Papaya Leaf Distortion Mosaic Virus Research Articles

An efficient papaya leaf distortion mosaic potyvirus vector for virus-induced gene silencing in papaya

Papaya (Carica papaya L.) is regarded as an excellent model for genomic studies of tropical trees because of its short generation time and its small genome that has been sequenced. However, functional genomic studies in papaya depend on laborious genetic transformations because no rapid tools exist for this species. Here, we developed a highly efficient virus-induced gene silencing (VIGS) vector for use in papaya by modifying an artificially attenuated infectious clone of papaya leaf distortion mosaic virus (PLDMV; genus: Potyvirus), PLDMV-E, into a stable Nimble Cloning (NC)-based PLDMV vector, pPLDMV-NC, in Escherichia coli. The target fragments for gene silencing can easily be cloned into pPLDMV-NC without multiple digestion and ligation steps. Using this PLDMV VIGS system, we silenced and characterized five endogenous genes in papaya, including two common VIGS marker genes, namely, phytoene desaturase, Mg-chelatase H subunit, putative GIBBERELLIN (GA)-INSENSITIVE DWARF1A and 1B encoding GA receptors; and the cytochrome P450 gene CYP83B1, which encodes a key enzyme involved in benzylglucosinolate biosynthesis. The results demonstrate that our newly developed PLDMV VIGS vector is a rapid and convenient tool for functional genomic studies in papaya.

Genetic diversity analysis of papaya leaf distortion mosaic virus isolates infecting transgenic papaya "Huanong No. 1" in South China.

The commercialized genetically modified papaya “Huanong No. 1” has been utilized to successfully control the destructive virus‐papaya ringspot virus (PRSV) in South China since 2006. However, another new emerging virus, papaya leaf distortion mosaic virus (PLDMV), was found in some PRSV‐resistant transgenic plants in Guangdong and Hainan provinces of South China through a field investigation from 2012 to 2019. The survey results showed that “Huanong No. 1” papaya plants are susceptible to PLDMV, and the disease prevalence in Hainan Province is generally higher than that in Guangdong Province. Twenty representative isolates were selected to inoculate “Huanong No. 1,” and all of the inoculated plants showed obvious disease symptoms similar to those in the field, indicating that PLDMV is a new threat to widely cultivated transgenic papaya in South China. Phylogenetic analysis of 111 PLDMV isolates in Guangdong and Hainan based on the coat protein nucleotide sequences showed that PLDMV isolates can be divided into two groups. The Japan and Taiwan China isolates belong to group I, whereas the Guangdong and Hainan isolates belong to group II and can be further divided into two subgroups. The Guangdong and Hainan isolates are far different from the Japan and Taiwan China isolates and belong to a new lineage. Further analysis showed that the Guangdong and Hainan isolates had a high degree of genetic differentiation, and no recombination was found. These isolates deviated from neutral evolution and experienced population expansion events in the past, which might still be unstable. The results of this study provide a theoretical basis for clarifying the evolutionary mechanism and population genetics of the virus and for preventing and controlling the viral disease.

Gene expression profiling of papaya (Carica papaya L.) immune response induced by CTS-N after inoculating PLDMV.

Plant immune regulation is a defensive strategy of plants for protection against pathogen invasion, and Chitosan-N (CTS-N) can induce plant autoimmunity regulation mechanisms. CTS-N was found to induce an immunomodulatory response in papaya against Papaya leaf-distortion mosaic virus (PLDMV). To date, the gene expression profile of CTS-N-induced papaya immunomodulatory response has not been reported. Here, the transcriptional map of papaya leaf genes were subjected to three treatments, viz., non-viral inoculation without CTS-N treatment (CK), virus inoculation without CTS-N treatment (CG), and virus inoculation of 1g/L treatment (B). These were studied by pot culture experiment. Comparison of the B group with the CG group revealed 732 upregulated and 510 downregulated genes. Comparison of the CG group with the CK group revealed 909 upregulated and 1024 downregulated genes. To determine gene function, gene ontology (GO) analysis was performed, where 480 biological process genes, 256 molecular function genes, and 343 cell composition genes were differentially expressed. Kyoto Encyclopedia of Genes and Genomes (KEGG) results revealed that the top three pathways were phenylpropane biosynthesis, starch and sucrose metabolism, and plant hormone signal transduction. Real-time Quantitative PCR (qPCR) results were consistent with the transcriptome results, with a correlation coefficient of 0.87. The results of the transcriptional group showed that genes associated with plant resistance were induced by CTS-N-treatment in papaya. The chitinase gene was related to the plant disease process. Related genes in plant hormone signal transduction pathways are associated with plant resistance, and six differentially expressed genes were correlated with enhanced immune resistance in papaya.

A Double Mutation in the Conserved Motifs of the Helper Component Protease of Papaya Leaf Distortion Mosaic Virus for the Generation of a Cross-Protective Attenuated Strain.

Potyviral helper component protease (HC-Pro), as a major determinant of symptom expression in susceptible plants, is a likely target candidate in the production of attenuated strains for cross-protection. In this study, single or double mutations of Lys (K) to Glu (E) in the Lys-Ile-Thr-Cys motif and Arg (R) to Ile (I) in the Phe-Arg-Asn-Lys motif of the HC-Pro from the severe papaya leaf distortion mosaic virus strain DF (PLDMV-DF) reduced symptom expression and virus accumulation in infected papaya (Carica papaya) plants. The papaya plants infected with the attenuated double mutant of PLDMV-EI presented as symptomless. PLDMV-EI provided effective protection against PLDMV-DF infection in three papaya cultivars and had no effect on plant growth and development. Our result showed that PLDMV-EI is a promising mild strain for the practical use of cross-protection in the field.

Thladiantha Dubia Mosaic Virus: A Novel Potyvirus Infecting Manchurian Tubergourd (Thladiantha dubia) in Northeast China.

A new virus with flexuous, filamentous particles approximately 650 nm long was discovered in Manchurian tubergourd (Thladiantha dubia Bunge) leaves exhibiting severe mosaic symptoms. The whole genome sequence of the virus was determined by reverse transcription-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). The entire genome consisted of 10,112 nucleotides (nt) excluding the poly (A) tail, which shared the highest nucleotide sequence identity (73.8%) with that of papaya leaf distortion mosaic virus Hainan-DF isolate (PLDMV-Hainan-DF). A phylogenetic analysis showed that this virus clustered with PLDMV isolates in a subbranch within the potyviral clade. Of the 23 species of indicator plants tested, only potato and its original host were systemically infected by the virus tested upon mechanical inoculation. A field survey showed that the virus was widely distributed on T. dubia and potatoes in Northeast China. Moreover, this virus displayed a high degree of genetic variation as evaluated by the sequences of the coat protein (CP) gene. Based on these results, the name Thladiantha dubia mosaic virus (ThDMV) is proposed for this new potyvirus.

Profile of siRNAs derived from green fluorescent protein (GFP)-tagged Papaya leaf distortion mosaic virus in infected papaya plants.

We used green fluorescent protein (GFP)-tagged Papaya leaf distortion mosaic virus (PLDMV-GFP) to track PLDMV infection by fluorescence. The virus-derived small interfering RNAs (vsiRNAs) of PLDMV-GFP were characterized from papaya plants by next-generation sequencing. The foreign GFP gene inserted into the PLDMV genome was also processed as a viral gene into siRNAs by components involved in RNA silencing. The siRNAs derived from PLDMV-GFP accumulated preferentially as 21- and 22-nucleotide (nt) lengths, and most of the 5'-terminal ends were biased towards uridine (U) and adenosine (A). The single-nucleotide resolution map revealed that vsiRNAs were heterogeneously distributed throughout the PLDMV-GFP genome, and vsiRNAs derived from the sense strand were more abundant than those from the antisense strand. The hotspots were mainly distributed in the P1 and GFP coding region of the antisense strand. In addition, 979 papaya genes targeted by the most abundant 1000 PLDMV-GFP vsiRNAs were predicted and annotated using GO and KEGG classification. Results suggest that vsiRNAs play key roles in PLDMV-papaya interactions. These data on the characterization of PLDMV-GFP vsiRNAs will help to provide insight into the function of vsiRNAs and their host target regulation patterns.

Two agroinfection-compatible fluorescent protein-tagged infectious cDNA clones of papaya leaf distortion mosaic virus facilitate the tracking of virus infection.

Papaya leaf distortion mosaic virus (PLDMV, the genus Potyvirus) is an emerging threat to papaya production. Here, agroinfection-compatible fluorescent protein-tagged PLDMV infectious cDNA clones driven by the Cauliflower mosaic virus 35S promoter were successfully constructed using one-step Gibson assembly. The clones were directly transformed into Agrobacterium tumefaciens to prevent potential problems such as plasmid instability during propagation in Escherichia coli. Ninety-five percent of papaya seedlings infected with PLDMV-GFP or PLDMV-mCherry developed systemic symptoms typical of those caused by wild-type PLDMV. Green and mCherry red fluorescence was observed in leaves, stems, and roots of infected papaya plants. The fluorescent protein-tagged agroinfectious PLDMV cDNA clones were stable in papaya for more than 90 days and during six serial passages at 30-day intervals. The availability of these infectious clones will contribute to research on PLDMV-host interactions and can be applied in the papaya breeding program for PLDMV resistance.

Generation of stable infectious clones of plant viruses by using Rhizobium radiobacter for both cloning and inoculation

A novel Rhizobium radiobacter (synonym Agrobacterium tumefaciens)-mediated approach was developed to generate stable infectious clones of plant viruses. This method uses R. radiobacter for both cloning and inoculation of infectious clones, bypassing the requirement of cloning in E. coli to avoid the instability. Only three steps are included in this method: (i) construct viral genome-encoding plasmids in vitro by one-step Gibson assembly; (ii) transform the assembled DNA products into R. radiobacter; (iii) inoculate plants with the R. radiobacter clones containing the viral genome. Stable infectious clones were obtained from two potyviruses papaya ringspot virus (PRSV) and papaya leaf distortion mosaic virus (PLDMV) using this method, whereas attempts utilizing "classical" E. coli cloning system failed repeatedly. This method is simple and efficient, and is promising for a wide application in generation of infectious clones of plant virus, especially for those which are instable in E. coli.

Update on gene transfer biotechnology of papaya

Papaya ringspot virus (PRSV) is the most devastating disease of papayas worldwide. For 15 years, since 1998, genetically engineered, PRSV resistant Hawaii papayas, 'Rainbow', 'SunUp', and 'Laie Gold' have been sold locally and 'Rainbow' has been exported to the western US. Following deregulation, it has been exported for eight years to Canada and for three years, on a very small scale, to Japan. Markets like Hong Kong that do not differentiate between non-transgenic products and genetically engineered organisms (GMOs) also import Hawaii GMO papayas. At least fifteen research groups attempted to develop GMO papayas, mostly for PRSV resistance. A majority of the papayas were resistant to their specific PRSV strains; however at least initially China is the only other country to have commercialized transgenic virus resistant papaya. Activity in GMO projects is reduced because of negative publicity and lack of funding, but several projects continue: delayed ripening in Malaysia and the Philippines (field testing); PRSV and Papaya leaf distortion mosaic virus (PLDMV) broad resistance with single, double, and super-constructs in Taiwan; PRSV resistance construct development in Pune, India; multiplication of transgenic plants for PRSV resistance testing in Hainan, China; transformation of papaya for PRSV resistance with a gene from a papaya relative, Vasconcellea pubescens; and the final stages of deregulation of a second PRSV resistant papaya for Florida in the US.

Development of plants resistant to Papaya leaf distortion mosaic virus by intergeneric hybridization between Carica papaya and Vasconcellea cundinamarcensis.

In this study, we confirmed that Vasconcellea cundinamarcensis resists Papaya leaf distortion mosaic virus (PLDMV), and used it to produce intergeneric hybrids with Carica papaya. From the cross between C. papaya and V. cundinamarcensis, we obtained 147 seeds with embryos. Though C. papaya is a monoembryonic plant, multiple embryos were observed in all 147 seeds. We produced 218 plants from 28 seeds by means of embryo-rescue culture. All plants had pubescence on their petioles and stems characteristic of V. cundinamarcensis. Flow cytometry and PCR of 28 plants confirmed they were intergeneric hybrids. To evaluate virus resistance, mechanical inoculation of PLDMV was carried out. The test showed that 41 of 134 intergeneric hybrid plants showed no symptoms and were resistant. The remaining 93 hybrids showed necrotic lesions on the younger leaves than the inoculated leaves. In most of the 93 hybrids, the necrotic lesions enclosed the virus and prevented further spread. These results suggest that the intergeneric hybrids will be valuable material for PLDMV-resistant papaya breeding.

Rapid Construction of Stable Infectious Full-Length cDNA Clone of Papaya Leaf Distortion Mosaic Virus Using In-Fusion Cloning.

Papaya leaf distortion mosaic virus (PLDMV) is becoming a threat to papaya and transgenic papaya resistant to the related pathogen, papaya ringspot virus (PRSV). The generation of infectious viral clones is an essential step for reverse-genetics studies of viral gene function and cross-protection. In this study, a sequence- and ligation-independent cloning system, the In-Fusion® Cloning Kit (Clontech, Mountain View, CA, USA), was used to construct intron-less or intron-containing full-length cDNA clones of the isolate PLDMV-DF, with the simultaneous scarless assembly of multiple viral and intron fragments into a plasmid vector in a single reaction. The intron-containing full-length cDNA clone of PLDMV-DF was stably propagated in Escherichia coli. In vitro intron-containing transcripts were processed and spliced into biologically active intron-less transcripts following mechanical inoculation and then initiated systemic infections in Carica papaya L. seedlings, which developed similar symptoms to those caused by the wild-type virus. However, no infectivity was detected when the plants were inoculated with RNA transcripts from the intron-less construct because the instability of the viral cDNA clone in bacterial cells caused a non-sense or deletion mutation of the genomic sequence of PLDMV-DF. To our knowledge, this is the first report of the construction of an infectious full-length cDNA clone of PLDMV and the splicing of intron-containing transcripts following mechanical inoculation. In-Fusion cloning shortens the construction time from months to days. Therefore, it is a faster, more flexible, and more efficient method than the traditional multistep restriction enzyme-mediated subcloning procedure.

Molecular Identification and Diversity Analysis of Papaya Mosaic Viruses in Hainan Province

Papaya ring spot virus( PRSV) and Papaya leaf-distortion mosaic virus( PLDMV) are dominant viruses causing papaya leaf mosaic disease in tropical and subtropical regions,threatening papaya planting industry. In this study,27 suspected papaya leaf mosaic disease samples were collected and identified from Sanya,Ledong,Wanning and Qionghai in Hainan province. Total RNA from leaves was extracted and used for reverse transcription to obtain the corresponding cDNAs. Gene-specific primers were designed according to CP,P1,Hc-Pro and NIb gene nucleotide sequences from PRSV genome and CP gene nucleotide sequences from PLDMV genome. By PCR and sequencing,20 PRSV-infected samples(74. 1%),3 PLDMV-infected samples(11.1%) and 1 PRSV-PLDMV cross-infected sample(3.7%) were identified. Phylogeny analysis showed that3 PRSV varieties were existed in Hainan province with high strain differentiation,whereas,PLDMV varieties in Hainan province had a common origin with PLDMV varieties from Taiwan and Japan. The results showed that PRSV and PLDMV were dominant papaya mosaic viruses in Hainan,and the homology was below 95% during 3PRSV varieties. This study would contribute to the subsequent construction of bivalent expression vector that could resist both PRSV and PLDMV viruses.

FIRST REPORT OF MIXED INFECTION OF PAPAYA RINGSPOT VIRUS AND PAPAYA LEAF DISTORTION MOSAIC VIRUS ON CARICA PAPAYA L.

Papaya ringspot virus (PRSV) and Papaya leaf distortion mosaic virus (PLDMV) from the family Potyviridae produce similar symptoms in papaya such as foliar mosaic, ringspots and distortion, water soaking streaks on petioles, and ringspots on fruit. PRSV is the most widespread and destructive viral disease damaging papaya production in the world, whereas PLDMV was recently identified in China (Tuo et al., 2013). In March 2014, 23 papaya trees displaying disease symptoms similar to those of PRSV or PLDMV were observed in Haikou (Hainan Island, China). Six samples were co-infected with PRSV and PLDMV, as shown by DAC-ELISA with antisera to PRSV or PLDMV. Mixed infection was subsequently confirmed by RT-PCR using PRSV-specific primers designed in a highly conserved region of gene P3 (P3-F, 5′TTGTGTACGACTTCTCACCGAA3′ and P3-R, 5′CGAATGTCATCCAAAGACT GATGATAAAC3′) and PLDMV-specific primers designed in a highly conserved region of the coat protein (CP) gene (CP-F, 5′GGCATGTGGTTTATGATGCAAGG G3′ and CP-R, 5′GCTCCGTGTTCTCAGTCGCATT3′). DNA fragments of the expected size (613 and 355 bp, respectively) were amplified from each mixed infected sample using PRSV and PLDMV-specific primers, and then cloned and sequenced. BLASTn analysis of the nucleotide sequences obtained from the cloned PCR products showed 99% identity with a PRSV isolate from Hainan (GenBank accession No. EF183499) and 100% identity with a PLDMV isolate from Hainan (GenBank accession no. JX974555) (Lu et al., 2008; Tuo et al., 2013). To our knowledge, this is the first report of mixed infection of PRSV and PLDMV on papaya, prompting the need for evaluating the potential threat of the mixed virus infection to papaya production.

Development and validation of a multiplex reverse transcription PCR assay for simultaneous detection of three papaya viruses.

Papaya ringspot virus (PRSV), Papaya leaf distortion mosaic virus (PLDMV), and Papaya mosaic virus (PapMV) produce similar symptoms in papaya. Each threatens commercial production of papaya on Hainan Island, China. In this study, a multiplex reverse transcription PCR assay was developed to detect simultaneously these three viruses by screening combinations of mixed primer pairs and optimizing the multiplex RT-PCR reaction conditions. A mixture of three specific primer pairs was used to amplify three distinct fragments of 613 bp from the P3 gene of PRSV, 355 bp from the CP gene of PLDMV, and 205 bp from the CP gene of PapMV, demonstrating the assay’s specificity. The sensitivity of the multiplex RT-PCR was evaluated by showing plasmids containing each of the viral target genes with 1.44 × 103, 1.79 × 103, and 1.91 × 102 copies for the three viruses could be detected successfully. The multiplex RT-PCR was applied successfully for detection of three viruses from 341 field samples collected from 18 counties of Hainan Island, China. Rates of single infections were 186/341 (54.5%), 93/341 (27.3%), and 3/341 (0.9%), for PRSV, PLDMV, and PapMV, respectively; 59/341 (17.3%) of the samples were co-infected with PRSV and PLDMV, which is the first time being reported in Hainan Island. This multiplex RT-PCR assay is a simple, rapid, sensitive, and cost-effective method for detecting multiple viruses in papaya and can be used for routine molecular diagnosis and epidemiological studies in papaya.

Reverse transcription loop-mediated isothermal amplification assay for rapid detection of Papaya ringspot virus

Papaya ringspot virus (PRSV) and Papaya leaf distortion mosaic virus (PLDMV), which causes disease symptoms similar to PRSV, threaten commercial production of both non-transgenic-papaya and PRSV-resistant transgenic papaya in China. A reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay to detect PLDMV was developed previously. In this study, the development of another RT-LAMP assay to distinguish among transgenic, PRSV-infected and PLDMV-infected papaya by detection of PRSV is reported. A set of four RT-LAMP primers was designed based on the highly conserved region of the P3 gene of PRSV. The RT-LAMP method was specific and sensitive in detecting PRSV, with a detection limit of 1.15×10−6μg of total RNA per reaction. Indeed, the reaction was 10 times more sensitive than one-step RT-PCR. Field application of the RT-LAMP assay demonstrated that samples positive for PRSV were detected only in non-transgenic papaya, whereas samples positive for PLDMV were detected only in commercialized PRSV-resistant transgenic papaya. This suggests that PRSV remains the major limiting factor for non-transgenic-papaya production, and the emergence of PLDMV threatens the commercial transgenic cultivar in China. However, this study, combined with the earlier development of an RT-LAMP assay for PLDMV, will provide a rapid, sensitive and cost-effective diagnostic power to distinguish virus infections in papaya.

Detection of Papaya leaf distortion mosaic virus by reverse-transcription loop-mediated isothermal amplification

Papaya leaf distortion mosaic virus (PLDMV) can infect transgenic papaya resistant to a related pathogen, Papaya ringspot virus (PRSV), posing a substantial threat to papaya production in China. Current detection methods, however, are unable to be used for rapid detection in the field. Here, a reverse-transcription loop-mediated isothermal amplification (RT-LAMP) assay was developed for the detection of PLDMV, using a set of four RT-LAMP primers designed based on the conserved sequence of PLDMV CP. The RT-LAMP method detected specifically PLDMV and was highly sensitive, with a detection limit of 1.32×10−6μg of total RNA per reaction. Indeed, the reaction was 10 times more sensitive than one-step RT-PCR, while also requiring significantly less time and equipment. The effectiveness of RT-LAMP and one-step RT-PCR in detecting the virus were compared using 90 field samples of non-transgenic papaya and 90 field samples of commercialized PRSV-resistant transgenic papaya from Hainan Island. None of the non-transgenic papaya tested positive for PLDMV using either method. In contrast, 19 of the commercialized PRSV-resistant transgenic papaya samples tested positive by RT-LAMP assay, and 6 of those tested negative by RT-PCR. Therefore, the PLDMV-specific RT-LAMP is a simple, rapid, sensitive, and cost-effective tool in the field diagnosis and control of PLDMV.

Complete genome sequence of an isolate of papaya leaf distortion mosaic virus from commercialized PRSV-resistant transgenic papaya in China

Papaya leaf distortion mosaic virus is highly destructive to commercial papaya production. Here, the complete genome sequence was determined for an isolate of papaya leaf distortion mosaic virus, designated PLDMV-DF, infecting the commercialized papaya ringspot virus (PRSV)-resistant transgenic papaya from China. Excluding the 3'-poly (A) tail, the sequence shares high sequence identity to several PLDMV isolates from Taiwan and Japan and is phylogenetically most closely related to the isolate from Japan. Infection of PLDMV-DF in transgenic PRSV-resistant papaya may indicate emergence of this disease in genetically engineered plants. The reported sequence for this isolate may help generate bi-transgenic papaya resistant to PRSV and PLDMV.

The impact of transgenic papaya (TPY10-4) fruit supplementation on immune responses in ovalbumin-sensitised mice

A transgenic papaya line (TPY10-4) that is resistant to both papaya ringspot virus (PRSV) and papaya leaf distortion mosaic virus (PLDMV) has been developed in Taiwan. This study investigated the immunomodulatory properties of transgenic TPY10-4 and its native (TCK) papaya fruits using an ovalbumin (OVA)-sensitised mouse model. Both green and ripe papaya fruits at low (0.2 g powder kg(-1) body weight (BW)) and high (1.6 g powder kg(-1) BW) doses were administered to experimental mice by intragastric gavage for 5 weeks. Changes in serum total immunoglobulin A (IgA), IgE, IgG and IgM levels, OVA-specific IgE, IgG1 and IgG2a titres and Th1/Th2 cytokine secretions using splenocytes were determined. Transgenic TPY10-4 or native TCK papaya fruit supplementation did not significantly affect body, visceral organ and relative tissue weights, total IgE antibody levels, OVA-specific IgE and IgG1 antibody titres or OVA-stimulated interferon-γ (IFN-γ), interleukin-2 (IL-2), IL-4, IL-5 and IL-10 secretions using splenocytes. However, transgenic papaya fruits markedly increased serum total IgM levels. This study suggests that transgenic TPY10-4 papaya fruits do not increase the allergenic potential of OVA by oral administration but may have a protective immunity via increasing the serum total IgM level.

Generation of hermaphrodite transgenic papaya lines with virus resistance via transformation of somatic embryos derived from adventitious roots of in vitro shoots

Papaya production is seriously limited by Papaya ringspot virus (PRSV) worldwide and Papaya leaf-distortion mosaic virus (PLDMV) in Eastern Asia. An efficient transformation method for developing papaya lines with transgenic resistance to these viruses and commercially desirable traits, such as hermaphroditism, is crucial to shorten the breeding program for this fruit crop. In this investigation, an untranslatable chimeric construct pYP08 containing truncated PRSV coat protein (CP) and PLDMV CP genes coupled with the 3' untranslational region of PLDMV, was generated. Root segments from different portions of adventitious roots of in vitro multiple shoots of hermaphroditic plants of papaya cultivars 'Tainung No. 2', 'Sunrise', and 'Thailand' were cultured on induction medium for regeneration into somatic embryos. The highest frequency of somatic embryogenesis was from the root-tip segments of adventitious roots developed 2-4 weeks after rooting in perlite medium. After proliferation, embryogenic tissues derived from somatic embryos were wounded in liquid-phase by carborundum and transformed by Agrobacterium carrying pYP08. Similarly, another construct pBG-PLDMVstop containing untranslatable CP gene of PLDMV was also transferred to 'Sunrise' and 'Thailand', the parental cultivars of 'Tainung No. 2'. Among 107 transgenic lines regenerated from 349 root-tip segments, nine lines of Tainung No. 2 carrying YP08 were highly resistant to PRSV and PLDMV, and 9 lines (8 'Sunrise' and 1 'Thailand') carrying PLDMV CP highly resistant to PLDMV, by a mechanism of post-transcriptional gene silencing. The hermaphroditic characteristics of the transgenic lines were confirmed by PCR with sex-linked primers and phenotypes of flower and fruit. Our approach has generated transgenic resistance to both PRSV and PLDMV with commercially desirable characters and can significantly shorten the time-consuming breeding programs for the generation of elite cultivars of papaya hybrids.

Generation of Transgenic Papaya with Double Resistance to Papaya ringspot virus and Papaya leaf-distortion mosaic virus

During the field tests of coat protein (CP)-transgenic papaya lines resistant to Papaya ringspot virus (PRSV), another Potyvirus sp., Papaya leaf-distortion mosaic virus (PLDMV), appeared as an emerging threat to the transgenic papaya. In this investigation, an untranslatable chimeric construct containing the truncated CP coding region of the PLDMV P-TW-WF isolate and the truncated CP coding region with the complete 3' untranslated region of PRSV YK isolate was transferred into papaya (Carica papaya cv. Thailand) via Agrobacterium-mediated transformation to generate transgenic plants with resistance to PLDMV and PRSV. Seventy-five transgenic lines were obtained and challenged with PRSV YK or PLDMV P-TW-WF by mechanical inoculation under greenhouse conditions. Thirty-eight transgenic lines showing no symptoms 1 month after inoculation were regarded as highly resistant lines. Southern and Northern analyses revealed that four weakly resistant lines have one or two inserts of the construct and accumulate detectable amounts of transgene transcript, whereas nine resistant lines contain two or three inserts without significant accumulation of transgene transcript. The results indicated that double virus resistance in transgenic lines resulted from double or more copies of the insert through the mechanism of RNA-mediated posttranscriptional gene silencing. Furthermore, three of nine resistant lines showed high levels of resistance to heterologous PRSV strains originating from Hawaii, Thailand, and Mexico. Our transgenic lines have great potential for controlling a number of PRSV strains and PLDMV in Taiwan and elsewhere.