Papaya Ringspot Virus Infection Research Articles

Characterization of gynodioecious Pune selection lines of papaya

Among major global threats to papaya cultivation, papaya ringspot virus (PRSV) is the most challenging one. In the absence of any PRSV resistant commercial papaya cultivar, PRSV management is restricted to minimizing yield losses. ICAR-Indian Agricultural Research Institute, Regional Station, Pune has developed PRSV tolerant dioecious papaya lines, Pune Selection (PS)-1, PS-2, PS-3 and PS-5. Being dioecious these lines have limited acceptability among farmers. Gynodioecious population from these lines were developed and characterized. They are numbered PS-1-1, PS-2-1, PS-3-1 and PS-5-1. These lines were characterized against prevailing commercial gynodioecious cultivar, Red Lady, for five generations. The average plant height of PS-2-1 and PS-5-1 (183 cm) was more than Red Lady (158 cm), however, stem girth of all lines was lesser than Red Lady. The fruiting height of all lines was less than Red Lady (87 cm). Length of the fruiting column of all lines was more than Red Lady (37 cm), except in PS-1-1. Fruit yield of all lines was more than Red Lady (16 kg/plant). Intensity of PRSV infection in Red Lady (48%) was considerably more than all lines. These lines can be used for developing PRSV tolerant gynodioecious papaya variety.

Differential expression of microRNAs in response to Papaya ringspot virus infection in differentially responding genotypes of papaya (Carica papaya L.) and its wild relative.

Papaya ringspot virus (PRSV) is one of the most devastating viruses of papaya that has significantly hampered papaya production across the globe. Although PRSV resistance is known in some of its wild relatives, such as Vasconcellea cauliflora and in some of the improved papaya genotypes, the molecular basis of this resistance mechanism has not been studied and understood. Plant microRNAs are an important class of small RNAs that regulate the gene expression in several plant species against the invading plant pathogens. These miRNAs are known to manifest the expression of genes involved in resistance against plant pathogens, through modulation of the plant's biochemistry and physiology. In this study we made an attempt to study the overall expression pattern of small RNAs and more specifically the miRNAs in different papaya genotypes from India, that exhibit varying levels of tolerance or resistance to PRSV. Our study found that the expression of some of the miRNAs was differentially regulated in these papaya genotypes and they had entirely different miRNA expression profile in healthy and PRSV infected symptomatic plants. This data may help in improvement of papaya cultivars for resistance against PRSV through new breeding initiatives or biotechnological approaches such as genome editing.

Mutagenesis of the melon Prv gene by CRISPR/Cas9 breaks papaya ringspot virus resistance and generates an autoimmune allele with constitutive defense responses.

The majority of plant disease resistance (R) genes encode nucleotide binding-leucine-rich repeat (NLR) proteins. In melon, two closely linked NLR genes, Fom-1 and Prv, were mapped and identified as candidate genes that control resistance to Fusarium oxysporum f.sp. melonis races 0 and 2, and to papaya ringspot virus (PRSV), respectively. In this study, we validated the function of Prv and showed that it is essential for providing resistance against PRSV infection. We generated CRISPR/Cas9 [clustered regularly interspaced palindromic repeats (CRISPR)/CRISPR-associated protein 9] mutants using Agrobacterium-mediated transformation of a PRSV-resistant melon genotype, and the T1 progeny proved susceptible to PRSV, showing strong disease symptoms and viral spread upon infection. Three alleles having 144, 154, and ~3 kb deletions, respectively, were obtained, all of which caused loss of resistance. Interestingly, one of the Prv mutant alleles, prvΔ154, encoding a truncated product, caused an extreme dwarf phenotype, accompanied by leaf lesions, high salicylic acid levels, and defense gene expression. The autoimmune phenotype observed at 25 °C proved to be temperature dependent, being suppressed at 32 °C. This is a first report on the successful application of CRISPR/Cas9 to confirm R gene function in melon. Such validation opens up new opportunities for molecular breeding of disease resistance in this important vegetable crop.

Change in physiological parameters and partitioning of sugar upon Papaya ringspot virus infection in Carica papaya and its wild relatives

Papaya ringspot virus-P is a major detrimental to papaya cultivation. All cultivars of Carica papaya are found to be susceptible to Papaya ringspot virus disease, meanwhile, the species in Vasconcellea gene pool possess PRSV resistance, conferred by many researchers. Inorder to understand the role of sugars and its partitioning as defence mechanism against PRSV attack, eleven accessions including susceptible cultivated varieties, intergeneric hybrids and wild relatives were inoculated and estimated physiological parameters such as photosynthetic rate (PN), stomatal conductance (gs) and transpiration rate (E) and profile of sugars in LC-MS. The results revealed that physiological parameters remained unchanged in resistant accessions; whereas, in susceptible accessions, PN and gs decreased as disease progressed and E increased upto 14 days post inoculation (dpi) and decline. Major transporter sugar, sucrose increased rapidly in resistant accessions, similar was the case for the glucose and fructose. As a defence mechanism, sucrose attracts towards the wounded site and further converts it into glucose and fructose by invertase, rapid occurrence of these processes act as signalling and resulted in defence related proteins. Due to the destruction of chlorophyll structure, sucrose and hexose sugars failed to elevate rapidly in susceptible accessions. Pentose sugar, ribose was increased immediately in resistant accessions, which might have enhance defence related genes and proteins. However, cell wall pentose sugars remained unaffected in resistant accessions, while in susceptible accessions, they increased at 30 dpi. Sugar alcohol viz., inositol was increased at initial stage in resistant accessions. Trehalose, a disaccharide sugar increased in susceptible accessions after 30 days of inoculation.

A new strain of Papaya ring spot virus infecting ivy gourd (Coccinia grandis L.) in India

Ivy gourd (Coccinia grandis L.) plants showing virus likesymptoms such as mosaic mottling and thickening of leaflamina were collected from Tindivanam, Tamil Nadu. ThroughReverse transcription polymerase chain reaction, infectionof potyvirus was confirmed with the yield of desiredamplicon (~1.0 kb) using universal primer pair. Sequenceanalysis of amplified product showed the infection of Papayaring spot virus (PRSV). Further association of PRSV wasconfirmed with PRSV specific primer pair (GK PRSV F/R).The nucleotide sequence analysis showed identity of coatprotein region shared only 84% with PRSV isolate fromThailand in BLAST analysis. In phylogenetic analysis, PRSVinfecting ivy gourd formed a separate cluster from otherPRSV isolates. This confirms the association of distinct strainof PRSV on Ivy gourd in India.

First Report of Papaya ring spot virus (PRSV) Infecting Jute (Corchorus olitorius) in India.

Jute is the most important bast fibre crop of the world, which is mainly cultivated in India, Nepal, Bangladesh, China, Indonesia and South American countries. The fibre is utilized for making apparels, ropes, bags, carpets etc (Biswas et al. 2014). This bio-fibre is gaining importance due to growing environmental consciousness worldwide. In June 2019, we noticed jute plants (less than 2%) showing virus like symptoms viz., downward curling, puckering, angular brownish to yellowish spots etc in a farmer's field at Amdanga Block, North 24 Paraganas, West Bengal, India. To identify the virus, five symptomatic leaves from five different plants were used for high throughput sequencing (HTS). We extracted total RNA from each leaf which was subjected to construction of cDNA libraries. Sequencing was done on Illumina Hiseq 4000 (CytoScan, Thermo Fisher). Approximately 46 million 105 nt paired end reads were generated. Raw reads were trimmed and filtered to perform de novo assembly as described previously by (Grabherr et al. 2013). The obtained contig was 10,326 bp nucleotides (nt) long and in BLASTn against GenBank showed highest identity with papaya ring spot virus (PRSV) with the contig covering 99.6% of the viral genome. The obtained contig shared 99.33% sequence similarity with PRSV strain P (Accession No. MT470188). The selected leaf samples were also tested by double-antibody sandwich (DAS)- enzyme linked immunosorbent assay (ELISA) for papaya ring spot virus (PRSV) along with some common viruses, viz., Potato leaf roll virus (PLRV), Watermelon mosaic virus, Cowpea mosaic virus and Cucumber mosaic virus with the help of commercial diagnostic kits (Agdia). However, only the test with PRSV gave positive reaction for the symptomatic samples. The major symptoms of PRSV on papaya are severe mosaic, chlorosis, reduced lamina with curling and puckering (Gonsalves et al. 2010). To confirm PRSV infection, five symptomatic leaf samples (used for HTS) were collected and whole RNA was extracted from the samples using RNeasy plant minikit (Qiagen, USA). Reverse transcriptase polymerase chain reaction (RT-PCR) was conducted by using isolated RNA. One pair of PRSV specific primer (PSRV1F: 5' TTAAATCTGATTCGTC 3' PRSV 1R: 5'GAAATTCACGCAAAGTCGA3') was developed by using primer BLAST software and was used in RT-PCR assays. Amplified fragments were cloned and sequenced and all the fragments shared 98% sequence identity with PRSV. One of the amplicons was deposited in NCBI (Accession No. MN615832). Crude sap was prepared by homogenizing PRSV-infected jute leaf tissues in 0.1 M sodium phosphate buffer and 2% carborundum dust was added as abrasive (Holkar et al. 2018). The sap was then gently rubbed on to the healthy papaya leaves for inoculation. Typical PRSV like symptoms appeared in inoculated leaves 10 days post inoculation which confirmed the presence of PRSV-P. PRSV was detected by RT-PCR as well as (DAS)-ELISA from all inoculated infected papaya leaf tissues, but could not be detected from uninoculated healthy papaya tissues. To the best of our knowledge, this is the first report of PRSV-P infecting jute in India.

Study of interaction between Papaya ringspot virus coat protein and infected Carica papaya proteins

ABSTRACT Papaya ringspot virus (PRSV) causes the Papaya ringspot disease. Virus–host interactions appear to play a significant role in the replication, pathogenesis, and infection caused by the PRSV. PRSV coat protein is likely to be involved in the processes of RNA replication, aphid transmission, and cell-to-cell movement, which is closely related to the host cell proteins resulting in a PRSV infection. To identify the host proteins that interact with the CP in vitro, immune precipitation, in-solution trypsin digestion, and LC–MS/MS were performed. Twenty-three identified proteins that interacted with the CP are involved in cellular metabolism, transcription, signal, translation, carbohydrate metabolism, protein metabolism, stress response, photosynthesis, nucleotide metabolism, respiration, and lipid metabolism processes. The search tool for interactions of chemicals (STITCH) results show that SWP (an RNA polymerase II transcription mediator) and MPPBETA (Mitochondrial processing peptidase) are involved in known plant defense mechanisms including transcription factors, cell division, hormones, stress, mitochondrial electron transferase, respiration, and proteasome. Therefore, analyzing virus–host protein interactions at a molecular level is important to build a better understanding of the virus replication mechanism and cellular responses mounted against viruses by the host defense system.

DsRNA-mediated protection against two isolates of Papaya ringspot virus through topical application of dsRNA in papaya

Papaya ringspot virus (PRSV) infections in papaya result in heavy yield losses, severely affecting the papaya industry worldwide, and hence warranting for effective control measures. In the past, transgenic papaya cultivars were developed that overexpressed parts of the PRSV genome and exhibited high levels of virus resistance. In the present study, a non-transgenic approach was employed, in which in vitro produced dsRNA molecules derived from a PRSV isolate from South India (PRSV-Tirupati) was tested for dsRNA-mediated protection against two isolates of PRSV through topical application of the dsRNA on papaya. The results showed that the dsRNA molecules from both the coat protein (CP) and helper component-proteinase (HC-Pro) genes of the PRSV-Tirupati isolate conferred 100 % resistance against PRSV-Tirupati infection. Further, the same dsRNA molecules were highly effective against the PRSV-Delhi isolate on the papaya cv. Pusa Nanha, conferring a resistance of 94 % and 81 %, respectively. Systemic papaya leaves of the dsRNA-treated plants were virus-free at 14 days post-inoculation, confirming the robustness of this non-transgenic virus control strategy. In contrast, the control TMV dsRNA did not protect against the PRSV infection. This study on the topical application of dsRNA opened up a new avenue for the control of papaya ringspot disease worldwide.

Biological and molecular evidence of papaya ring spot virus pathotype P from mid-hills of Meghalaya, India

Papaya ring spot virus (PRSV) is the limiting factor of papaya production in India irrespective of agro-climatic conditions and it may cause crop losses up to 85–90%. In this study, diagnostic survey on PRSV was conducted in mid-hills of Ri-Bhoi district, Meghalaya, India during April to June, 2015. Reverse transcription polymerase chain reaction assay detected PRSV infection in 38 of 53 samples collected from surveyed locations with an average incidence of 71.7%. The representative isolate (PRSV-P:Umiam) from mid-hill Meghalaya was maintained in healthy papaya seedlings by standard sap inoculation method and typical symptoms were expressed within 21–24 days post inoculation. Studies on the physical properties revealed that the dilution end point of PRSV-P:Umiam at 10−2, longevity in vitro for 18 h and thermal inactivation point in between 50 and 55 °C. Among the cucurbitaceous hosts, pumpkin (Cucurbita pepo) alone exhibited chlorotic lesions on leaves within 20–25 days post inoculation. The partial coat protein (CP 750 bp) of PRSV-P:Umiam gene shared maximum nucleotide (~ 95%) and amino acid (~ 98%) identity with PRSV isolates reported from northern and eastern India. The CP based phylogeny clustered PRSV-P:Umiam with the PRSV isolates from north and east India.

Karakterisasi Molekuler Papaya ringspot virus tipe P pada Tanaman Mentimun di Jawa

Moleculer Characterization of Papaya ringspot virus type P on Cucumber in JavaInfection of Papaya ringspot virus (PRSV) on cucumber plants showing mosaic symptom was detected using specific antibody. Further investigation was conducted to determine molecular characters and status of PRSV infecting cucumber in Java. Infection of PRSV was detected from leaf samples collected from the field using dot immunobinding assay (DIBA). Disease frequency caused by PRSV infection reached 81.11%, 95.86%, 91.66%, and 92.3% in East Java, Central Java, Yogyakarta, and West Java, respectively. Characterization of PRSV isolates was conducted by reverse transcription polymerase chain reaction (RT-PCR) using specific primers for PRSV-P and PRSV-W, followed by cloning, and DNA sequencing. DNA fragment of 470 bp was successfully amplified using specific primers for PRSV-P from several samples from Nganjuk, Brebes, Kulon Progo, and Subang; but no amplification was achieved using specific primers for PRSV-W. Nucleotide and amino acid analysis showed high homology among PRSV-P isolates from Nganjuk, Brebes, Kulon Progo, and Subang, i.e. 98.6%-99.7% and 99.3%-100%, respectively. This is an indication of a low genetic variation among PRSV-P from Java. Further phylogenetic analysis indicated that PRSV-P isolate cucumber is in the same cluster with PRSV-P isolate papaya from Bali, Indonesia. This is the first report of PRSV-P infecting cucumber in Indonesia.

Ultra-sensitive detection of papaya ringspot virus using single-tube nested PCR.

Aphid-transmitted papaya ringspot virus (PRSV) is the greatest disease threat to the commercial production of papaya worldwide. Specific ultrasensitive assays are important for the early detection of PRSV in the field. We have developed asingle-tube nested PCR (STNP) assay to address this need. Two nested PCR primer sets were designed to target the P3 gene of PRSV. The annealing temperatures and concentrations of both primer pairs were optimized to reduce potential competition between primer sets in STNP. The assay is more sensitive than regular RT-PCR as determined by serial dilutions of cDNA and RNA templates and sample extracts from infected plants. STNP is capable of detecting PRSV in plants 7 days post-inoculation, whereas RT-PCR and ELISA are capable of detecting PRSV 14 to 21 days post-inoculation. This new assay can also detect PRSV from virus infected but asymptomatic plants. This system could assist epidemiological studies in the field and in quarantine protocols by enabling early detection of very low PRSV infection rates in the field and in imported plant samples. Keywords: early detection; quarantine protocols.

Sunn hemp intercrop and mulch increases papaya growth and reduces wind speed and virus damage

Papaya (Carica papaya L.) production in south Florida is limited by trade winds, storm wind damage, and papaya ringspot virus (PRSV) infection. This study was implemented to test a system intercropping sunn hemp (Crotalaria juncea L.) with papaya during papaya establishment, then mowing the intercrop and using it as a mulch on papaya beds. The study was performed in 2014 and repeated in 2015. Treatments included no sunn hemp (No-SH), sunn hemp mown early (SH-ME) 65days after transplanting (DAT), and sunn hemp mown late (SH-ML) at 100 DAT. Wind speeds, sunn hemp growth and biomass contribution, papaya above ground growth, yield, flowering date, weeding time, and gas exchange variables, including net CO2 assimilation (A) and stomatal conductance (gs) of H2O were measured. In 2015, additional measurements included PRSV infection rates and root growth via minirhizotron imaging. Results indicated a positive establishment environment as a result of the sunn hemp intercrop-mulching system. The system reduced weed pressure, reduced wind speed within papaya rows, and increased papaya growth after mowing and mulching. In 2015, standing sunn hemp reduced PRSV infection rates and hastened flowering. Mulching increased root growth in 2015, and A and gs for 2 months after mulching. The SH-ML treatment led to elongation and reduced growth due to excessive shading. With the appropriate timing of mowing, this system promises improved production efficiency and reduced risks for south Florida papaya producers.

Subchronic Immunotoxicity Assessment of Genetically Modified Virus-Resistant Papaya in Rats

Papaya is an important fruit that provides a variety of vitamins with nutritional value and also holds some pharmacological properties, including immunomodulation. Genetically modified (GM) papaya plants resistant to Papaya ringspot virus (PRSV) infection have been generated by cloning the coat protein gene of the PRSV which can be used as a valuable strategy to fight PRSV infection and to increase papaya production. In order to assess the safety of GM papaya as a food, this subchronic study was conducted to assess the immunomodulatory responses of the GM papaya line 823-2210, when compared with its parent plant of non-GM papaya, Tainung-2 (TN-2), in Sprague-Dawley (SD) rats. Both non-GM and GM 823-2210 papaya fruits at low (1 g/kg bw) and high (2 g/kg bw) dosages were administered via daily oral gavage to male and female rats consecutively for 90 days. Immunophenotyping, mitogen-induced splenic cell proliferation, antigen-specific antibody response, and histopathology of the spleen and thymus were evaluated at the end of the experiment. Results of immunotoxicity assays revealed no consistent difference between rats fed for 90 days with GM 823-2210 papaya fruits, as opposed to those fed non-GM TN-2 papaya fruits, suggesting that with regard to immunomodulatory responses, GM 823-2210 papaya fruits maintain substantial equivalence to fruits of their non-GM TN-2 parent.

Induction of systemic resistance against Papaya ring spot virus (PRSV) and its vector Myzus persicae by Penicillium simplicissimum GP17-2 and silica (Sio2) nanopowder

The systemic expressions of certain defense-related genes in cucumber plants induced by culture filtrate (CF) of the plant growth-promoting fungus (PGPF), Penicillium simplicissimum GP17-2, and challenging with Sio2 nanoparticles against Papaya ring spot virus (PRSV) and its vector the green peach aphid Myzus persicae were investigated. CF and Sio2 were topically applied to cucumber plants by soil drench method. Results showed that the severity of PRSV and its accumulation in cucumber leaves were significantly reduced in all treated cucumber plants compared with the control. The expression of pathogenesis-related genes showed strong activations of peroxidases (POX) and phenylalanineammonia lyase (PAL) genes and moderate expression of PR-1 one day after inoculation, while, six days after inoculation a high activation of PAL and PR-1 genes and moderate activation of POX gene were detected. No expression was detected in plants infected with PRSV alone without any treatments. These results suggested that CF and Sio2 treatments mediated the expression of the majority of various pathogen-related genes, which may contribute to the increased defense mechanism against PRSV infection in cucumber.

Differential Life History Trait Associations of Aphids with Nonpersistent Viruses in Cucurbits.

The diversity of vectors and fleeting nature of virus acquisition and transmission renders nonpersistent viruses a challenge to manage. We assessed the importance of noncolonizing versus colonizing vectors with a 2-yr survey of aphids and nonpersistent viruses on commercial pumpkin farms. We quantified aphid alightment using pan traps, while testing leaf samples with multiplex RT-PCR targeting cucumber mosaic virus (CMV), zucchini yellow mosaic virus (ZYMV), watermelon mosaic virus (WMV), and papaya ringspot virus (PRSV). Overall, we identified 53 aphid species (3,899 individuals), from which the melon aphid, Aphis gossypii Glover, a pumpkin-colonizing species, predominated (76 and 37% of samples in 2010 and 2011, respectively). CMV and ZYMV were not detected, but WMV and PRSV were prevalent, both regionally (WMV: 28/29 fields, PRSV: 21/29 fields) and within fields (infection rates = 69 and 55% for WMV in 2010 and 2011; 28 and 25% for PRSV in 2010 and 2011). However, early-season samples showed extremely low infection levels, suggesting cucurbit viruses are not seed-transmitted and implicating aphid activity as a causal factor driving virus spread. Interestingly, neither noncolonizer and colonizer alightment nor total aphid alightment were good predictors of virus presence, but community analyses revealed species-specific relationships. For example, cowpea aphid (Aphis craccivora Koch) and spotted alfalfa aphid (Therioaphis trifolii Monell f. maculata) were associated with PRSV infection, whereas the oleander aphid (Aphis nerii Bover de Fonscolombe) was associated with WMV spread within fields. These outcomes highlight the need for tailored management plans targeting key vectors of nonpersistent viruses in agricultural systems.

FIRST REPORT OF MIXED INFECTION OF PAPAYA RINGSPOT VIRUS AND PAPAYA LEAF DISTORTION MOSAIC VIRUS ON CARICA PAPAYA L.

Papaya ringspot virus (PRSV) and Papaya leaf distortion mosaic virus (PLDMV) from the family Potyviridae produce similar symptoms in papaya such as foliar mosaic, ringspots and distortion, water soaking streaks on petioles, and ringspots on fruit. PRSV is the most widespread and destructive viral disease damaging papaya production in the world, whereas PLDMV was recently identified in China (Tuo et al., 2013). In March 2014, 23 papaya trees displaying disease symptoms similar to those of PRSV or PLDMV were observed in Haikou (Hainan Island, China). Six samples were co-infected with PRSV and PLDMV, as shown by DAC-ELISA with antisera to PRSV or PLDMV. Mixed infection was subsequently confirmed by RT-PCR using PRSV-specific primers designed in a highly conserved region of gene P3 (P3-F, 5′TTGTGTACGACTTCTCACCGAA3′ and P3-R, 5′CGAATGTCATCCAAAGACT GATGATAAAC3′) and PLDMV-specific primers designed in a highly conserved region of the coat protein (CP) gene (CP-F, 5′GGCATGTGGTTTATGATGCAAGG G3′ and CP-R, 5′GCTCCGTGTTCTCAGTCGCATT3′). DNA fragments of the expected size (613 and 355 bp, respectively) were amplified from each mixed infected sample using PRSV and PLDMV-specific primers, and then cloned and sequenced. BLASTn analysis of the nucleotide sequences obtained from the cloned PCR products showed 99% identity with a PRSV isolate from Hainan (GenBank accession No. EF183499) and 100% identity with a PLDMV isolate from Hainan (GenBank accession no. JX974555) (Lu et al., 2008; Tuo et al., 2013). To our knowledge, this is the first report of mixed infection of PRSV and PLDMV on papaya, prompting the need for evaluating the potential threat of the mixed virus infection to papaya production.

NIa-Pro of Papaya ringspot virus interacts with Carica papaya eukaryotic translation initiation factor 3 subunit G (CpeIF3G).

The interaction of papaya eukaryotic translation initiation factor 3 subunit G (CpeIF3G) with Papaya ringspot virus (PRSV) NIa-Pro was validated using a bimolecular fluorescence complementation assay in papaya protoplasts based on the previous yeast two-hybrid assay results. The C-terminal (residues 133-239) fragment of PRSV NIa-Pro and the central domain (residues 59-167) of CpeIF3G were required for effective interaction between NIa-Pro and CpeIF3G as shown by a Sos recruitment yeast two-hybrid system with several deletion mutants of NIa-Pro and CpeIF3G. The central domain of CpeIF3G, which contains a C2HC-type zinc finger motif, is required to bind to other eIFs of the translational machinery. In addition, quantitative real-time reverse transcription PCR assay confirmed that PRSV infection leads to a 2- to 4.5-fold up-regulation of CpeIF3G mRNA in papaya. Plant eIF3G is involved in various stress response by enhancing the translation of resistance-related proteins. It is proposed that the NIa-Pro-CpeIF3G interaction may impair translation preinitiation complex assembly of defense proteins and interfere with host defense.

First report of mixed infection of Papaya ringspot virus and phytoplasma in papaya in India.

Papaya plants exhibiting symptoms such as multiple axillary shoots, leaf reduction, mosaic, chlorosis, flattened petiole, oily spots on stem and virescence of flowers were observed in Pune (India). Electron microscopy observations of leaf dip preparations revealed flexuous filamentous particle of 760x12 nm, suggesting the presence of a potyvirus, which was identified as Papaya ringspot virus (PRSV) in ELISA using a specific antiserum. The presence of PRSV was confirmed by RT-PCR using coat protein gene-specific primers that amplified a fragment of ca. 950 bp in size. Sequence analysis of the RT-PCR product (GenBank accession No. KJ142142) showed 87 to 100% identity at the nucleotide level with other Indian PRSV isolates (Jain et al., 2004). The presence of a phytoplasma was tested in symptomatic papaya by PCR using universal P1/P7 and R16mF2/R16mR1 primer pairs. BLAST analysis of the consensus sequence obtained by sequencing PCR products (GenBank accession No. JQ346525) revealed 99% nucleotide sequence identity with Candidatus Phytoplasma aurantifolia, a member of group 16Sr II phytoplasma. Transmission of the phytoplasma to healthy papaya grafted onto infected papaya was obtained four weeks after grafting with the development of multiple axillary shoots. The presence of a phytoplasma and a virus in papaya has previously been reported in Puerto Rico and Cuba (Licha, 2002; Arocha et al., 2009). To our knowledge, this is the first evidence of mixed infection of PRSV and a phytoplasma in papaya from India, although these two pathogens were reported separately earlier (Jain et al., 2004; Rao et al., 2011).

Resistance of non-transgenic papaya plants to papaya ringspot virus (PRSV) mediated by intron-containing hairpin dsRNAs expressed in bacteria.

RNA-mediated virus resistance based on natural antiviral RNA silencing has been exploited as a powerful tool for engineering virus resistance in plants. In this study, a conserved 3'-region (positions 9839-10117, 279 nt) of the capsid protein (CP) gene of papaya ringspot virus (PRSV), designated CP279, was used to generate an intron-containing hairpin RNA (ihpRNA) construct by one-step, zero-background ligation-independent cloning (OZ-LIC). The RNaseIII-deficient Escherichia coli strain M-JM109lacY was identified as the best choice for producing large quantities of specific ihpRNA-CP279. Resistance analyses and ELISA data verified that most papaya plants mechanically co-inoculated with TRIzol-extracted ihpRNA-CP279 and PRSV were resistant to PRSV, and resistance was maintained throughout the test period (>2 months post-inoculation). In contrast, a 1-2 day interval between sequential inoculation of PRSV and ihpRNA-CP279 did not result in complete protection against PRSV infection, but delayed the appearance of viral symptoms by 3 to 4 days. These findings indicate that direct mechanical inoculation of papaya plants with bacterially-expressed ihpRNA-CP279 targeting the PRSV CP gene can interfere with virus infection. This work lays a foundation for developing a non-transgenic approach to control PRSV by directly spraying plants with ihpRNA or crude bacterial extract preparations.

Production of cocktail of polyclonal antibodies using bacterial expressed recombinant protein for multiple virus detection

Cocktail of polyclonal antibodies (PAb) were produced that will help in multiple virus detection and overcome the limitation of individual virus purification, protein expression and purification as well as immunization in multiple rabbits. A dual fusion construct was developed using conserved coat protein (CP) sequences of Cucumber mosaic virus (CMV) and Papaya ringspot virus (PRSV) in an expression vector, pET-28a(+). The fusion protein (∼40kDa) was expressed in Escherichia coli and purified. Likewise, a triple fusion construct was developed by fusing conserved CP sequences of CMV and PRSV with conserved nucleocapsid protein (N) sequence of Groundnut bud necrosis virus (GBNV) and expressed as a fusion protein (∼50kDa) in pET-28a(+). PAb made separately to each of these three viruses recognized the double and triple fusion proteins in Western blot indicating retention of desired epitopes for binding with target antibodies. The fusion proteins (∼40kDa and ∼50kDa) were used to produce cocktail of PAb by immunizing rabbits, which simultaneously detected natural infection of CMV and PRSV or CMV, PRSV and GBNV in Cucurbitaceous, Solanaceous and other hosts in DAC-ELISA. This is the first report on production of a cocktail of PAb to recombinant fusion protein of two or three distinct viruses.