Ormosia Hosiei Research Articles

Hosimosines A-E, structurally diverse cytisine derivatives from the seeds of Ormosia hosiei Hemsl. et Wils

Ormosia hosiei Hemsl. et Wils (Fabaceae family) is an arbor species endemic to China. The seeds of O. hosiei have been used as traditional Chinese medicine to treat hernia, abdominal pain, blood stasis and amenorrhea. Cytisine-like and angustifoline type alkaloids were main components identified from this plant. In our research on the bioactive alkaloids from the promising Chinese medicinal plants, four new angustifoline type alkaloids (1–4) and a new cytisine-like alkaloid (5), named hosimosine A-E, together with 13 known analogues (6–18) were isolated from the seeds of O. hosiei. Their structures were elucidated by the extensive spectroscopic methods, especially the interpretation of NMR spectra and specific rotations, along with the methods of NMR and ECD calculation. Compounds 1–4 were identified as two pairs of epimers, whose relative configurations were deduced from density functional theory (DFT) calculations of NMR chemical shifts and DP4+ analysis, and absolute configurations were determined by comparison of their experimental and theoretical ECD spectra. Compound 5 displayed two sets of NMR data caused by the existence of tautomeric forms. Compounds 14, 17 and 18 were determined to be enantiomers of literature compounds. Some of the isolates exhibited moderate cytotoxic effects against HepG2, A2780 and MCF-7 cells.

Spatial–Temporal Distribution Pattern of Ormosia hosiei in Sichuan under Different Climate Scenarios

Ormosia hosiei is an endemic plant in China listed as a national grade II key protected wild plant with important scientific, economic, and cultural values. This study was designed to predict the potential suitable distribution areas for O. hosiei under current and future climate change and to provide a reference to enhance the species’ conservation and utilization. Based on the actual geographical locations of O. hosiei in Sichuan, we applied two species distribution models (BIOCLIM and DOMAIN) to predict its current and future potential suitable areas and future change patterns. We also analyzed the major climatic variables limiting its geographical distribution with principal component analysis. The results indicated that O. hosiei was mainly distributed in the eastern region of Sichuan and concentrated in the middle subtropical climate zone at relatively low elevations. The principal component analysis identified two critical factors representing temperature and moisture. The temperature was the most critical factor limiting O. hosiei distribution in Sichuan, especially the effect of extreme low temperatures. Both models’ simulation results of potential suitable areas under the current climate scenario showed that the excellent suitable habitat was consistent with the current actual distribution, remaining in the eastern region of Sichuan. Under the future climate scenario with doubled CO2 concentration (2100), both models predicted a sharp decrease in the areas of excellent and very high suitable habitats. The findings can inform strategies and guidelines for O. hosiei research, conservation, nursery production, and cultivation in Sichuan.

Hard Seed Characteristics and Seed Vigor of Ormosia hosiei

The Ormosia hosiei is a secondary protected wild plant in China, and its seed has a hardness rate of 86%. To explore the characteristics of the hard seed and the difference in seed vigor between hard seeds and the non-hard seeds of O. hosiei, the water absorption characteristics, germination characteristics, seed coat structure, seed coat permeability, enzyme activity, and main biochemical substances of the O. hosiei seeds were determined. The results showed that the hard and dense seed coat is the main obstacle to absorbing water of O. hosiei seeds; the main reason is that the seed coat is composed of cuticle, palisade cells, and thick-walled cells with impermeability. Hot water treatment can soften the seed coat and remove wax and grease from the seed coat, and concentrated sulfuric acid treatment can corrode the local seed coat and break the barrier of cuticle and palisade tissue. The effectiveness of concentrated sulfuric acid to break the dormancy of O. hosiei hard seeds is better than that of hot water treatment, but the damage to the seed coat is larger and irreversible. The germination, germination index, root activity, TTCH content, and SOD activity of the hard seeds were higher than those of the non-hard seeds, but the SSC, conductivity value, and MDA content were lower than those of the non-hard seeds.

Phytochemical compositions and biological activities of the branches and leaves of Ormosia hosiei Hemsl. et Wils.

Ormosia hosiei Hemsl. et Wils. is an economical and medicinal plant, increasingly cultivated in China; however, its branches and leaves are often pruned as waste. This is the first study focused on the phytochemical profiles and antioxidant, anti-α-glucosidase, anti-tyrosinase, and anti-neuroinflammatory activities of the branches and leaves of O. hosiei. Herein, thirty-seven characteristic compounds were identified by UPLC-MS/MS and twelve were detected for the first time in O. hosiei. Twenty-seven phenolics were further quantified and significant differences in phenolic compositions between the branches and leaves of O. hosiei were observed. The ethanol extracts exhibited promising antioxidant, anti-α-glucosidase, anti-tyrosinase, and anti-neuroinflammatory effects, and the bioactivities significantly correlated with total phenolic content and twelve individual phenolics. Naringin, genistein, vitexin, vitexin-2-O-rhamnoside, syringaresinol and syringaresinol-4-O-β-D-glucopyranoside can be considered potential quality markers of O. hosiei. Our results provided solid evidence that the branches and leaves of O. hosiei deserve more attention and exploitation, considering the potential to be developed as functional foods or herbal medicines.

Mating Systems of Single Families and Population Genetic Diversity of Endangered Ormosia hosiei in South China.

Ormosia hosiei is a tree species native to China that has been extensively used for ornamental and furniture purposes due to its valued timber. The mating system has substantial impact on genetic diversity and structure of plant natural population. Such information should be considered when planning tree planting for forest restoration. Here we used 12 microsatellite markers and described the mating system of single families and the population genetic diversity of O. hosiei. A high level of genetic diversity was observed in both adults and progenies, although slight differences existed among populations and their progenies, with the expected heterozygosity ranging from 0.763 to 0.794. Overall, O. hosiei displayed a predominantly outcrossed mating. The estimate of multi-locus outcrossing rate (tm) was high with low variations among families, ranged from 0.997 to 1.000. The value of tm-ts, ranged from 0.000 to 0.139, indicated that biparental inbreeding occurred in progenies. Therefore, to obtain a reasonable genetic representation of native tree species and prevent problems associated with inbreeding depression, we suggested effective in situ conservation by replanting seedlings, but seedling production for restoration purposes may require a much larger sampling effort than is currently used. Moreover, it is necessary to conduct further multiple population and multi-year experiments to verify our conclusions.

First Report of Meloidogyne enterolobii on Ormosia hosiei in China.

Ormosia hosiei is an evergreen tree that belongs to the family of Fabaceae. It is prized for ornamental and medicinal value and rosewood. In November 2020, galls were observed on roots of stunted O.hosiei plants in the Nanning arboretum (22°43'38″ N, 108°18'06″ E), Guangxi, China. Disease incidence was approximately 80% (150 plants evaluated). Females were obtained by dissecting galls and J2s were collected from a single egg mass hatching. The female white body was pear to globular-shaped with a distinct neck region, while the perineal pattern usually was oval-shaped with a moderately high dorsal arch. J2 bodies were translucent with narrow tails and pointed tips, with hyaline tail termini. Those morphological characters were consistent with description of Meloidogyne enterolobii (Yang and Eisenback 1983; Brito et al. 2004). Morphological measurements (mean, standard deviation and range) of J2s (n = 20) included body length= 436.07 ± 12.5 (411.8 to 464.3) µm, body width = 16.01 ± 1.1 (14.6 to 17.7) µm, stylet length = 12.4 ± 0.8 (11.3 to 13.5) µm, dorsal esophageal gland orifice to the stylet base (DGO) = 3.8 ± 0.3 (3.3 to 4.3) µm, tail = 53.6 ± 4.3 (48.9 to 60.6) µm, and hyaline tail length = 15.9 ± 1.5 (13.6 to 18.3) µm. Measurements of females (n = 20) were: body length = 669.5 ± 43.8 (549.9 to 709.4) μm, body width = 641.9 ± 45.2 (559.3 to 732.8) μm, DGO = 5.3 ± 0.52 (4.6 to 6.1) μm, and stylet length = 14.9 ± 0.86 (13.8 to 16.8) μm. These measurements were also consistent with M. enterolobii (Yang and Eisenback. 1983). The ITS rRNA gene sequence and D2-D3 expansion segment of 28S rDNA were amplified in the DNA of individual J2 using the primers 18S/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) and D2A/D3B (ACAAGTACCGTGAGGGAAAGT/TCGGAAGGAACCAGCTACTA), respectively (Vrain et al. 1992; Subbotin et al. 2006 ). The sequences were submitted in the NCBI with GeneBank Accessions No. MZ617284 (766-bp) and OK072889 (759-bp). The homology of the genes was 99% to 100% identical to that of M. enterolobii in ITS rRNA gene sequence MT406251, MG773551, KF418369. The D2-D3 region of 28S rRNA gene revealed 100% identity with M. enterolobii sequences from MT193450, MF467276, MZ541997 etc. Neighbor-joining phylogenetic analysis showed that it was the most similar to M. enterolobii. For further confirmation, M. enterolobii species-specific primer pairs Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/ TCAGTTCAGGCAGGATCAACC) were used for amplification of the ribosomal intergenic spacer 2. An expected PCR fragment of approximately 236-bp was obtained (Long et al. 2006). Pathogenicity test was conducted in greenhouse with 26 to 30˚C temperature. Eggs were multiplied in the greenhouse using a single eggmass hand-picked from infested O. hosiei roots. Twelve eight-month-old O. hosiei healthy seedlings were inoculated with 5,000 eggs/pot containing autoclaved soil mix (clay: substrate =1:3, v/v), and 6 noninoculated seedlings were controls. After 10 weeks, the control plants displayed no symptoms. The roots of all inoculated plants showed galling symptoms. The reproduction factor (final population/initial population) was 5.2. Furthermore, the morphological and molecular identification of the nematode was identical to the original samples. M. enterolobii has a broad host range (Philbrick et al. 2020). To our knowledge, this is the first report of M. enterolobii parasitizing O. hosiei worldwide. This finding expands the host range of this nematode.

Ormosia hosiei

This datasheet on Ormosia hosiei covers Identity.

Exponential fertilization on red-seed tree (Ormosia hosiei) seedlings subjected to contrasting light conditions: Do we really need intensive nutrient loading?

Exponential fertilization (EF) can feed seedlings with more nutrients than needed for growth and continuous lighting is expected to reduce the risk of loading at high application rate. In this study, red-seed tree (Ormosia hosiei Hemsley & E. H. Wilson) seedlings were raised by EF at a low rate of 160 mg nitrogen (N) plant-1 (conventional) (N-phosphorus [P]-potassium [K], 12-9-12) and a high rate of 600 mg N plant-1 (intensive), which was adapted from previous studies with large-pot-seedlings. Both fertilizer regimes were nested to either of two light spectra from high-pressure sodium (HPS) and light-emitting diode (LED) sources with three replicates for each combined treatment. Seedlings subjected to the conventional regime in the LED spectrum showed better growth and greater biomass accumulation with higher leaf N and P contents than other ones. In the conventional fertilizer regime, the LED spectrum also resulted in higher photosynthesis shown by more pigments and higher N synthesis than the HPS spectrum. The HPS spectrum strengthened P synthesis in the intensive regime. The antioxidative activity was stimulated by a high dose of EF, hence excessive toxicity was likely induced. We recommend using the normal rate of 160 mg N plant-1 for the culture of red-seed tree seedlings with LED lighting to promote seedling quality without causing excessive nutrient toxicity.

Effect of stand age on soil microbial communities of a plantation Ormosia hosiei forest in southern China

Changes in soil environmental factors and microbial communities of a precious tree species (Ormosia hosiei) plantation with different forest ages are still unclear. Obtaining this information can provide a theoretical basis for scientific forest management. Ormosia hosiei plantations of varying ages (7, 20, and 45 years old) were targeted in Zhejiang Province, China. We collected surface soil (0–20 cm) and analysed the diversity and structural characteristics of soil microbial communities by high-throughput sequencing. Redundancy analysis (RDA) and Spearman correlation analysis revealed soil environmental factors that cause differences in the microbial communities. The soil bacterial community diversity was not significantly affected by stand age, while the Chao and Ace indexes of the fungal community at 20 and 45 years were markedly higher than those at 7 years. The abundance of Proteobacteria in the 45 years was lower than those at 7 and 20 years, while the abundance of Actinobacteria at 7 years was lower than those at 20 and 45 years, and the abundance of Basidiomycota gradually increased with increasing stand age. The RDA and correlation analysis indicated that the soil microbial biomass carbon (MBC), bulk density (SBD), total porosity (STP), and total potassium (TK) were key factors that affected the bacterial communities and had a significant correlation with Actinobacteria. Soil temperature (T), available phosphorus (AP) and forest litter (FL) affected the fungal communities and had a significant correlation with Basidiomycota. In conclusion, forest age did not affect bacterial diversity, but the soil fungal community of the O. hosiei plantation in the middle-aged forest (20 years old) had the highest diversity; there were obvious differences in the composition and structure of soil microorganisms between different forest ages, which may be attributed to the phyla present (e.g., Proteobacteria, Actinobacteria, and Basidiomycota), which may be caused by differences in T, SBD, STP, AP, TK, MBC, and FL.

Effects of fertilization and container-type on nutrient uptake and utilization by four subtropical tree seedlings

Seedling quality is important for subtropical tree species endangered by the degradation of natural habitats in southern China. At present, the cultural regime for raising these seedlings involving fertilizer levels and size of container is not clear. In this study, seedlings of three endangered species, red-seed tree (Ormosia hosiei), Zhejiang phoebe (Phoebe chekiangensis), and Zhejiang camphor (Cinnamomum japonicum) were evaluated along with red-bark oak (Cyclobalanopsis gilva) as a reference, a species which is not endangered. Seedlings were raised in 2.8, 3.6, 5.1, and 6.3 L containers and fertilizer applied at 1.0, 2.0, 3.0 and 4.0 kg m−3. Seedling height and leaf biomass increased in response to higher fertilizer levels while larger containers resulted in greater stem and root biomass. Root biomass of endangered species seedlings did not respond to neither treatments. Zhejiang phoebe seedlings responded to nitrogen and phosphorus uptake but red-seed tree seedlings were unaffected by any nutrient levels. Red-bark oak seedlings had high nitrogen-use efficiency. Based on the results, it is recommended using at least 5.1 L containers to culture Zhejiang phoebe and Zhejiang camphor seedlings with fertilizer at 3.0 kg m−3. Red-bark oak and red-seed tree seedlings should be cultured with 2.0 kg m−3 in smaller containers.

Dark Septate Endophyte Improves Drought Tolerance of Ormosia hosiei Hemsley & E. H. Wilson by Modulating Root Morphology, Ultrastructure, and the Ratio of Root Hormones

Dark septate endophytes (DSEs) are known to help host plants survive drought stress; however, how DSEs enhance host plant drought resistance under water stress conditions remains unclear. The objective of this study was to inoculate Ormosia hosiei seedlings with a DSE strain (Acrocalymma vagum) to investigate the effects of DSE inoculation on root morphology, ultrastructure, and the endogenous hormone content under drought stress conditions and to elucidate the drought resistance mechanism involved in the DSE–host-plant association. The inoculated seedlings were grown under three different soil water conditions (well watered—75% field water capacity, moderate water—55% field water capacity, or low water—35% field water capacity) for 114 days. Fresh root weight, root volume, root surface area, root fork, and root tip number were significantly higher in inoculated seedlings than in noninoculated seedlings. Furthermore, the root architecture of the inoculated seedlings changed from herringbone branching to dichotomous branching. Mitochondria and other organelles in root cells of inoculated seedlings remained largely undamaged under water stress, whereas organelles in root cells of noninoculated seedlings were severely damaged. The abscisic acid (ABA) and indole-3-acetic acid (IAA) content and IAA/ABA ratio of inoculated seedlings were significantly higher than those of noninoculated seedlings, whereas the content of gibberellic acid (GA) and the ratios of GA/ABA, zeatin riboside (ZR)/ABA, and ZR/IAA in inoculated seedlings were lower than those of noninoculated seedlings. DSE inoculation could help plants adapt to a drought stress environment by altering root morphology, reducing ultrastructural damage, and influencing the balance of endogenous hormones, which could be of great significance for the cultivation and preservation of the O. hosiei tree.

Complete chloroplast genome of the wild-type Ormosia hosiei

Ormosia hosiei is a critically Endangered and important economic plant which is endemic in southern, eastern and central China. The complete chloroplast (cp) genome sequence of O. hosiei was determined by Next-generation sequencing technology. Total length of the cp genome is 172,210 bp, which contained a large single-copy (LSC) and a small single copy (SSC), separated by the inverted repeats (IR) of 40,377 bp. The cpDNA is structured with 144 genes, comprising 98 protein-coding genes, 38 tRNA genes, and 8 rRNA genes. Phylogenetic analysis suggested that Ormosia is closely related to the genus Styphnolobium within the Fabaceae.

Characterization of the complete chloroplast genome of an endemic species of pea family in China, Ormosia hosiei (Fabaceae)

Ormosia hosiei (Fagaceae), a critically endangered plant species, is famous for its excellent wood from which the carving craft and high-grade furniture can be made. In this study, we characterized the complete chloroplast genome of O. hosiei based on next generation sequencing to analyze its phylogenetic position. The circular complete chloroplast genome of O. hosiei was 171,642 bp in length, containing a large single-copy (LSC) region of 72,295 bp and a small single-copy (SSC) region of 18,659 bp. These two regions were separated by a pair of inverted repeat regions (IRa and IRb), each of them 40,344 bp. A total of 144 functional genes were encoded, consisted of 98 protein-coding genes, 38 tRNA genes, and 8 rRNA genes. The overall GC content of the chloroplast genome was 38.1%, and the GC contents of the LSC, SSC, and IR regions were 33.5, 29.8, and 39.3%, respectively. The phylogenetic analysis by maximum likelihood showed that the O. hosiei is clustered into one clade with Styphnolobium japonicum by strong support values, and thus is closely related to Styphnolobium.

Quantitative Characteristics of Ormosia hosiei under Different Disturbance Levels

Ormosia hosiei is a native endangered plant in China,the characteristics of many populations have been largely altered by increasing human activities. We used age-diameter relationships to study the age structures,and built the life tables,the survival curves,killing power value curves and mortality rate curves of three O. hosiei populations. In the heavily disturbed population, there was a declining population; the population,which was disturbed recently,had many young-aged individuals,accounting for 78. 77% of the total individuals. The survival curves of three populations were characterized by high death rates of young-aged individuals. The age structure of the long-term exposure to less disturbed population was stable with sufficient numbers of young-aged individuals. For the life tables,the death rates of the age class Ⅰ and Ⅱ were negative with a shortage of young-aged individuals. The age structure and dynamics of three populations were similar to those of the other endangered species in China. Compared with ten years ago,the resources of O. hosiei was reduced. Therefore,more attention should be paid for the conservation of this species,the on-site conservation and off-site preservation methods should be combined,and strengthening the scientific research to promote the population development in the successive progressive direction.

Patterns of seed predation and dispersal of an endangered rare plant <I>Ormosia hosiei</I> by Edward’s long-tailed rats and Chinese white-bellied rats

Patterns of seed predation and dispersal of an endangered rare plant <I>Ormosia hosiei</I> by Edward’s long-tailed rats and Chinese white-bellied rats

Genetic diversity of natural populations of endangered Ormosia hosiei, endemic to China

Ormosia hosiei is native to China and valued for its timber. In order to help preserve this endangered wild species, we investigated the distribution of O. hosiei populations in southern China. Based on ISSR markers, 101 clear and reproducible DNA fragments were generated. Of these, 96 (95.1%) were polymorphic. Shannon’s index (I) and Nei’s gene diversity (h) were 0.5483 and 0.3747, indicating a high level of genetic diversity. Moreover, there was a lack of significant association between genetic and geographical distances in the populations. The distribution of genetic diversity among the wild populations of O. hosiei in southern China may be the result of events in the species’ evolutionary history, including habitat fragmentation and habitat damage caused by human activity. Based on these findings, we suggest that areas with larger populations of O. hosiei should take effective measures to ensure the conservation.