.02). These differences hold when accounting for other co-variates in the multivariate analysis. These data support further exploration of this SNP in gynecologic cancers. Citation Format: Eric J. Devor, Jesus Gonzalez-Bosquet, Kimberly K. Leslie. SNP rs1982 in the 3’UTR of placenta-specific protein 1 (PLAC1) is associated with endometrial cancer survival [abstract]. In: Proceedings of the AACR Virtual Special Conference: Endometrial Cancer: New Biology Driving Research and Treatment; 2020 Nov 9-10. Philadelphia (PA): AACR; Clin Cancer Res 2021;27(3_Suppl):Abstract nr PO013.

Abstract 2795: Ex vivo modelling of vascularized pdx-derived ovarian tumors

Abstract Predicting clinical response to anticancer drugs remains a major challenge in cancer therapy research. The current treatment of patients with ovarian cancer involves surgery and platinum-based chemotherapy, which still result in recurrence on advanced stages of the disease. During tumor progression, cancerous cells continuously accumulate mutations giving rise to a heterogeneous population of cells. Additionally, spatial distribution of stromal, endothelial and immune cells in the microenvironment affects tumor progression, cell morphology, and ultimately drug response. In order to predict clinical outcome of chemotherapy in vitro, tumor heterogeneity and microenvironment constituents must be conserved. Current models of tumor biology and microenvironment consist in xenografts of human tumors implanted in immunodeficient mice. These models allow studying systemic treatment response, but its application is limited to small developmental studies. Here, we present a high throughput in vitro 'grafting' platform where we co-culture blood vessels with tumor explants. Each unit in this platform is composed of two parallel microfluidic channels and a central chamber. Two endothelial tubules are generated in the microfluidic channels and cultured in presence of a gradient of angiogenic factors (S1P, VEGF, bFGF and PMA) added to the central chamber of the culture unit. Angiogenic tubules form vascular beds within 3-5 days, after which tumor explants are loaded to the central chamber on top of the vascular beds. The model shown in this study consists of ovarian serous papillary adenocarcinoma collected after xenograft growth in immunodeficient mice. This ovarian cancer explant was previously characterized as resistant to Paclitaxel. In this study, we observe how the vascular bed remodels in the presence of the explant and closely interacts with ovarian tumor tissue. Vessel perfusion and stabilization of vascular bed was monitored by real time imaging of 150 kDa FITC-Dextran. Cultures were evaluated by assessment of morphology and presence of endothelial and tumor cell biomarkers. Moreover, co-culture response to Sorafenib (anti-angiogenic), Palbociclib and Paclitaxel was detected by distinctive proliferation rates as compared to control conditions. The established ovary cancer-on-a-chip platform enables the study of fundamental aspects of tumor disease and progression. In addition, these co-cultures serve as a platform for understanding tumor-endothelial cell crosstalk and its consequences for tumor aggressiveness. Moreover, these models constitute a suitable platform for drug screenings of anti-cancer and anti-angiogenic compounds, making them a powerful translational tool for drug selection in personalized medicine applications. Citation Format: Silvia Bonilla, Jean-François Mirjolet, Pauline Berger, Elodie Rajon, Erik Walinga, Remko van Vught, Henriëtte Lanz, Jos Joore, Paul Vulto, Fabrice Viviani, Karla Queiroz. Ex vivo modelling of vascularized pdx-derived ovarian tumors [abstract]. In: Proceedings of the Annual Meeting of the American Association for Cancer Research 2020; 2020 Apr 27-28 and Jun 22-24. Philadelphia (PA): AACR; Cancer Res 2020;80(16 Suppl):Abstract nr 2795.

Outcomes of surgical resection for pulmonary metastasis from ovarian cancer

BackgroundDue to its rarity, information on pulmonary metastasectomy for pulmonary metastasis from ovarian cancer is limited.MethodsCases of pulmonary metastasectomy for ovarian cancer were collected in a multi-institutional setting and the outcomes were analyzed.ResultsAmong 1508 cases in which pulmonary resection was performed to treat pulmonary metastasis from tumors of various organs, 6 cases (0.4%) involved pulmonary metastasis from ovarian cancer. The mean age was 61 years (range, 39–75 years). The histological types were undifferentiated carcinoma in 2 patients, and clear cell adenocarcinoma, serous papillary cystadenocarcinoma, serous adenocarcinoma, and endometroid adenocarcinoma in 1 patient each. One patient (17%) had a history of liver metastasis at the time of pulmonary resection. The median disease-free interval was 22 months (range, 0 [synchronous]-188 months). The tumor was solitary in 5 patients (83%). The mean tumor size was 15 mm (range, 5–23 mm). All 6 patients underwent complete resection. The type of resection was wide wedge resection in 3 patients, segmentectomy in 2 patients, and lobectomy in 1 patient. Four patients (67%) received postoperative chemotherapy. Thus far, 4 patients (67%) have experienced recurrence after pulmonary resection. In terms of outcomes, 1 patient who had synchronous pulmonary metastasis with the primary tumor died in the early period after pulmonary resection, 1 patient is alive without recurrence after a short follow-up period (5 months), 3 patients have achieved mid- to long-term survival and are alive with disease (38–61 months), and 1 patient achieved long-term (61 months) disease-free survival.ConclusionsPatients with pulmonary metastasis from ovarian cancer who fulfill the eligibility criteria for pulmonary metastasectomy are rare. Pulmonary metastasectomy for ovarian cancer can provide favorable outcomes in highly selected patients. Patients with synchronous pulmonary metastasis from ovarian cancer are not good candidates for pulmonary metastasectomy.

Ovarian Cancer Metastatic to Breast and Axilla: A Case Report

Background: Metastases to breast and axilla from extramammary sites are uncommon and have been reported in only 2% of breast malignancies. Ovarian cancer metastatic to breast and axillary lymph nodes is extremely rare and only accounts for 0.03%-0.6% of all breast neoplasms. The most common histologic feature of ovarian cancer metastatic to breast is papillary serous adenocarcinoma. Differentiating the secondary breast malignancies from primary ones is crucial as the treatment and prognosis are different, which could avoid many unnecessary procedures. Prognosis is generally poor because most patients have simultaneous spread of the disease.
 Case presentation: A 67-year-old woman with a history of ovarian cancer, undergoing chemotherapy presented with redness and swelling in her left breast and pathologic axillary lymph nodes. Work ups revealed ovarian cancer metastases to breast and axillary lymph nodes. She underwent chemotherapy with second line chemotherapeutics. The results were satisfying and the patient is well.
 Conclusion: The history of cancer in patients with a breast mass, even if clinically benign, may give rise to potential metastases. Screening with physical examination and serial mammography for patients with ovarian cancer could be beneficial. Early and accurate diagnosis of breast metastatic tumors is critical for proper management and preventing unnecessary and possibly harmful procedures.

Serous adenocarcinoma detected in the cervical smear: A case report

Introduction. Cytological smear tests of the cervix are routine diagnostic methods used for detection of precancerous lesions and tumors of the cervix; they are highly sensitive and specific in the detection of precancerous squamous intraepithelial lesions. Glandular lesions are much less frequently found in the cervical smear. The most common glandular lesions detected in the cervical smear are endocervical and endometrial adenocarcinomas. Cervical metastases are rare, although there are case reports in the literature. Case Report. In this case report, we present a 64-year-old woman with an abnormal cervical smear and postmenopausal metrorrhagia. Numerous accumulations, as well as individual atypical epithelial cells, were detected in the cervical smear and a cytological diagnosis of a highgrade squamous intraepithelial lesion was made based on cytomorphological features suspicious for invasion (Bethesda Classification, 2014) so a cervical biopsy and curettage of the endocervical canal were performed. A high-grade serous adenocarcinoma was diagnosed by histopathological examination of cervical biopsy and cervical canal curettage specimens, after which a transvaginal ultrasound examination was performed, which showed tumors on both ovaries and free fluid in the abdominal cavity. The patient underwent abdominal hysterectomy with bilateral salpingo-oophorectomy. Histological examination confirmed high-grade ovarian papillary serous adenocarcinoma with psammoma bodies. Conclusion. The cytological diagnostic features and criteria for serous adenocarcinoma in Papanicolaou smears are still vague and insufficiently defined in the literature, which is the reason for very common errors in the interpretation, so further research on the pathogenesis, diagnosis and therapy of this tumor is of great importance.

2703 Gastric Metastasis From a Primary Ovarian Cancer

INTRODUCTION: Metastasis to stomach is very rare in general and often related to a breast or a lung primary. Ovarian cancer metastasizing to the stomach is extremely rare. We are reporting a very unusual case of a lady who had gastric metastasis from the primary ovarian cancer more than 3 years after the initial diagnosis. Serosal tumors are more likely to metastasize in comparison to the mucinous type. CASE DESCRIPTION/METHODS: A 49 year old Hispanic lady who had originally presented 3.5 years prior to her recent admission with abdominal pain and bloating. Work-up confirmed bilateral ovarian masses. Staging was negative for liver, lung and brain involvement. She had surgery. The pathology confirmed papillary serous adenocarcinoma with appendiceal and omental involvement. Estrogen and progesterone receptors were positive. She was considered to have Stage III-C disease, and started with chemotherapy. Unfortunately, within a few months, she came in with shortness of breath with imaging showing bilateral pleural effusions. She had thoracentesis which confirmed metastasis from her primary ovarian cancer. Her staging status was changed to IV. She was started on palliative chemotherapy. She would respond partially at first, but then she did show progression of the cancer. She then presented to the hospital recently with GI bleeding, anemia, sepsis, acute renal failure, leukocytosis and respiratory compromise. An upper endoscopy showed a large cratered malignant appearing ulcer in the body of the stomach. Biopsies confirmed adenocarcinoma from the ovarian source. Based on her advanced disease, and multi-system organ failure, the family decided on hospice care. DISCUSSION: Ovarian cancer metastasizing to the stomach is exceedingly rare. The symptoms are usually vague as the involvement is often serosal or sub-mucosal from local infiltration from the peritoneal carcinomatosis. However, hematogenous spread can occur as well. Presentation is often late, months to years after the initial diagnosis of the cancer. EGD should be considered in ovarian cancer patients presenting with upper GI symptoms. EUS/FNA biopsy may help in the diagnosis of the submucosal lesions. Prognosis is usually poor with average life expectancy after the diagnosis of gastric metastasis being 15 months.

Neoadjuvant Chemotherapy in Advanced Epithelial Ovarian Cancer: An Institutional Experience

Epithelial ovarian cancer is the second most common gynaecological malignancy among Indian women. Primary debulking surgery remains the standard of care in advanced operable ovarian cancer patients, but is associated with morbidity. Neoadjuvant chemotherapy followed by delayed primary cytoreductive surgery may be a better treatment strategy in advanced ovarian cancer. We present our experience of neoadjuvant chemotherapy in advanced ovarian cancer with special emphasis on treatment outcomes. A retrospective analysis of advanced epithelial ovarian carcinoma (stages III and IV) patients treated at the Department of Surgical Oncology at King George’s Medical University, Lucknow, between 2012 and 2016 was done. A total of 128 patients with advanced ovarian carcinoma were treated during this period. Median age at diagnosis was 46 years. Among these patients, 115 underwent surgery, of which 57.4% were optimally cytoreduced. Papillary serous adenocarcinoma was the most common histological subtype (78.1%). Recurrence was seen in 73% of patients, with a median time to recurrence 16 months (range 6.5–37 months). They were managed with second-line chemotherapy and surgery. Median overall survival in this study for optimally cytoreduced stage III patients was 38 months and 17 months for optimally cytoreduced stage IV patients. Median progression-free survival for stage III was 13 months and stage IV was 6 months. Neoadjuvant chemotherapy facilitates surgery in advanced ovarian cancer and helps in assessing chemotherapy responsiveness. It provides an opportunity to modify systemic treatment if there is no response to therapy or disease progression.

TGF-β signaling proteins and CYP24A1 may serve as surrogate markers for progesterone calcitriol treatment in ovarian and endometrial cancers of different histological types

Background: Strategies are needed to coordinately block drivers and induce suppressors of cancer to reduce incidence and improve outcomes for individuals with inherited or acquired risk. We previously reported the chemopreventive and therapeutic efficacy of the combination of progestin and calcitriol in transformed and malignant endometrioid endometrial cancer (EC) and in ovarian cancer models involving attenuated expression of TGF-β signaling proteins and progestin-mediated inhibition of calcitriol-induced CYP24A1 expression. This study aims to expand the applications for this combination to other subtypes of endometrial and ovarian cancers, including those with mutations in ARID1A or PIK3CA, DNA mismatch repair (MMR) deficiency or BRCA1 null status. Methods: Ovarian and EC cell lines of different histotypes were cultured with either progesterone, calcitriol, or the combination of progesterone and calcitriol for 3 or 5 days. The end points for this in vitro investigation included assessments of cell growth by (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) (MTS) assays and the expression of TGF-β ligands, receptors, SMAD proteins and CYP24A1 by western blotting. Results: Treatment of ovarian clear cell carcinoma, endometrioid carcinoma, papillary serous adenocarcinoma, BRCA1 null, and DNA MMR deficient EC cell lines with progesterone alone or in combination with calcitriol inhibited cell growth and expression of TGF-β1, TGF-β2, TGF-Rβ1, TGF-βR2, pSMAD2/3 and CYP24A1. Expression of TGF-βR3, SMAD-4, progesterone receptor (PR) and vitamin-D receptor (VDR) was not altered in any cell line tested except, ES-2, where VDR expression was upregulated in response to treatment. Conclusions: These results suggest that progesterone alone and progesterone-calcitriol combination have broad application in both chemopreventive and therapeutic settings that merit further development in a wide variety of ovarian and ECs, including those derived from germline or somatic mechanisms. Moreover, our data suggest that TGF-β signaling proteins and CYP24A1 may be effective surrogate markers indicative of treatment response.

TGF-β signaling proteins and CYP24A1 may serve as surrogate markers for progesterone calcitriol treatment in ovarian and endometrial cancers of different histological types.

BackgroundStrategies are needed to coordinately block drivers and induce suppressors of cancer to reduce incidence and improve outcomes for individuals with inherited or acquired risk. We previously reported the chemopreventive and therapeutic efficacy of the combination of progestin and calcitriol in transformed and malignant endometrioid endometrial cancer (EC) and in ovarian cancer models involving attenuated expression of TGF-β signaling proteins and progestin-mediated inhibition of calcitriol-induced CYP24A1 expression. This study aims to expand the applications for this combination to other subtypes of endometrial and ovarian cancers, including those with mutations in ARID1A or PIK3CA, DNA mismatch repair (MMR) deficiency or BRCA1 null status.MethodsOvarian and EC cell lines of different histotypes were cultured with either progesterone, calcitriol, or the combination of progesterone and calcitriol for 3 or 5 days. The end points for this in vitro investigation included assessments of cell growth by (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) (MTS) assays and the expression of TGF-β ligands, receptors, SMAD proteins and CYP24A1 by western blotting.ResultsTreatment of ovarian clear cell carcinoma, endometrioid carcinoma, papillary serous adenocarcinoma, BRCA1 null, and DNA MMR deficient EC cell lines with progesterone alone or in combination with calcitriol inhibited cell growth and expression of TGF-β1, TGF-β2, TGF-Rβ1, TGF-βR2, pSMAD2/3 and CYP24A1. Expression of TGF-βR3, SMAD-4, progesterone receptor (PR) and vitamin-D receptor (VDR) was not altered in any cell line tested except, ES-2, where VDR expression was upregulated in response to treatment.ConclusionsThese results suggest that progesterone alone and progesterone-calcitriol combination have broad application in both chemopreventive and therapeutic settings that merit further development in a wide variety of ovarian and ECs, including those derived from germline or somatic mechanisms. Moreover, our data suggest that TGF-β signaling proteins and CYP24A1 may be effective surrogate markers indicative of treatment response.

Abstract 4921: TGF-beta signaling proteins and CYP24A1 may serve as surrogate markers for progesterone calcitriol treatment in ovarian and endometrial cancers of different histological types

Abstract Strategies are needed to coordinately block drivers and induce suppressors of cancer to reduce incidence and improve outcomes for individuals with inherited or acquired risk. We previously reported the chemopreventive and therapeutic efficacy of the combination of progestin and calcitriol in transformed and malignant endometrioid endometrial cancer and in ovarian cancer models involving attenuated expression of TGF-β signaling proteins and progestin-mediated inhibition of calcitriol-induced CYP24A1 expression. This study aims to expand the applications for this combination to other subtypes of endometrial and ovarian cancers including those with mutations in ARID1A or PIK3CA, DNA mismatch repair deficiency or BRCA1-null status. The end points for this in vitro investigation included assessments of cell growth and the expression of TGF-β ligands, receptors, SMAD proteins and CYP24A1. Treatment of ovarian clear cell carcinoma, endometrioid carcinoma, papillary serous adenocarcinoma, BRCA1 null, and DNA mismatch repair deficient endometrial cancer cell lines with progesterone alone or in combination with calcitriol inhibited cell growth and expression of TGF-β1, TGF-β2, TGF-Rβ1, TGF-βR2, pSMAD2/3 and CYP24A1. Expression of TGF-βR3, SMAD-4, PR and VDR was not altered in any cell line tested except, ES-2, where VDR expression was upregulated in response to treatment. These results suggest that progesterone alone and progesterone-calcitriol combination have broad application in both chemopreventive and therapeutic settings that merit further development in a wide variety of ovarian and endometrial cancers, including those derived from germline or somatic mechanisms. Moreover, our data suggest that TGF-β signaling proteins and CYP24A1 may be effective surrogate markers indicative of treatment response. Citation Format: Ana Paucarmayta, Hannah Taitz, Yovanni Casablanca, Gustavo C. Rodriguez, G L. Maxwell, Kathleen M. Darcy, Viqar Syed. TGF-beta signaling proteins and CYP24A1 may serve as surrogate markers for progesterone calcitriol treatment in ovarian and endometrial cancers of different histological types [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2019; 2019 Mar 29-Apr 3; Atlanta, GA. Philadelphia (PA): AACR; Cancer Res 2019;79(13 Suppl):Abstract nr 4921.