Outbreak Of Aseptic Meningitis Research Articles

Nosocomial outbreaks of aseptic meningitis: A public health concern

Nosocomial outbreaks of aseptic meningitis: A public health concern

Molecular typing of enteroviruses: comparing 5′UTR, VP1 and whole genome sequencing methods

Enteroviruses (EV) commonly cause hand, foot and mouth disease (HFMD), and can also cause potentially fatal neurological and systemic complications. In our laboratory, sequencing 5' untranslated region (UTR) of the viral genome has been the routine method of genotyping EVs. During a recent localised outbreak of aseptic meningitis, sequencing the 5'UTR identified the causative virus as EV-A71, which did not fit with the clinical syndrome or illness severity. When genotyped using a different target gene, VP1, the result was different. This led us to evaluate the accuracy of the two different target genome regions and compare them against whole genome sequencing (WGS). We aimed to optimise the algorithm for detection and characterisation of EVs in the diagnostic laboratory. We hypothesised that VP1 and WGS genotyping would provide different results than 5'UTR in a subset of samples. Clinical samples from around New South Wales which were positive for EV by commercial polymerase chain reaction (PCR) assays were genotyped by targeting three different viral genome regions: the 5'UTR, VP1 and WGS. Sequencing was performed by Sanger and next generation sequencing. The subtyping results were compared. Of the 74/118 (63%) samples that were successfully typed using both the 5'UTR and the VP1 method, the EV typing result was identical for 46/74 (62%) samples compared to WGS as the gold standard. The same EV group but different EV types were found in 22/74 (30%) samples, and 6/74 (8%) samples belonged to different EV groups depending on typing method used. Genotyping with WGS and VP1 is more accurate than 5'UTR. Genotyping by the 5'UTR method is very sensitive, but less specific.

Pathological Characteristics of Echovirus 30 Infection in a Mouse Model.

Echovirus 30 (E30), a member of species B enterovirus, is associated with outbreaks of aseptic meningitis and has become a global health emergency. However, the pathogenesis of E30 remains poorly understood due to the lack of appropriate animal models. In this study, we established a mouse infection model to explore the pathogenicity of E30. The 2-day-old IFNAR-/- mice infected with E30 strain WZ16 showed lethargy and paralysis, and some died. Obvious pathological changes were observed in the skeletal muscle, brain tissue, and other tissues, with the highest viral load in the skeletal muscles. Transcriptome analysis of brain and skeletal muscle tissues from infected mice showed that significant differentially expressed genes were enriched in complement response and neuropathy-related pathways. Using immunofluorescence assay, we found that the viral double-stranded RNA (dsRNA) was detected in the mouse brain region and could infect human glioma (U251) cells. These results indicated that E30 affects the nervous system, and they provide a theoretical basis for understanding its pathogenesis. IMPORTANCE Echovirus 30 (E30) infection causes a wide spectrum of diseases with mild symptoms, such as hand, foot, and mouth disease (HFMD), acute flaccid paralysis, and aseptic meningitis and other diseases, especially one of the most common pathogens causing aseptic meningitis outbreaks. We established a novel mouse model of E30 infection by inoculating neonatal mice with clinical isolates of E30 and observed the pathological changes induced by E30. Using the E30 infection model, we found complement responses and neuropathy-related genes in the mice tissues at the transcriptome level. Moreover, we found that the viral dsRNA localized in the mouse brain and could replicate in human glioma cell line U251 rather than in the neuroblastoma cell line, SK-N-SH.

Clinical, Laboratory, and Molecular Epidemiology of an Outbreak of Aseptic Meningitis Due to a Triple-Recombinant Echovirus in Ashburton, New Zealand.

Here, we describe a small enterovirus outbreak including nine cases of aseptic meningitis in a New Zealand hospital in 2017. Most patients had a lymphocytic predominance in the CSF, their length of stay was short, and there were no paediatric cases or ICU admissions. VP1 genotyping revealed that the outbreak was caused by an echovirus E30 strain closely related to strains reported from the US, UK, Brazil, and Denmark. They all form a separate cluster within lineage “h”, which leads to the proposal of establishing a new lineage tentatively named “j” for this group of echovirus E30 strains. However, whole genome sequencing and reference mapping to echovirus E30 sequences showed very poor mapping of reads to the 3′ half of the genome. Further bioinformatic analysis indicated that the causative agent of this outbreak might be a mosaic triple-recombinant enterovirus composed of echovirus E6, echovirus E11, and echovirus E30 genome segments.

Development of A Neonatal Mouse Model for Coxsackievirus B1 Antiviral Evaluation.

Coxsackievirus B1 (CVB1) is a leading causative agent of severe infectious diseases in humans and has been reported to be associated with outbreaks of aseptic meningitis, myocarditis, and the development of chronic diseases such as type 1 diabetes mellitus (T1DM). There is no approved vaccine or effective antiviral therapy to treat CBV1 infection. And animal models to assess the effects of antiviral agents and vaccine remain limited. In this study, we established a neonatal mouse model of CVB1 using a clinically isolated strain to characterize the pathological manifestations of virus infection and to promote the development of vaccines and antiviral drugs against CVB1. One-day-old BALB/c mice were susceptible to CVB1 infection by intraperitoneal injection. Mice challenged with CVB1 at a low dose [10 median tissue culture infective dose (TCID50)] exhibited a series of clinical symptoms, such as inactivity, emaciation, limb weakness, hair thinning, hunching and even death. Pathological examination and tissue viral load analysis showed that positive signals of CVB1 were detected in the heart, spinal cord, limb muscle and kidney without pathological damage. Particularly, CVB1 had a strong tropism towards the pancreas, causing severe cellular necrosis with inflammatory infiltration, and was spread by viraemia. Notably, the monoclonal antibody (mAb) 6H5 and antisera elicited from CVB1-vaccinated mice effectively protected the mice from CVB1 infection in the mouse model. In summary, the established neonatal mouse model is an effective tool for evaluating the efficacy of CVB1 antiviral reagents and vaccines.Supplementary InformationThe online version contains supplementary material available at 10.1007/s12250-021-00444-1.

Temporal phylogeny and molecular characterization of echovirus 30 associated with aseptic meningitis outbreaks in China

BackgroundAn outbreak of aseptic meningitis occurred from June to August 2016, in Inner Mongolia Autonomous Region, China.MethodsTo determine its epidemiological characteristics, etiologic agent, and possible origin, specimens were collected for virus isolation and identification, followed by molecular epidemiological analysis.ResultsA total of 363 patients were clinically diagnosed from June 1st to August 31st 2016, and most cases (63.1%, n = 229) were identified between June 22nd and July 17th, with children aged 6 to 12 years constituting the highest percentage (68.9%, n = 250). All viral isolates from this study belonged to genotype C of echovirus 30 (E30), which dominated transmission in China. To date, two E30 transmission lineages have been identified in China, of which Lineage 2 was predominant. We observed fluctuant progress of E30 genetic diversity, with Lineage 2 contributing to increased genetic diversity after 2002, whereas Lineage 1 was significant for the genetic diversity of E30 before 2002.ConclusionsWe identified the epidemiological and etiological causes of an aseptic meningitis outbreak in Inner Mongolia in 2016, and found that Lineage 2 played an important role in recent outbreaks. Moreover, we found that Gansu province could play an important role in E30 spread and might be a possible origin site. Furthermore, Fujian, Shandong, Taiwan, and Zhejiang provinces also demonstrated significant involvement in E30 evolution and persistence over time in China.

Analysis of enterovirus genotypes in the cerebrospinal fluid of children associated with aseptic meningitis in Liaocheng, China, from 2018 to 2019

BackgroundAseptic meningitis is most often caused by enteroviruses (EVs), but EVs associated with aseptic meningitis have not yet been reported in Liaocheng. The aim of this study was to determine the prevalence and genetic characteristics of EVs causing aseptic meningitis in children in Liaocheng.MethodsWe reviewed the epidemiological and clinical characteristics of 504 paediatric cases of aseptic meningitis in Liaocheng from 2018 to 2019 and analysed the phylogeny of the predominant EV types causing this disease.ResultsA total of 107 children were positive for EV in cerebrospinal fluid samples by nested PCR. Most of the positive patients were children 13 years old or younger and had symptoms such as fever, headache and vomiting (P < 0.05). The seasons with the highest prevalence of EV-positive cases were summer and autumn. The 107 EV sequences belonged to 8 serotypes, and echovirus types 18, 6 and 11 were the three dominant serotypes in Liaocheng during the 2-year study period. Phylogenetic analyses demonstrated that the E18 and E6 isolates belonged to subgenotype C2, while the E11 isolates belonged to subgenotype D5. VP1 analysis suggested that only one lineage of these three types was cocirculating in the Liaocheng region.ConclusionsThis study demonstrated the diverse EV genotypes contributing to a large outbreak of aseptic meningitis in Liaocheng. Therefore, large-scale surveillance is required to assess the epidemiology of EVs associated with aseptic meningitis and is important for the diagnosis and treatment of aseptic meningitis in Liaocheng.

Molecular characterisation and epidemiology of enterovirus-associated aseptic meningitis in the Western and Eastern Cape Provinces, South Africa 2018-2019.

Enteroviruses are amongst the most common causes of aseptic meningitis. Between November 2018 and May 2019, an outbreak of enterovirus-associated aseptic meningitis cases was noted in the Western and Eastern Cape Provinces, South Africa. To describe the epidemiology and phylogeography of enterovirus infections during an aseptic meningitis outbreak in the Western and Eastern Cape Provinces of South Africa. Cerebrospinal fluid samples from suspected cases were screened using a polymerase chain reaction targeting the 5'UTR. Confirmed enterovirus-associated meningitis samples underwent molecular typing through species-specific VP1/VP2 primers and pan-species VP1 primers. Between November 2018 and May 2019, 3497 suspected cases of aseptic meningitis were documented in the Western and Eastern Cape Provinces. Median age was 8 years (range 0-61), interquartile range (IQR=4-13 years), 405/735 (55%) male. 742/3497 (21%) cases were laboratory - confirmed enterovirus positive by routine diagnostic PCR targeting the 5'UTR. 128/742 (17%) underwent molecular typing by VP1 gene sequencing. Echovirus 4 (E4) was detected in 102/128 (80%) cases. Echovirus 9 was found in 7%, Coxsackievirus A13 in 3%. 10 genotypes contributed to the remaining 10% of cases. Synonymous mutations were found in most cases, with sporadic amino acid changes in 13 (12.7%) cases. The aseptic meningitis outbreak was associated with echovirus 4. Stool samples are valuable for molecular typing in CSF confirmed EV-associated aseptic meningitis.

The Immunogenicity and Safety Profile for KM-248, a Combined Measles, Mumps, and Rubella Vaccine, and Its Noninferiority to the Measles Vaccine in Healthy Japanese Children: a Phase 3 Randomized Multicenter Single-Blind Clinical Trial

The domestic combined measles-mumps-rubella (MMR) vaccine was withdrawn in Japan in 1993 following an outbreak of aseptic meningitis attributed to the mumps component of the cocktail. KM-248 is an MMR vaccine (M-M-R®II), manufactured by Merck & Co., Inc. (Kenilworth, NJ, USA) and registered and approved in 74 countries, but which has not been approved in Japan. This multicenter, randomized, single-blind study, was designed to evaluate the noninferiority of the KM-248 measles component in terms of immunogenicity when compared to the control measles vaccine already approved in Japan and the seroconversion rates for these three viruses following KM-248 administration. Vaccination with KM-248 in children aged 12-90 months (n = 178) induced robust immune responses to measles, mumps, and rubella viruses. The seroconversion rate for the measles virus by the measles component of KM-248 (n = 172) was shown to be non-inferior to that of the control measles vaccine (n = 85). No serious adverse reactions, such as aseptic meningitis or anaphylaxis, were observed. Fever is one of the most common adverse reactions associated with vaccination and was observed in approximately half of the participants. KM-248 administered to healthy Japanese children aged between 12 and 90 months demonstrated a comparable safety and efficacy profile to the control vaccine.

Aseptic meningitis outbreak associated with echovirus 4 in Northern Europe in 2013-2014.

Picornaviruses (family Picornaviridae) are small, nonenveloped, positive-sense, single-stranded RNA viruses. The members of this family are currently classified into 47 genera and 110 species. Of picornaviruses, entero- and parechoviruses are associated with aseptic meningitis. They are transmitted via fecal-oral and respiratory routes, and occasionally, these viruses may cause a brief viremia and gain access to central nervous system (CNS). During the diagnostic screening of entero- and parechovirus types in Finland in year 2013-14, we detected a cluster of echovirus 4 (E4) infections in young adults and adolescents. As E4 is infrequently detected in Finland, we contacted several Northern and Central European laboratories that conduct routine surveillance for enteroviruses and, for those who have had E4 cases, we send a query for E4 sequences and data. Here we report CNS infections caused by E4 in Finland, Sweden, Norway, Denmark, Iceland and Germany in 2013 and 2014, and show that the E4 detected in these countries form a single lineage. In contrast, E4 strains circulating in these countries preceding the year 2013, and those circulating elsewhere in Europe during 2013-2014, formed several independent clusters.

Investigating the etiologic agents of aseptic meningitis outbreak in Iranian children.

Introduction:This study aimed to determine the viral agent (s) and their genome burden associated with an aseptic meningitis outbreak that occurred in Yasuj, Iran.Materials and Methods:During April to August 2015, 104 CSF samples from 104 patients under 14 years old admitted to the hospital of Yasuj, Iran, with aseptic meningitis associated clinical signs were collected. 200 μl CSF specimens was prepared for DNA and RNA viral genome extraction each and then subjected to diagnostic Taq-man real time PCR assays for the present of Enteroviruses, HSV, VZV, mumps, measles and rubella in the samples.Results:The majority of them had experienced clinical meningitis sign. Primary laboratory differentiated tests were in favor of viral meningitis. Among a total of 104 patients diagnosed with clinically aseptic meningitis, enterovirus as the most significant viral agent was detected in 53 subjects. However, mumps, HSV and VZV, as the endemic causes of viral meningitis, were detected in 6, 6 and 2 of the affected patients. It was revealed that two HSV and one VZV affected patients were co-infected with enteroviruses. All affected children with relatively variable viral load recovered without any sequels.Conclusion:The present study revealed enterovirus as the main predominant cause of pediatric aseptic meningitis that broke out in Yasuj-Iran. Also, the co-circulation of mumps, HSV and VZV, as the endemic cause during the same aseptic meningitis outbreak, was demonstrated in some cases.

Outbreak of aseptic meningitis caused by echovirus 30 in Kushiro, Japan in 2017

Background: Echovirus 30 (E30) is one of the most common causative agents for aseptic meningitis.Objectives: In the autumn of 2017, there was an outbreak caused by E30 in Kushiro, Hokkaido, Japan. The aim of this study was to characterize this outbreak.Study design: Fifty-nine patients were admitted to the Department of Pediatrics, Kushiro Red Cross Hospital (KRCH) with clinical diagnosis of aseptic meningitis. Among those, 36 patients were finally diagnosed as E30-associated aseptic meningitis by the detection of viral RNA using reverse transcription-polymerase chain reaction (RT-PCR) and/or the evidence of more than four-fold rise in neutralizing antibody (NA) titers in the convalescent phase relative to those in the acute phase. We investigated these 36 confirmed cases.Results: The median age was 6 years (range: 6 months–14 years). The positive signs and symptoms were as follows: fever (100%), headache (94%), vomiting (92%), jolt accentuation (77%), neck stiffness (74%), Kernig sign (29%), and abdominal pain (28%). The median cerebrospinal fluid (CSF) white cell count, neutrophil count, and lymphocyte count were 222/μL (range: 3–1434/μL), 144/μL (range: 1–1269/μL), and 85/μL (range: 2–354/μL), respectively. Although the detected viral genes demonstrated same cluster, they were different from E30 strains observed in Japan between 2010 and 2014.Conclusion: We mainly showed clinical and virological features of the E30-associated aseptic meningitis outbreak that occurred in Kushiro. To prevent further spread of E30 infection, continuous surveillance of enterovirus (EV) circulation and standard precautions are considered essential.

Molecular characterization of an outbreak of enterovirus-associated meningitis in Mossel Bay, South Africa, December 2015\u2013January 2016

BackgroundHuman enteroviruses (HEVs) are common causal agents of aseptic meningitis in young children. Laboratory and syndromic surveillance during December 2015 and January 2016 noted an unusually high number of paediatric aseptic meningitis cases at a hospital in Mossel Bay, Western Cape Province, South Africa. HEV was detected in clinical samples, prompting an outbreak investigation.MethodsEpidemiological investigations were conducted to ascertain possible linkage between cases. Amplification, sequencing and phylogenetic analysis of the 5’UTR and VP1 regions was undertaken to determine the HEV serotype associated with the outbreak as well as other cases of aseptic meningitis in the area in the preceding 6 weeks.ResultsOver the 2-month period, 63 CSF samples were available for testing. A total of 43 outbreak cases (68.3%) were observed, and the 26 (60.5%) that could be typed were coxsackie virus A9 (CVA9). Children attending three crèche facilities were epidemiologically linked, accounting for 60.5% (26/43) of the CVA9 cases. The majority of patients were under 10 years of age (55/63, 87.3%) and there was a male predominance (66%). Nucleotide sequence analysis of the 5’UTR and VP1 regions identified 2 lineages of CVA9 co-circulating during the outbreak, although the VP1 capsid protein sequence was identical as all nucleotide differences were synonymous. There was a unique isoleucine at position 64 and all outbreak viruses had a valine to threonine change in the hypervariable BC loop of VP1. Other HEV types circulating in the preceding period were echovirus 30 (n = 4), echovirus 5 (n = 3) and 1 each of echovirus 6, echovirus 9 and echovirus 15.ConclusionCVA9 was identified as the pathogen responsible for the large outbreak of aseptic meningitis, with 2 distinct co-circulating lineages.

Recombination analysis of coxsackievirus B5 genogroup C.

Coxsackievirus B5 (CVB5) is a member of the species Enterovirus B of the genus Enterovirus, family Picornaviridae. Based on its VP1 sequence, CVB5 is divided into four genogroups: A, B, C, and D. From 2002 to 2012, CVB5 serotype genogroup C caused an outbreak of aseptic meningitis in China. In order to study the evolution of CVB5 genogroup C, phylogenetic and recombination analysis was performed using the 399 available enterovirus B genome sequences in the GenBank database. The results indicated that 10 strains of CVB5 serotype genogroup C resulted from recombination between members of genogroup B and echovirus serotype E6, and another 5 strains resulted from recombination between members of genogroup C and serotype CVB4. These recombination events were confirmed by phylogenetic analysis.

Seroepidemiological and phylogenetic characterization of neurotropic enteroviruses in Ireland, 2005-2014.

Enteroviruses (EVs) are associated with a broad spectrum of clinical presentation, including aseptic meningitis (AM), encephalitis, hand, foot and mouth disease, acute flaccid paralysis, and acute flaccid myelitis. Epidemics occur sporadically and are associated with increased cases of AM in children. The present study describes the seroepidemiological analysis of circulating EVs in Ireland from 2005 to 2014 and phylogenetic characterization of echovirus 30 (E-30), enterovirus A71 (EV-A71), and enterovirus D68 (EV-D68). EV VP1 genotyping was applied to viral isolates and clinical samples, including cerebrospinal fluid (CSF), and those isolates that remained untypeable by neutralising anti-sera. An increase in AM cases from 2010 to 2014 was associated with an E-30 genogroup variant VII and sequences clustered phylogenetically with those detected in AM outbreaks in France and Italy. EV-D68 viral RNA was not detected in CSF samples and no neurological involvement was reported. Three EV-A71 positive CSF samples were identified in patients presenting with AM. A phylogenetic analysis of respiratory-associated EV-D68 and EV-A71 cases in circulation was performed to determine baseline epidemiological data. EV-D68 segregated with clades B and B(1) and EV-A71 clustered as subgenogroup C2. The EV VP1 genotyping method was more sensitive than neutralising anti-sera methods by virus culture and importantly demonstrated concordance between EV genotypes in faecal and CSF samples which should facilitate EV screening by less invasive sampling approaches in AM presentations.

An outbreak of aseptic meningitis in Podlaskie Voivodeship in 2014

Enteroviruses cause common infections with various clinical course and forms, such as hand-foot-and-mouth disease (Boston exanthem disease), herpangina, myocarditis and pericarditis, widespread myositis (epidemic pleurodynia, Bornholm disease), or aseptic inflammation of the nervous system, among children and adolescents. An increase in aseptic meningitis cases of enteroviral aetiology, including the E30 virus, was occasionally observed in various European countries. In 2014, an outbreak of aseptic meningitis was reported in Podlaskie Voivodeship. A total of 640 cases were reported between June 1 and November 30, 2014, of which 228 had confirmed enteroviral aetiology. Summer and autumn seasons favour the incidence of viral infections of the central nervous system. Symptomatic infections are more common in males than females. Infections with enterovirus show the tendency to form endemic regions.

Laboratory diagnosis and genetic analysis of a family clustering outbreak of aseptic meningitis due to echovirus 30

Echovirus 30 (E30) is a major pathogen associated with aseptic meningitis. In the summer of 2014, a family clustering aseptic meningitis outbreak occurred in urban–rural fringe of Ningbo city in Zhejiang Province in China. To identify the etiologic agent, specimens were tested by cell culture and reverse transcriptase–polymerase chain reaction. Pathogenic examination confirmed that the outbreak is caused by E30. The first case is a 6-year-old child, who studied in kindergarten in local, suffered from headache and fever. Same symptoms appeared in his parents, aunts, and other six relatives continuously. Meanwhile, vomiting occurred in majority of the patients and diarrhea in parts of them. White blood cells in cerebrospinal fluid (CSF) exceeded normal range in all patients. Protein levels in CSF were above normal range in half of the patients. Glucose levels in CSF were within normal range in all patients. We isolated six strains E30 in the stool specimens of patients, and carried out sequencing analysis to VP1 region. Sequencing results showed that 100% sequence identity was seen in both nucleotide and amino acid levels. Phylogenetic analysis discovered that isolate in this study was grouped into sublineage D2 together with sequences isolated from other areas of China in the 2000s and 2010s. Our study is the first family clustering outbreak of aseptic meningitis caused by E30 in Zhejiang Province in China. It is essential to establish an enterovirus molecular surveillance system in China to prevent mass outbreaks in Zhejiang.

Complete genome sequence of a coxsackievirus B3 recombinant isolated from an aseptic meningitis outbreak in eastern China.

Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8% identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7%) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed.

Molecular characterization of echovirus 30 isolates from Poland, 1995-2015.

Echovirus 30 (E30) is one of the most frequently identified enterovirus and a major cause of meningitis in children and adults. To investigate the genetic variability and relationship of E30 isolated from specimens of aseptic meningitis cases that occurred in Poland over a period of 20years, sequences of VP1 gene were determined and genetic analysis was performed. From 1995 to 2015, 124 E30 were isolated using RD cells, and 58 isolates were sequenced and characterized by phylogenetic analysis of partial VP1 region (793 nt). In general, nucleotide sequence divergence in pairwise comparisons among Polish E30 isolates ranged from 0.0 to 15.0%. The phylogenetic analysis revealed that E30 circulating in Poland since 1995 belong to two unique groups: Group I, characterized by high divergence (up to 13.1%), segregated in four subgroups, and showed strong temporal circulation of E30. Group II, detected in Poland in 2013-2014, was closely correlated with two meningitis outbreaks and formed a separate genetically homogeneous group. Phylogenetic analysis revealed that strains from Poland had the closest genetic relationship with not only the isolates previously identified in Europe (Belarus, France, Germany, Italy, Russia) but also those in other parts of the world (Australia, China). Sequences of outbreak isolates were grouped in group II together with those from Russia and China isolated during 2010-2013. The identification of five distinct viral lineages during 1995-2015 confirmed the high E30 genetic diversity which may be an essential precondition for the emergence of new strains responsible for further potential aseptic meningitis outbreaks.

MOLECULAR-EPIDEMIOLOGICAL INVESTIGATION OF THE OUTBREAK OF ASEPTIC MENINGITIS IN NOVOSIBIRSK REGION

The aim of this study was to investigate the outbreak of aseptic meningitis in theNovosibirskregion in 2008–2009. We studied genetic diversity and molecular-epidemiological characteristics of human enteroviruses that caused aseptic meningitis. Materials and metods. In the present study we investigated samples of cerebrospinal fluid from 199 patients with a diagnosis “aseptic meningitis”, based on the clinical characteristics of the disease (headache, stiff neck, fever, nausea, vomiting), and confirmed by laboratory tests of spinal fluid (lymphocyte cell count > 10 cells/ml). All samples were tested by PCR for RNA of Enterovirus and Flavivirus and DNA Myc. tuberculosis, Borrelia spp., Neisseria spp. In the samples there were not found RNA Flavivirus, DNA Myc. tuberculosis, Borrelia spp., Neisseria spp., but in 73 samples (37%) was identified RNA enterovirus (EV). Determination of nucleotide sequences of 5’UTR and VP1-region of EV revealed that they belong to the following genotypes: the highest percentage was presented by genotype ECHO 30 (62%); another genotypes were Cox A2 (8%), Cox A4 (5%), Cox A14 (3%), Cox A16 (5%), Cox B5 (8%), ECHO 6 (3%), ECHO 9 (3% ) and ECHO 25 (3%). In 2008 most of the EV that caused the symptoms of aseptic meningitis belonged to genotype ECHO 30 (76%). In 2009 the clinical specimens containing genotype ECHO 30 were not found, but the largest percentage of EV belonged to genotypes Cox A2 (33%) and Cox A4 (22%). Thus, in 2008 we recorded outbreak of aseptic meningitis, the major etiological factor was enterovirus ECHO 30. And the rise of the incidence of aseptic meningitis in 2009 is related to the circulation of new genotypes of EV. The investigated strains were deposited in an international database GenBank under accession numbers KP258231-KP258235, HM559584.