Pantoea Ananatis Research Articles

Detection and Molecular Diversity of Pantoea ananatis Associated with White Spot Disease in Maize, Sorghum and Crabgrass in Brazil

AbstractBacteria of the genus Pantoea have become important plant pathogens worldwide in recent years. Pantoea ananatis was reported as the cause of maize white spot, a serious maize disease in Brazil, causing significant yield losses. However, very little information is available about how to detect this pathogen, its genetic variability and the putative alternative hosts in maize‐growing areas. To address these issues, we implemented a rapid and efficient PCR‐based method to identify P. ananatis isolated from leaves showing white spot symptoms and evaluated its genetic diversity in maize, sorghum and crabgrass. Of the 29 bacteria isolated from typical water‐soaked lesions of white spot disease that produced yellow colonies, 15 isolates were identified as P. ananatis by 16S rDNA sequencing and correctly detected by the PCR reaction, amplifying a specific fragment of the ice nucleation gene (ina). These P. ananatis isolates included 13 from maize, one from sorghum and one from crabgrass, while the other 14 yellow colony isolates were from other bacterial species, including two Pantoea species (Pantoea dispersa and Pantoea agglomerans) that were not amplified by the ina primers. These results indicate that the optimized PCR assay can be used to detect P. ananatis isolated from white spot lesions and could be used as a large‐scale and cost‐effective method of detecting this pathogen in leaf lesions on maize and other grasses. All isolates were evaluated for hypersensitive response (HR) on tobacco, revealing that some P. ananatis were able to induce HR. The high genetic variability revealed by rep‐PCR did not differentiated the P. ananatis isolates based on their hosts or HR reaction. The detection, characterization and diversity of P. ananatis from maize, sorghum and crabgrass in our study can be applied in understanding epidemiology and designing control strategies for maize white spot disease in Brazil.

Pantoea ananatis as a Cause of Corneal Infiltrate after Rice Husk Injury

We report a case of an agricultural worker presenting with corneal infiltrate following ocular injury with a rice husk. On examination, a superficial corneal foreign body was removed and sent for culture, which grew Pantoea ananatis. This is, to our knowledge, the first clinical case report of Pantoea ananatis causing corneal infiltrate.

Molecular and culture-dependent analyses revealed similarities in the endophytic bacterial community composition of leaves from three rice (Oryza sativa) varieties

The endophytic bacterial communities of the three most important rice varieties cultivated in Uruguay were compared by a multiphasic approach. Leaves of mature plants grown in field experiments for two consecutive crop seasons were studied. No significant differences were found in the heterotrophic bacterial density for the three varieties. Pantoea ananatis and Pseudomonas syringae constituted 51% of the total of the isolates. These species were always present regardless of the variety or the season. Molecular analysis based on the 16S rRNA gene was performed by terminal restriction fragment length polymorphism (T-RFLP) and cloning. T-RFLP analysis revealed that bacterial communities grouped according to the variety, although the three varieties presented communities that showed 74% or higher similarities. Brevundimonas, the dominant genus in the clone library (18% of the clones), which might be present in all varieties according to T-RFLP profiles, was not recovered by cultivation. Conversely, bacteria from the genus Pseudomonas were not detected in the clone library. These results indicate that communities established in leaves of physiologically different rice varieties were highly similar and composed by a reduced group of strongly associated and persistent bacteria that were partially recovered by cultivation.

Biochemical characterization of l-arabitol 2-dehydrogenase from Pantoea ananatis

Two oxidoreductases, XDH and LAD, were found in the same operon that was involved in sugar metabolism in Pantoea ananatis. LAD, whose endogenous substrate was unknown, was recombinantly prepared and biochemically analyzed. Consequently, LAD was identified as l-arabitol 2-dehydrogenase and its substrate specificity was complementary to that of XDH.

Isolation of mesotrione-degrading bacteria from aquatic environments in Brazil

Mesotrione is a benzoylcyclohexane-1,3-dione herbicide that inhibits 4-hydroxyphenyl pyruvate dioxygenase in target plants. Although it has been used since 2000, only a limited number of degrading microorganisms have been reported. Mesotrione-degrading bacteria were selected among strains isolated from Brazilian aquatic environments, located near corn fields treated with this herbicide. Pantoea ananatis was found to rapidly and completely degrade mesotrione. Mesotrione did not serve as a sole C, N, or S source for growth of P. ananatis, and mesotrione catabolism required glucose supplementation to minimal media. LC–MS/MS analyses indicated that mesotrione degradation produced intermediates other than 2-amino-4-methylsulfonyl benzoic acid or 4-methylsulfonyl-2-nitrobenzoic acid, two metabolites previously identified in a mesotrione-degrading Bacillus strain. Since P. ananatis rapidly degraded mesotrione, this strain might be useful for bioremediation purposes.

Draft Genome Sequence of Pantoea ananatis B1-9, a Nonpathogenic Plant Growth-Promoting Bacterium

Pantoea ananatis B1-9 is an endophytic Gram-negative rhizobacterium that was isolated for its ability to promote plant growth and improve crop yield in the field. Here we report the draft genome sequence of P. ananatis B1-9. Comparison of this sequence to the sequenced genome of a plant-pathogenic P. ananatis strain, LMG20103, indicated that the pathogenesis-related genes were absent, but a subset of gene functions that may be related to its plant growth promotion were present.

Identification and elimination of bacterial contamination during in vitro propagation of Guadua angustifolia Kunth

Background:Guadua angustifolia Kunth is a very important bamboo species with significant utility in pharmaceutical, paper, charcoal, and construction industries. Microbial contamination is a major problem encountered during establishment of in vitro cultures of Guadua.Objective:This study has been designed to analyze the identity of contaminating bacteria and to develop the strategy to eliminate them during micropropagation of Guadua.Materials and Methods:We isolated and consequently analyzed partial sequence analysis of the 16S rRNA gene to identify two contaminating bacteria as (1) Pantoea agglomerans and (2) Pantoea ananatis. In addition, we also- performed antibiotic sensitivity testing on these bacterial isolates.Results:We identified kanamycin and streptomycin sulfate as potentially useful antibiotics in eliminating the contaminating bacteria. We grew shoots on multiplication medium containing BAP (2 mg/l) and adenine sulfate (10 mg/l) supplemented with kanamycin (10 μg/ml) for 10 days and transferred them to fresh medium without antibiotics and found that bacterial growth was inhibited. Moreover, we observed intensive formation of high-quality shoots. Streptomycin sulfate also inhibited bacterial growth but at higher concentration. We also demonstrated that shoots grown in streptomycin sulfate tended to be shorter and had yellow leaves.Conclusion:Thus, we have developed a novel strategy to identify and inhibit intriguing microbial contaminations of (1) Pantoea agglomerans and (2) Pantoea ananatis during establishment of in vitro cultures of Guadua. This would improve in vitro establishment of an important bamboo, Guadua angustifolia Kunth for large scale propagation.

Localization of selected pathogens of cotton within the southern green stink bug

Southern green stink bugs, Nezara viridula (L.) (Hemiptera: Pentatomidae), are pests of cotton recently shown to ingest, retain, and introduce some pathogens of cotton into bolls. The objective of this study was to determine where pathogen colonization occurs in N. viridula after ingestion. Laboratory-reared adult N. viridula were fed sterile green beans soaked in water (control) or beans previously soaked in a suspension of one of three opportunistic bacterial pathogens [Pantoea agglomerans (Ewing & Fife), Pantoea ananatis (Serrano) Truper & De’Clari, or Klebsiella pneumoniae (Schroeter)] or a yeast [Nematospora coryli (Peglion)]. The insect rostrum, head, and alimentary canal were subsequently processed to determine the presence of pathogenic organisms. Overall, the alimentary canal exhibited significantly more bacterial colony forming units per g tissue (mean ± SEM = 4 806.3 ± 397.2) than the head (443.4 ± 397.2) and rostrum (46.0 ± 397.2); concentrations in the head and rostrum did not differ significantly. All four pathogens were detected in the alimentary canal, but only P. agglomerans and N. coryli were detected in the rostrum and head. Although P. ananatis and K. pneumoniae were only detected in the alimentary canal, their ranges of concentrations were similar to those of P. agglomerans and N. coryli in this tissue. Non-selective media indicated that other bacterial fauna was also detected in all study insects. Thus, N. viridula does not discriminate with regard to ingestion of pathogens. The observed distribution pattern of tested bacteria and yeast in certain tissues of N. viridula clarifies the propensity for transmission of P. agglomerans and N. coryli. Results are discussed in relation to future research avenues examining selective colonization of certain pathogens and frequency of host infection by adults harboring the pathogenic organisms.

The complete genome sequence of Pantoea ananatis AJ13355, an organism with great biotechnological potential

Pantoea ananatis AJ13355 is a newly identified member of the Enterobacteriaceae family with promising biotechnological applications. This bacterium is able to grow at an acidic pH and is resistant to saturating concentrations of L-glutamic acid, making this organism a suitable host for the production of L-glutamate. In the current study, the complete genomic sequence of P. ananatis AJ13355 was determined. The genome was found to consist of a single circular chromosome consisting of 4,555,536 bp [DDBJ: AP012032] and a circular plasmid, pEA320, of 321,744 bp [DDBJ: AP012033]. After automated annotation, 4,071 protein-coding sequences were identified in the P. ananatis AJ13355 genome. For 4,025 of these genes, functions were assigned based on homologies to known proteins. A high level of nucleotide sequence identity (99%) was revealed between the genome of P. ananatis AJ13355 and the previously published genome of P. ananatis LMG 20103. Short colinear regions, which are identical to DNA sequences in the Escherichia coli MG1655 chromosome, were found to be widely dispersed along the P. ananatis AJ13355 genome. Conjugal gene transfer from E. coli to P. ananatis, mediated by homologous recombination between short identical sequences, was also experimentally demonstrated. The determination of the genome sequence has paved the way for the directed metabolic engineering of P. ananatis to produce biotechnologically relevant compounds. Electronic supplementary materialThe online version of this article (doi:10.1007/s00253-011-3713-5) contains supplementary material, which is available to authorized users.

A New Leaf Blight of Rice Caused by Pantoea ananatis in India.

In September 2008, a new blight disease appeared on basmati rice (Oryza sativa L.) in fields in the northern states of India, including Uttar Pradesh, Haryana, and Punjab. First symptoms were water-soaked lesions at the tip of rice leaves. Lesions eventually spread down the leaf blades. Infected leaves turned light brown, exhibiting a blighted appearance. The disease was severe during the post-flowering stage. From 2008 to 2011, yellow-pigmented bacteria were consistently recovered on nutrient agar (beef extract 5 g, peptone 10 g, NaCl 5 g, and agar 20 g) from symptomatic rice leaves. The disease was thought to be caused by Xanthomonas oryzae pv. oryzae, the rice bacterial blight pathogen. However, physiological and molecular analysis of two strains (ITCC B0050 and ITCC B0055) isolated in 2008 revealed that the causal agent was the bacterium Pantoea ananatis. Colonies, raised and translucent with smooth margins, grew well within 24 h at 37°C. The bacteria are gram-negative facultative anaerobes with small rods arranged singly or in a chain of two to five cells. The bacteria are positive for catalase and indole production while negative for oxidase and alkaline reaction in malonate broth. Electron microscopy shows that the bacterial cells were 1.1 to 2.3 × 0.4 to 0.7 μm and have three to six peritrichous flagella. 16S rRNA gene sequence (1,535 nt generated by PCR with primers 5'AGAGTTTGATCATGGCTCAG3' and 5'AAGGAGGTGATCCAACCGCA3') of ITCC B0050 and ITCC B0055 (GenBank Nos. JF756690 and JF756691, respectively) share 99%-nt identity with P. ananatis (GenBank No. DQ512490.1). Biolog microbial identification analysis (version 4.2) of both strains showed similarity indices of 0.842 with P. ananatis (Biolog Inc., Hayward, CA). Pathogenicity was confirmed by employing the leaf tip clipping method to inoculate susceptible basmati rice (cv. Pusa basmati 1). Leaves were inoculated in triplicate with sterile water or a 1 × 108 CFU ml-1 suspension of each isolate in water. The artificially inoculated rice leaves produced water-soaked lesions similar to that observed during natural rice infection in the field. At 10 to 15 days postinoculation, the lesions on the inoculated leaves dried and turned from straw color to light brown. Yellow-pigmented bacteria were reisolated from the infected rice leaves and their identity was confirmed to be identical to the original strain by 16S rRNA sequence analysis and Biolog analysis. Both pathogen isolates elicited hypersensitive reaction in tobacco (Nicotiana tabacum cv. Xanthi) leaves 24 to 48 h postinoculation (1 × 108 CFU ml-1). These studies indicate that the causal agent of the newly emerged rice leaf blight disease in northern India is P. ananatis. Pantoea spp. are opportunistic pathogens documented to cause different diseases in economically important crop plants including grain discoloration of rice in China (1), leaf blight and bulb decay of onion in the United States (2), and leaf blight of rice in Korea (3). To our knowledge, this is the first report of rice leaf blight caused by P. ananatis in India. The significance of this pathogen to basmati rice production in India was not known until this report. The predominance of the disease in the major basmati-growing belts of northern India would certainly have great impact in reducing the yield potential of basmati rice.

Cell aggregation is negatively regulated by N-acylhomoserine lactone-mediated quorum sensing in Pantoea ananatis SK-1

Pantoea ananatis SK-1 produces N-acylhomoserine lactones (AHLs) and regulates expression of some virulence factors through AHL-mediated quorum sensing. In this study, we discovered that the strain SK-02I, which has a disrupted AHL-synthetic gene, showed constitutive cell aggregation. SK-1 has the ability to aggregate, and cell aggregation inhibitory factors are expressed under control of AHL-mediated quorum sensing. One of the transposon mutants, SK-33M, constitutively aggregates without defective AHL production. A homology search revealed that the transposon integration site was located in the adhesin-like yeeJ gene. Based on RT-PCR analysis, transcription of yeeJ is regulated by AHL-mediated quorum sensing. However, because both the wild-type and SK-33M strains induced necrotic symptoms in onion leaves, we conclude that the yeeJ gene is not involved in the pathogenicity of SK-1.

Exopolysaccharide Production Is Influenced by Sugars,N-Acylhomoserine Lactone, and Transcriptional Regulators RcsA and RcsB, but Does Not Affect Pathogenicity in the Plant PathogenPantoea ananatis

Pantoea ananatis SK-1 produced EPS by AHL-mediated quorum sensing on an LB agar plate containing glucose, fructose, and sucrose. rcsA and rcsB mutants did not produce EPS with or without AHLs and with or without sugars, but they induced necrotic symptoms in onion leaves. These results indicate that EPS production does not relate to the pathogenicity of SK-1.

Engineering of a plasmid-free Escherichia coli strain for improved in vivo biosynthesis of astaxanthin

BackgroundThe xanthophyll astaxanthin is a high-value compound with applications in the nutraceutical, cosmetic, food, and animal feed industries. Besides chemical synthesis and extraction from naturally producing organisms like Haematococcus pluvialis, heterologous biosynthesis in non-carotenogenic microorganisms like Escherichia coli, is a promising alternative for sustainable production of natural astaxanthin. Recent achievements in the metabolic engineering of E. coli strains have led to a significant increase in the productivity of carotenoids like lycopene or β-carotene by increasing the metabolic flux towards the isoprenoid precursors. For the heterologous biosynthesis of astaxanthin in E. coli, however, the conversion of β-carotene to astaxanthin is obviously the most critical step towards an efficient biosynthesis of astaxanthin.ResultsHere we report the construction of the first plasmid-free E. coli strain that produces astaxanthin as the sole carotenoid compound with a yield of 1.4 mg/g cdw (E. coli BW-ASTA). This engineered E. coli strain harbors xanthophyll biosynthetic genes from Pantoea ananatis and Nostoc punctiforme as individual expression cassettes on the chromosome and is based on a β-carotene-producing strain (E. coli BW-CARO) recently developed in our lab. E. coli BW-CARO has an enhanced biosynthesis of the isoprenoid precursor isopentenyl diphosphate (IPP) and produces β-carotene in a concentration of 6.2 mg/g cdw. The expression of crtEBIY along with the β-carotene-ketolase gene crtW148 (NpF4798) and the β-carotene-hydroxylase gene (crtZ) under controlled expression conditions in E. coli BW-ASTA directed the pathway exclusively towards the desired product astaxanthin (1.4 mg/g cdw).ConclusionsBy using the λ-Red recombineering technique, genes encoding for the astaxanthin biosynthesis pathway were stably integrated into the chromosome of E. coli. The expression levels of chromosomal integrated recombinant biosynthetic genes were varied and adjusted to improve the ratios of carotenoids produced by this E. coli strain. The strategy presented, which combines chromosomal integration of biosynthetic genes with the possibility of adjusting expression by using different promoters, might be useful as a general approach for the construction of stable heterologous production strains synthesizing natural products. This is the case especially for heterologous pathways where excessive protein overexpression is a hindrance.

Identification of Pantoea ananatis gene encoding membrane pyrroloquinoline quinone (PQQ)-dependent glucose dehydrogenase and pqqABCDEF operon essential for PQQ biosynthesis

Pantoea ananatis accumulates gluconate during aerobic growth in the presence of glucose. Computer analysis of the P. ananatis SC17(0) sequenced genome revealed an ORF encoding a homologue (named gcd) of the mGDH (EC 1.1.99.17) apoenzyme from Escherichia coli and a putative pyrroloquinoline quinone (PQQ) biosynthetic operon homologous to pqqABCDEF from Klebsiella pneumoniae. Construction of Δgcd and Δpqq mutants of P. ananatis confirmed the proposed functions of these genetic elements. The P. ananatis pqqABCDEF was cloned in vivo and integrated into the chromosomes of P. ananatis and E. coli according to the Dual In/Out strategy. Introduction of a second copy of pqqABCDEF to P. ananatis SC17(0) doubled the accumulation of PQQ. Integration of the operon into E. coli MG1655ΔptsGΔmanXY restored the growth of bacteria on glucose. The obtained data show the essential role of pqqABCDEF in PQQ biosynthesis in P. ananatis and E. coli. We propose that the cloned operon could be useful for an efficient phosphoenolpyruvate-independent glucose consumption pathway due to glucose oxidation and construction of E. coli strains with the advantage of phosphoenolpyruvate-derived metabolite production.

A new record of the tobacco thrips Frankliniella fusca (Hinds) (Thysanoptera: Thripidae) from Japan

The tobacco thrips, Frankliniella fusca, which is known as a vector of TSWV and Pantoea ananatis causing center rot of onion, and a serious pest of tobacco, cotton and groundnuts in North America, is newly recorded from the bulbs of Narcissus pseudonarcissus in Honshu, mainland Japan. Two strains were found in Shimane Prefecture. One strain was collected from a bulb produced in Niigata Prefecture in the winter of 2002, and the other was collected from bulbs produced in Fukushima Prefecture in the autumn of 2002. F. fusca can be easily distinguished from other members of this genus in Japan.

Dynamics, Diversity and Function of Endophytic Siderophore-Producing Bacteria in Rice

Siderophore production confers to bacteria competitive advantages to colonize plant tissues and to exclude other microorganisms from the same ecological niche. This work shows that the community of endophytic siderophore-producing bacteria (SPB) associated to Oryza sativa cultivated in Uruguayan soils is dynamic and diverse. These bacteria were present in grains, roots, and leaves, and their density fluctuated between log(10) 3.44 and log(10) 5.52 cfu g(-1) fresh weight (fw) during the plant growth. Less than 10% of the heterotrophic bacteria produced siderophores in roots and leaves of young plants, but most of the heterotrophic bacteria were siderophore-producers in mature plants. According to their amplified restriction DNA ribosomal analysis (ARDRA) pattern, 54 of the 109 endophytic SPB isolated from different plant tissues or growth stages from replicate plots, were unique. Bacteria belonging to the genera Sphingomonas, Pseudomonas, Burkholderia, and Enterobacter alternated during plant growth, but the genus Pantoea was predominant in roots at tillering and in leaves at subsequent stages. Pantoea ananatis was the SPB permanently associated to any of the plant tissues, but the genetic diversity within this species-revealed by BOX-PCR fingerprinting- showed that different strains were randomly distributed along time and plant tissue, suggesting that a common trait of the species P. ananatis determined the interaction with the rice plant. Several isolates were stronger IAA producers than Azospirillum brasilense or Herbaspirillum seropedicae. In vitro inhibition assays showed that SPB of the genus Burkholderia were good antagonists of pathogenic fungi and that only one SPB isolate of the genus Pseudomonas was able to inhibit A. brasilense and H. seropedicae. These results denoted that SPB were selected into the rice plant. P. ananatis was the permanent and dominant associated species which was unable to inhibit two of the relevant plant growth-promoting bacteria.

First report of pathogenicity of Pantoea ananatis in sorghum (Sorghum bicolor) in Brazil

Bacterial isolates from sorghum plants showing leaf spot symptoms were identified through molecular and phenotypic traits, showing that the isolates belong to Pantoea ananatis. Sorghum plants inoculated with those isolates showed a pathogenic reaction. The causal agent was reisolated and Koch’s postulates were fulfilled. This is the first report of P. ananatis causing leaf spots on sorghum plants in Brazil.

FIRST REPORT OF PANTOEA ANANATIS ASSOCIATED WITH LEAF SPOT DISEASE OF MAIZE IN POLAND

Maize (Zea mays) is one of the most important crops in Poland. Its acreage and production have grown over the last ten years, also thanks to the increasing interest for the bioenergy sector in the country. Maize is used as a source of methanol and biomass, and for fodder. Studies on bacterial infections of maize are plentiful in the world literature, but not in Poland, were only two such reports exist. This prompted the present investigation, in which combined samples from plants growing in different Polish locations were tested. Leaf samples were collected from plants displaying symptoms resembling those of leaf spot disease of maize induced by Pantoea ananatis. Four bacterial isolates were identified as P. ananatis using pathogenicity, biochemical, serological and molecular tests. To our knowledge this is the first report of the presence of the P. ananatis on maize in Poland and in Europe.

Biosynthesis of zeaxanthin in recombinant Pseudomonas putida

Pseudomonas putida KT2440 strain was investigated for biosynthesis of the valuable xanthophyll zeaxanthin. A new plasmid was constructed harboring five carotenogenic genes from Pantoea ananatis and three genes from Escherichia coli under control of an L: -rhamnose-inducible promoter. Pseudomonas putida KT2440 wild type hardly tolerated the plasmids for carotenoid production. Mating experiments with E. coli S17-1 strains revealed that the carotenoid products are toxic to the Pseudomonas putida cells. Several carotenoid-tolerant transposon mutants could be isolated, and different gene targets for relief of carotenoid toxicity were identified. After optimization of cultivation conditions and product processing, 51 mg/l zeaxanthin could be produced, corresponding to a product yield of 7 mg zeaxanthin per gram cell dry weight. The effect of various additives on production of hydrophobic zeaxanthin was investigated as well. Particularly, the addition of lecithin during cell cultivation increased volumetric productivity of Pseudomonas putida by a factor of 4.7 (51 mg/l vs. 239 mg/l).

High versus low level expression of the lycopene biosynthesis genes from Pantoea ananatis in Escherichia coli

The heterologous synthesis of lycopene in non-carotenogenic Escherichia coli required the introduction of the biosynthesis genes crtE, crtB, and crtI. Recombinant E. coli strains, expressing each lycopene biosynthesis gene from Pantoea ananatis using multi-copy plasmid or single-copies after stable chromosomal integration, were cultivated and the formation of lycopene was investigated. The different expression conditions significantly influenced the lycopene formation as well as the growth behaviour. High plasmid expression levels of crtI with a single copy background of crtE and crtB in E. coli led to a predominate synthesis of tetradehydrolycopene at 253 microg g(-1) (cdw).