One-tube Reverse Transcription-polymerase Chain Reaction Research Articles

Improved Efficiency for Quantitative and Qualitative Indexing for Citrus tristeza virus and Citrus psorosis virus.

Reverse transcription-polymerase chain reaction (RT-PCR) assays were developed for the detection of Citrus tristeza virus (CTV; genus Closterovirus) and Citrus psorosis virus (CPsV; genus Ophiovirus) in citrus trees. Real-time TaqMan RT-PCR was also developed for the detection of CTV. Three different sample preparation methods were compared. The total RNA extraction method by Qiagen was found to be more reliable than the other two methods consisting of crude plant sap extraction and total nucleic acid trapping on a silica bed. Of 287 samples tested for CTV, 210 samples tested positive by RT-PCR and 198 samples by enzyme-linked immunosorbent assay (ELISA). Furthermore, the results from monthly tests of a selected number of field-grown CTV-infected trees showed that RT-PCR detected the virus in 100% of the infected trees in winter and summer, whereas ELISA did not. The one-tube RT-PCR detection was developed for CPsV and was more sensitive than ELISA. Notably, three of 10 CPsV isolates were not detected by ELISA. As demonstrated here, our approach allows the efficacious detection of different viruses in citrus plants using a minimal amount of tissue during all seasons. The molecular methods described could be used in citrus certification programs and to test trees in nurseries and commercial orchards.

Reverse Transcription‐Polymerase Chain Reaction‐Based Detection of Plant Viruses

A one-step reverse transcription-polymerase chain reaction (RT-PCR) is used to detect two cherry flexiviruses, Cherry green ring mottle virus (CGRMV) and Cherry necrotic rusty mottle virus (CNRMV), in Prunus species. This unit presents procedures for collection of plant samples, preparation of total nucleic acids, viral RNA-rich or total RNA extracts from plant tissues, and subsequent amplification of the viral targets by one-step RT-PCR using a pair of consensus primers. The PCR amplicons are visualized by electrophoresis in a 1% agarose gel containing ethidium bromide in TAE buffer and viewed under ultraviolet light. This procedure is rapid, sensitive, reliable, and cost-effective and is generally useful on a wide variety of plant/virus systems. The use of a semi-automatic homogenizer for sample preparation and one-tube RT-PCR for virus detection makes this approach ideal for screening large numbers of samples.

No borna disease virus-specific RNA detected in blood of race horses and jockeys.

Borna disease virus (BDV) predominantly infects horses and sheep, causing a broad range of behavioural disorders. It is controversial whether BDV infects humans and causes psychiatric disorders. We searched for BDV-derived nucleic acids in blood of race horses and jockeys riding the horses. We assayed for the BDV genome in RNA extracted from peripheral blood mononuclear cells (PBMC) of 39 race horses and 48 jockeys. Two polymerase chain reaction protocols [one-tube reverse transcription-polymerase chain reaction (RT-PCR) and two-step RT-PCR] were used to assay BDV p24 and p40 transcripts. The p24 and p40 viral nucleic acid sequences were not detected in the PBMC RNAs from any of the race horses or jockeys. These data do not support an epidemiological association between BDV infection, race horses and humans.

Peach latent mosaic viroid Detected for the First Time on Almond Trees in Tunisia.

Almond (Prunus dulcis Mill) is an important crop in countries of the Mediterranean area. Until now, among viroids, only Hop stunt viroid (HSVd) is known to infect cultivated almond trees (2). In 2004, a survey of almond trees was carried out in orchards in different regions of Tunisia, a major producing and exporting country of almond. Symptoms such as mosaic and necrotic lesions, potentially caused by the Peach latent mosaic viroid (PLMVd), were observed on leaves of cultivated almond trees. Since PLMVd was recently detected in peach and pear trees in Tunisia (4), the presence of this viroid in almond trees was studied. The detection method on the basis of one-tube reverse transcription-polymerase chain reaction (RT-PCR) assays was previously described and validated for the detection of this viroid in fruit trees (4). Amplification products were obtained by using previously reported primer pairs of PLMVd (1). Positive controls included RNA preparations of twigs of PLMVd-infected GF 305 peach seedlings. These materials, provided by B. Pradier (Station de Quarantaine des Ligneux, Lempdes, France), were positive as revealed by chip budding on peach seedling indicator plants grown under greenhouse conditions. RT-PCR analysis of nucleic acid preparations from leaves of almond showed specific amplification products with the expected size of 337 bp for two almond trees among 17 trees tested. Nucleotide sequence analyses of cloned amplification products obtained with the PLMVd primers confirmed a size of 337 bp and revealed a sequence similar to sequences from other PLMVd isolates previously characterized. The sequences shared 94 to 98% identity with the reference isolates of PLMVd from peach (EMBL Accession No. M83545, AF170511, AF170514, and AY685181). The two infected almond trees are proximal to each other and peach trees infected with PLMVd. This suggests that one tree may have served as a source of inoculum for the other through agronomic practices such as pruning or the aphid Myzus percicae (3). Alternatively, PLMVd may have originated in an unknown host and was then transmitted to almond trees. Our investigation shows that almond is a new host for PLMVd.

Detection of respiratory syncytial virus and human metapneumovirus by reverse transcription polymerase chain reaction in adults with and without respiratory illness

Background Reverse transcription polymerase chain reaction (RT-PCR) is a powerful tool that allows the detection of minute quantities of viral RNA. Because of the sensitivity of these assays it is possible that the finding of viral RNA indicates not only active infection but also transient colonization or residual nucleic acid from a distant infection. Respiratory syncytial virus (RSV) and human metapneumovirus (hMPV) are two viruses for which RT-PCR is now frequently used for diagnosis in adult disease. Objective We evaluated nasal secretions from adults with and without respiratory illnesses by nested, one-tube RT-PCR for RSV and hMPV to determine if rates of detectable RNA were significantly higher among ill subjects compared to controls suggesting a causal relationship with respiratory illness. Methods Adults presenting to a healthcare provider with complaints of respiratory illness were recruited as “cases” and those visiting for non-respiratory complaints were recruited as “controls”. Subjects were enrolled during a 3-month period (January to April) when both viruses were expected to be prevalent in the community. Nasal swab samples were obtained and subjected to one-tube nested RT-PCR for RSV and hMPV. Results Of 146 ill subjects, 17 (11.6%) tested positive for RSV and 5 (3.4%) were positive for hMPV. Of the 158 control subjects, one was RT-PCR positive for RSV and none tested positive for hMPV. The rates of RT-PCR positive cases compared to controls were significantly different for RSV ( p < .0001) and hMPV ( p < .02). Subjects remained RSV RT-PCR positive on average until day 7.1 ± 2.8 of symptoms with a range of 3–10 days. No subject had a positive swab on days 14, 21 or 28. Conclusion Asymptomatic carriage of RSV or hMPV is uncommon. RT-PCR should be a useful method for the diagnosis of these viral illnesses in adults.

First Report of Pear blister canker viroid, Peach latent mosaic viroid, and Hop stunt viroid Infecting Fruit Trees in Tunisia.

Viroids of fruit trees are plant pathogens distributed worldwide and can cause severe losses and economic damage to crops. A survey of fruit trees was carried out in 17 orchards in the northern and Sahel regions of Tunisia. Samples were collected in field trees of peach (Prunus persica L), pear (Pyrus communis L), and almond (Prunus dulcis Mill.) that showed symptoms potentially caused by viroids (leaf mosaic in peach, blister canker in pear, and necrotic leaves in almond). The investigation was conducted during May, September, and December 2003 to screen for the presence of Pear blister canker viroid (PBCVd) on pear, Peach latent mosaic viroid (PLMVd) on peach, and Hop stunt viroid (HSVd) on the three plant species in naturally infected field trees. The detection method was based on one-tube reverse transcription-polymerase chain reaction (RT-PCR) assays using a Titan kit (Roche Diagnostics, Penzberg, Germany). DNA amplification was obtained by using previously reported primer pairs for PLMVd and HSVd (1,4). For PBCVd, forward primer 5' GTCTGAAGCCTGGGCGCTGG 3' and reverse primer 5' CCTTCGT CGACGACGAGCCGAG 3' were designed using an available sequence (3). Positive controls included isolate D168 of PLMVd (obtained from Dr. B. Pradier, Station de Quarantaine des Ligneux, Lempdes, France) and propagated in GF 305 rootstock and HSVd (provided by Dr. R. Flores, Instituto de Biologia Molecular y cellular de Plantas, Valencia, Spain) propagated in cucumber. The method described by Grasseau et al. (2), with some modifications, was used to prepare the samples for RT-PCR. RT-PCR analysis of nucleic acid preparations from leaves and bark of peach, pear, and almond showed that PLMVd occurred in the northern and Sahel regions of Tunisia. Of 37 peach trees tested, 12 were found infected with PLMVd. Two pear trees among 73 tested were infected with PBCVd. HSVd was detected in 2 of 11 almond, 1 of 37 peach, and 7 of 72 pear trees tested. One pear tree infected with HSVd was also infected with PBCVd. Symptoms observed in fruit trees were not consistently associated with the presence of viroids. Nucleotide sequence analyses of cloned amplification products obtained using the PBCVd, PLMVd, and HSVd primers confirmed a size of 315, 330, and 300 nt, respectively, and revealed a sequence similar to sequence variants from other isolates previously characterized for each viroid. PBCVd was 99% identical with the P47A isolate variant 9 (GenBank Accession No. Y18043); PLMVd shared 85 to 96% identity with the PC-C32 Italian isolate of PLMVd from peach (GenBank Accession No. AJ550905), and HSVd shared 99 to 100% identity with the HSVd from dapple plum fruit (GenBank Accession No. AY460202). To our knowledge, our investigation reports for the first time, the occurrence of PLMVd, PBCVd, and HSVd infecting fruit trees in Tunisia, stressing the need for a certification program to aid in prevention and spread of fruit tree viroids in this country.

Detection and quantitation of group A rotaviruses by competitive and real-time reverse transcription-polymerase chain reaction

A competitive reverse transcription-polymerase chain reaction (RT-PCR) was developed to detect and to quantitate the RNA of group A rotaviruses. In the assay, a 433 bp fragment is amplified by a one-tube RT-PCR protocol using primers with binding sites located in a highly conserved region of segment 6 of the rotavirus genome. An in vitro synthesized RNA with a 43-base deletion with respect to the wild-type sequence of this fragment was used as an internal control. Using these transcripts as templates, 10 RNA molecules were amplified reproducibly and detected in ethidium bromide-stained agarose gels or by fluorimetry using the SYBR Green I dye in a real-time RT-PCR assay. The efficiency of the protocol was confirmed by the detection of small amounts of viral RNA of group A rotaviruses in clinical samples obtained from various animal species and man.

Highly sensitive one-tube RT-PCR and microplate hybridisation assay for the detection and for the discrimination of classical swine fever virus from other pestiviruses

Rapid, sensitive and specific laboratory diagnostic methods are necessary to confirm outbreaks of classical swine fever. The detection of classical swine fever virus (CSFV) and its discrimination from other pestiviruses can be achieved by virus isolation on cell culture, antigen detection, or molecular methods. To reduce the time and the number of steps in the diagnostic procedure a sensitive and rapid detection method based on specific amplification of the pestiviral RNA by one-step reverse transcription-polymerase chain reaction (RT-PCR) followed by detection and differentiation of the amplification products by pestivirus-, bovine viral diarrhoea virus- (BVDV-) and CSFV-specific capture probe hybridisation and colorimetric assay in microwell plates (enzyme liked immunosorbent assay (ELISA)) was developed. Two different methods using two gene regions for pestivirus RT-PCR amplification were carried out. One pair of primers was selected from the 5′-UTR region and the second one from the gene region coding for N pro, C and E0 proteins. The designed oligonucleotide primers were used for several pestivirus reference strains as well as for some field isolates detection in cell culture supernatants and in clinical specimens. The specificity and sensitivity of both methods were compared using EZ r Tth RNA PCR kit and ACCESS RT-PCR system for combined RT-PCR assay. The use of one-step RT-PCR eliminates the additional manipulations that are generally required for a two reaction system and limits the risk of carry-over contamination. Labelling of PCR products with digoxigenin (DIG) during the amplification reaction enables colorimetric assessment of hybridisation reactions. For solution hybridisation pestivirus-, BVDV- and CSFV-specific biotin-labelled capture probes were used. By serial dilutions of DIG-labelled PCR products the RT-PCR-ELISA was found to be 100-times more sensitive than the conventional agarose gel electrophoresis. Higher sensitivity of RT-PCR-ELISA detection using specific biotin-labelled probes offers the opportunity to eliminate strain specific nested PCR and to overcome the problems with contamination and false positive results.

Clinical significance of hepatitis C virus infection to alcoholics with cirrhosis in Korea

To investigate the prevalence and clinical significance of hepatitis C virus (HCV) infection and its relationship with the development of hepatocellular carcinoma (HCC), 162 consecutive alcoholic patients with cirrhosis were studied. Alcohol intake and parenteral risk factors were investigated by interview using a questionnaire. All patients had consumed at least 80 g alcohol/day for at least the past 5 years. Sera were tested for anti-HCV using a third-generation enzyme immunoassay (EIA), hepatitis B s antigen (HBsAg), anti-HBs, anti-HBc and anti-HIV. Serum HCV-RNA was detected by a one-tube reverse transcription-polymerase chain reaction (RT-PCR) method. Patients were classified into three groups accroding to the presence or absence of viral markers: (i) cases without anti-HCV or HBsAg (group A); (ii) cases with HBsAg only (group B); and (iii) cases with anti-HCV only (group C). Demographic and clinical findings were compared among the three groups. Anti-HCV was present in 17 cases (10.5%) and HBsAg was present in 47 cases (29%). No patient had both anti-HCV and HBsAg. Group C subjects were the oldest, but the duration of drinking in this group was similar to that of group A. There was no significant difference in the daily alcohol intake among the three groups. Previous surgical operations and tattooing were more frequent in group C. Only one patient in group C was an intravenous drug user. The combined rate of HCC was significantly higher in groups B and C than in groups A (34, 23.5 and 6.1%, respectively). Laboratory data showed a higher platelet count, higher albumin level, lower bilirubin level and lower aspartate aminotransferase/alanine aminotransferase ratio in group C patients than in the other two groups. Hepatitis C virus RNA was detected in 14 of 85 cases tested (16.5%), in 11 of 12 cases (91.7%) with anti-HCV and in three of 73 cases (4.1%) without anti-HCV. Hepatitis C virus infection is frequent in alcoholic patients with cirrhosis in Korea. Hepatitis C virus, as well as hepatitis B virus, infection may have a synergistic effect on the development of HCC in alcoholic patients.

A RT-PCR assay for the rapid recognition of border disease virus.

A reverse transcription--polymerase chain reaction (RT-PCR) method was developed for the specific detection of border disease virus (BDV), using the primers PBD1 and PBD2 flanking a 225 bp DNA fragment, selected from the 5'noncoding region of the pestivirus genome. In tests on 70 pestiviruses it was shown to be BDV-specific. A closed, one-tube nested RT-PCR method employing general pestivirus outer primers (324 and 326), and the same BDV-specific inner primers (PBD1 and PBD2) in conjunction with a BDV-specific fluorogenic TaqMan probe also detected only BDV and was more sensitive. BDV-specific RT-PCR was used in combination with a PCR specific for bovine viral diarrhoea virus type 2 (BVDV2) to ascertain whether virus stocks contained mixtures of BDV and BVDV2. It was shown that the ovine pestivirus strains 175375 and 59386 were originally BDV, but after subculture had become contaminated with BVDV2. This explains a previously reported discrepancy in the genetic typing of 59386. Although the BDV-specific RT-PCR can also detect BDV in clinical samples, the assay is likely to be most useful for the rapid typing of laboratory pestivirus strains.

One-tube fluorogenic reverse transcription-polymerase chain reaction for the quantitation of feline coronaviruses

A one-tube reverse transcription-polymerase chain reaction (RT-PCR) for absolute feline coronavirus (FCoV) quantitation was developed. The assay is based on the 5′ nuclease activity of the Thermus flavus (Tfl) polymerase and a fluorogenic probe which generates fluorescence when it is cleaved. The fluorogenic probe, also called TaqMan™ probe (Perkin Elmer, Foster City, USA), is an oligonucleotide designed to bind between the two PCR primers to the target cDNA and is labeled with a reporter and a quencher dye. In the intact probe, the quencher dye suppresses the fluorescence of the reporter dye by Förster-type energy transfer. During the polymerase extension steps the Tfl exonuclease activity cleaves the hybridised probe resulting in the generation of fluorescent emission of the reporter dye. The threshold cycle ( C T value) indicates the increase of reporter fluorescence and is directly related to the initial amount of target cDNA or RNA, respectively. Fluorescence is monitored in real time after each cycle by a Perkin-Elmer ABI Prism® 7700 Sequence Detector. After completion of amplification, the C T values of the samples are calculated back to a standard curve, generated by amplification of diluted standard molecules. The one-tube RT-PCR described below allows precise quantitation, is highly sensitive, rapid (no separate reverse transcription step and no post-amplification steps), easy to handle, allows for a high sample throughput, shows a very good reproducibility, and can be executed with a low risk of contamination. The design of the primers–probe combination enables the detection of all known FCoV strains and is also useful for the detection of canine coronavirus, transmissible gastroenteritis virus and porcine respiratory coronavirus.

Detection of Apple Stem Grooving Virus in Dormant Apple Trees with Crude Extracts as Templates for One-Step RT-PCR

Partial nucleotide sequences of amplification products obtained from four European apple stem grooving virus (ASGV) isolates using degenerate primers showed 80 to 85% similarity with the published ASGV sequence of a Japanese strain but 98 to 100% identities among themselves. Based on these sequences, two ASGV-specific primers (ASGV4F-ASGV4R) were designed to amplify a 574-bp fragment located in the putative viral RNA polymerase. With these primers, six European and five American ASGV isolates, maintained in herbaceous hosts (Chenopodium quinoa, Nicotiana glutinosa, and N. occidentalis) or in apple trees, were readily detected by reverse transcription-polymerase chain reaction (RT-PCR). Using these specific ASGV primers, dsRNA preparations have been shown to constitute good templates for reliable amplification of ASGV sequences from leaves and bark tissues of apple trees, both in a two-step RT-PCR protocol and in the one-step Titan One-Tube RT-PCR. System. Furthermore, the one-step RT-PCR system allowed a specific amplification of ASGV sequences directly from clarified crude extracts of leaves and bark tissues of apple trees during both active growth and the dormant season.

Simple one-tube reverse transcription-polymerase chain reaction protocol containing anticontamination procedure for detection of GB virus C/hepatitis G virus RNA

A simple one-tube reverse transcription-polymerase chain reaction protocol for detection of GB virus C/hepatitis G virus (GBV-C/HGV) RNA in serum samples containing anticontamination uracil- N-glycosylase procedure was developed. Amplification products were detected in a standard microtiter plate format using a commercial PCR ELISA kit (Boehringer Mannheim, Germany). Complete agreement between the results of a novel method and the previously determined GBV-C/HGV RNA status was obtained on 131 serum samples (76 GBV-C/HGV RNA positive and 55 GBV-C/HGV RNA negative samples). The novel method provides the potential for automated, simple, rapid and accurate routine detection of GBV-C/HGV RNA in diagnostic virological laboratories.

One-tube multiplex RT-PCR of BCR-ABL transcripts in analysis of patients with chronic myeloid leukaemia and acute lymphoblastic leukaemia

We describe a one-tube multiplex reverse transcription polymerase chain reaction (RT-PCR) assay for the detection of bcr-abl fusion mRNA in analysis of patients with chronic myeloid leukaemia and acute lymphoblastic leukaemia. The assay provides a quick and reliable method for the detection and analysis of chromosome translocations resulting in formation of the fusion proteins p210 (b3a2/b2a2) and p190 (e1a2). The method is based on the use of magnetic beads and sequence-specific reverse transcription primers. By combining direct mRNA isolation, reverse transcription and first-stage PCR we have reduced the number of manipulations, maintained sensitivity, and minimized the risk of contamination. A nested primer strategy is used to secure sensitivity. We also introduce a competitive one-tube RT-PCR to be able to monitor the relative quantity of transcripts using in vitro transcribed RNA as competitor.

5] Use of quantitative polymerase chain reaction to study retinoid receptor expression

Publisher Summary This chapter describes different methods employed for the expression analysis of various retinoid receptors. Different one-tube reverse transcription–polymerase chain reaction (RT–PCR) that assembles the reverse transcription reaction and the cyclic amplification reaction in a single tube are described. One of the protocols described exploits the reverse transcriptase activity of thermostable polymerases. In the presence of Mn 2+ ions the enzyme isolated from Thermus thermophilus (Tth polymerase) uses RNA as a template for DNA polymerization. In the second step of the one-tube reaction, Mn 2+ ions are sequestered by EGTA, a chelator with a high affinity for Mn 2+ as compared to Mg 2+ ; the latter ion and PCR primers are added to the diluted reaction mix and amplification of the cDNA produced can be performed in the same tube. Depending on the expression level of the receptors in the sample analyzed and on the amount of RNA used for the reaction, the cycle number of the first round of amplification can be adjusted and different amounts of the first round of amplification can be used as a template for the second round to calibrate the sensitivity of the system.