Olpidium Brassicae Research Articles

Crop rotation significantly influences the composition of soil, rhizosphere, and root microbiota in canola (Brassica napus L.)

BackgroundCrop rotation is an agronomic practice that is known to enhance productivity and yield, and decrease pest and disease pressure. Economic and other factors have increased the frequency of certain crops, including canola, with unknown effects on the below ground microbial communities that impact plant health and performance. This study investigated the effect of 12 years of crop rotation including canola-wheat; canola-pea-barley; and unrotated canola across three geographic sites in Western Canada with diverse soil types and environmental conditions. To provide data on mature, established crop rotation strategies, root exudate profiles, soil nutrient fluxes, and bacterial and fungal microbial community profiles were determined at the flowering stage in the final two (canola) years of the 12-year rotations.ResultsAfter 12 years of rotation, nutrient fluxes were affected in the soil in an inconsistent manner, with K, NO3, Mg, Ca, P, and Fe fluxes variably impacted by rotation depending on the year and site of sampling. As expected, rotation positively influenced yield and oil content, and decreased disease pressure from Leptosphaeria and Alternaria. In two of the three sites, root exudate profiles were significantly influenced by crop rotation. Bacterial soil, root, and rhizosphere communities were less impacted by crop rotation than the fungal communities. Fungal sequences that were associated with specific rotation strategies were identified in the bulk soil, and included known fungal pathogens in the canola-only strategy. Two closely related fungal sequences identified as Olpidium brassicae were extremely abundant at all sites in both years. One of these sequences was observed uniquely at a single site and was significantly associated with monocropped canola; moreover, its abundance correlated negatively with yield in both years.ConclusionsLong-term canola monoculture affected root exudate profiles and soil nutrient fluxes differently in the three geographic locations. Bacterial communities were less impacted by rotation compared to the fungal communities, which consistently exhibited changes in composition in all ecological niches at all sites, in both years. Fungal sequences identified as O. brassicae were highly abundant at all sites, one of which was strongly associated with canola monoculture. Soil management decisions should include consideration of the effects on the microbial ecosystems associated with the plants in order to inform best management practices.

Contrasting Responses of Rhizosphere Bacterial, Fungal, Protist, and Nematode Communities to Nitrogen Fertilization and Crop Genotype in Field Grown Oilseed Rape (Brassica napus)

The rhizosphere microbiome is considered to play a key role in determining crop health. However, current understanding of the factors which shape assembly and composition of the microbiome is heavily biased toward bacterial communities, and the relevance for other microbial groups is unclear. Furthermore, community assembly is determined by a variety of factors, including host genotype, environment and agricultural management practices, and their relative importance and interactions remain to be elucidated. We investigated the impact of nitrogen fertilization on rhizosphere bacterial, fungal, nematode and protist communities of 10 contrasting oilseed rape genotypes in a field experiment. We found significant differences in the composition of bacteria, fungi, protist and nematode communities between the rhizosphere and bulk soil. Nitrogen application had a significant but weak effect on fungal, bacterial, and protist community composition, and this was associated with increased relative abundance of a complex of fungal pathogens in the rhizosphere and soil, including Mycosphaerella sp. and Leptosphaeria sp. Network analysis showed that nitrogen application had different effects on microbial community connectivity in the soil and rhizosphere. Crop genotype significantly affected fungal community composition, with evidence for a degree of genotype specificity for a number of pathogens, including L. maculans, Alternaria sp., Pyrenopeziza brassicae, Olpidium brassicae, and L. biglobosa, and also potentially beneficial Heliotales root endophytes. Crop genotype had no significant effect on assembly of bacteria, protist or nematode communities. There was no relationship between genetic distance of crop genotypes and the extent of dissimilarity of rhizosphere microbial communities. Field disease assessment confirmed infection of crops by Leptosphaeria sp., P. brassicae, and Alternaria sp., indicating that rhizosphere microbiome sequencing was an effective indicator of plant health. We conclude that under field conditions soil and rhizosphere nutrient stoichiometry and crop genotype are key factors determining crop health by influencing the infection of roots by pathogenic and mutualistic fungal communities, and the connectivity and stability of rhizosphere microbiome interaction networks.

Relationships between yield, rotation length, and abundance of Olpidium brassicae and Pyrenochaeta sp. in the rhizosphere of oilseed rape

Oilseed rape yields in the UK have been found to decline with more frequent cropping in a rotation. Previously, two soil-borne organisms (Olpidium brassicae (Chytridiomycota) and Pyrenochaeta sp. (Ascomycota)) were identified as having high relative abundance in rhizosphere fungal communities associated with oilseed rape crops where yield decline had been recorded. In order to better understand these organisms' association with the oilseed rape crop, the current study was designed to investigate the fungal rhizosphere microbiome of oilseed rape grown in a wide range of rotational frequencies. Samples collected from a long-term rotation trial site at three time points through the growing season were used to determine fungal community composition, and quantification of O. brassicae and Pyrenochatea sp. Analyses showed the combined root and rhizosphere fungal communities were similar across all oilseed rape rotations, largely due to the high relative abundance of O. brassicae, irrespective of cropping frequency. Olpidium brassicae abundance peaked in March (mid-season) in all rotations, before declining in abundance by June (pre-harvest). In contrast, Pyrenochaeta sp. increased in abundance throughout the season, with significantly higher levels reached in June than earlier in the season. Pyrenochaeta sp. had a greater abundance early in the season (January) in continuously grown and alternate oilseed rape (grown one year in two) than in rotations with longer gaps between oilseed rape crops This study concludes that O. brassicae cannot be solely associated with yield decline of OSR observed in short rotation cropping due to its prevalence in the extended rotations examined (up to 6-year gap).

Plant-mediated effects of soil phosphorus on the root-associated fungal microbiota in Arabidopsis thaliana.

Summary Plants respond to phosphorus (P) limitation through an array of morphological, physiological and metabolic changes which are part of the phosphate (Pi) starvation response (PSR). This response influences the establishment of the arbuscular mycorrhizal (AM) symbiosis in most land plants. It is, however, unknown to what extent available P and the PSR redefine plant interactions with the fungal microbiota in soil.Using amplicon sequencing of the fungal taxonomic marker ITS2, we examined the changes in root‐associated fungal communities in the AM nonhost species Arabidopsis thaliana in response to soil amendment with P and to genetic perturbations in the plant PSR.We observed robust shifts in root‐associated fungal communities of P‐replete plants in comparison with their P‐deprived counterparts, while bulk soil communities remained unaltered. Moreover, plants carrying mutations in the phosphate signaling network genes, phr1, phl1 and pho2, exhibited similarly altered root fungal communities characterized by the depletion of the chytridiomycete taxon Olpidium brassicae specifically under P‐replete conditions.This study highlights the nutritional status and the underlying nutrient signaling network of an AM nonhost plant as previously unrecognized factors influencing the assembly of the plant fungal microbiota in response to P in nonsterile soil.

Canola Root-Associated Microbiomes in the Canadian Prairies.

Canola is one of the most economically important crops in Canada, and the root and rhizosphere microbiomes of a canola plant likely impact its growth and nutrient uptake. The aim of this study was to determine whether canola has a core root microbiome (i.e., set of microbes that are consistently selected in the root environment), and whether this is distinct from the core microbiomes of other crops that are commonly grown in the Canadian Prairies, pea, and wheat. We also assessed whether selected agronomic treatments can modify the canola microbiome, and whether this was associated to enhanced yield. We used a field experiment with a randomized complete block design, which was repeated at three locations across the canola-growing zone of Canada. Roots and rhizosphere soil were harvested at the flowering stage of canola. We separately isolated total extractable DNA from plant roots and from adjacent rhizosphere soil, and constructed MiSeq amplicon libraries for each of 60 samples, targeting bacterial, and archaeal 16S rRNA genes and the fungal ITS region. We determined that the microbiome of the roots and rhizosphere of canola was consistently different from those of wheat and pea. These microbiomes comprise several putative plant-growth-promoting rhizobacteria, including Amycolatopsis sp., Serratia proteamaculans, Pedobacter sp., Arthrobacter sp., Stenotrophomonas sp., Fusarium merismoides, and Fusicolla sp., which correlated positively with canola yield. Crop species had a significant influence on bacterial and fungal assemblages, especially within the roots, while higher nutrient input or seeding density did not significantly alter the global composition of bacterial, fungal, or archaeal assemblages associated with canola roots. However, the relative abundance of Olpidium brassicae, a known pathogen of members of the Brassicaceae, was significantly reduced in the roots of canola planted at higher seeding density. Our results suggest that seeding density and plant nutrition management modified the abundance of other bacterial and fungal taxa forming the core microbiomes of canola that are expected to impact crop growth. This work helps us to understand the microbial assemblages associated with canola grown under common agronomic practices and indicates microorganisms that can potentially benefit or reduce the yield of canola.

Stability and succession of the rhizosphere microbiota depends upon plant type and soil composition.

We examined succession of the rhizosphere microbiota of three model plants (Arabidopsis, Medicago and Brachypodium) in compost and sand and three crops (Brassica, Pisum and Triticum) in compost alone. We used serial inoculation of 24 independent replicate microcosms over three plant generations for each plant/soil combination. Stochastic variation between replicates was surprisingly weak and by the third generation, replicate microcosms for each plant had communities that were very similar to each other but different to those of other plants or unplanted soil. Microbiota diversity remained high in compost, but declined drastically in sand, with bacterial opportunists and putative autotrophs becoming dominant. These dramatic differences indicate that many microbes cannot thrive on plant exudates alone and presumably also require carbon sources and/or nutrients from soil. Arabidopsis had the weakest influence on its microbiota and in compost replicate microcosms converged on three alternative community compositions rather than a single distinctive community. Organisms selected in rhizospheres can have positive or negative effects. Two abundant bacteria are shown to promote plant growth, but in Brassica the pathogen Olpidium brassicae came to dominate the fungal community. So plants exert strong selection on the rhizosphere microbiota but soil composition is critical to its stability. microbial succession/ plant-microbe interactions/rhizosphere microbiota/selection.

First Report of Lettuce big-vein associated virus (Varicosavirus) Infecting Lettuce in Mexico

Lettuce (Lactuca sativa) is a common consumed vegetable and a major source of income and nutrition for small farmers in Mexico. This crop is infected with at least nine viruses: Mirafiori lettuce big-vein virus (MiLBVV), Lettuce big-vein associated virus (LBVaV), both transmitted by the soil-borne fungus Olpidium brassicae; Tomato spotted wilt virus (TSWV), Tomato chlorotic spot virus (TCSV), Groundnut ringspot virus (GRSV), Lettuce mottle virus (LMoV), Cucumber mosaic virus (CMV), Bidens mosaic virus (BiMV), and Lettuce mosaic virus (LMV) (1). From March to May 2012, a disease on lettuce was observed in the south region of Mexico City displaying mild to severe mosaic, leaf deformation, reduced growth, slight thickening of the main vein, and plant death. At the beginning of the epidemic there were just a few plants with visible symptoms and 7 days later the entire crop was affected, causing a loss of 93% of the plants. It was estimated by counting the number of severely affected or dead plants in three plots. No thrips, aphids, or whiteflies were observed in the crop during this time. Twenty plants with similar symptoms were collected and tested by RT-PCR using the primers LBVaVF 5'-AACACTATGGGCATCCACAT-3' and LBVaVR 5'-GCATGTCAGCAATCAGAGGA-3' specific for the coat protein gene of LBVaV, amplifying a 322-bp fragment. Primers CP829F 5'-CCWACTTCATCAGTTGAGCGCTG-3' and CP1418R 5'-TATCAGCTCCCTACACTATCCTCGC-3' were used to detect MiLBVV (2). No amplification was obtained for MiLBVaV in any plants tested. PCR products of approximately 300 bp were obtained from four out of 20 symptomatic lettuce samples tested for LBVaV, but not from healthy plant and water controls. These results suggest the presence of another virus in symptomatic lettuce plants. Amplicons were gel-purified and sequenced using LBVaVF and LBVaVR primers. A consensus sequence was generated using the Bioedit v. 5 program. Both sequences of these Mexican lettuce isolates were 100% identical (Accession Nos. KC776266.1 and KC776267.1) and had identities between 94 and 99% to all sequences of LBVaV available in GenBank. Additionally, when alignments were made using ClustalW, these sequences showed identities of 99.7% to Almeria-Spanish isolate (Accession No. AY581686.1); 99.4% to Granada-Spanish isolate (AY581689.1); 99.1% to Dutch isolate (JN710441.1), Iranian isolate (JN400921.1), Australian isolate (GU220725.1), Brazilian isolate (DQ530354.1), England isolate (AY581690.1), and American isolate (AY496053.1); 96.2% to Australian isolate (GU220722.1); 96.3% to Japanese isolate (AB190527.1); and 92.8% to Murcia-Spanish isolate (AY581691.1). Twenty lettuce plants were mechanically inoculated with leaf tissue taken from the four plants collected in the field and tested positive for LBVaV by RT-PCR; 12 days after inoculation, mosaic symptoms were observed in all inoculated plants and six of them were analyzed individually by RT-PCR obtaining a fragment of the expected size. To our knowledge, this is the first report of LBVaV infecting lettuce in Mexico. Further surveys and monitoring of LBVaV incidence and distribution in the region, vector competence of olpidium species, and impact on the crop quality are in progress.

Distribution of Lettuce Big-Vein Incidence Under Three Irrigation Systems.

Spatial patterns of lettuce big-vein (LBV) incidence under furrow, sprinkler, and subsurface drip irrigation systems were determined. Because LBV pathogen is a virus and is vectored by the soilborne chytrid Olpidium brassicae, different irrigation systems likely affect the movement of the vector and were hypothesized to result in different distribution patterns and levels of the disease. Lettuce plants were mapped by recording the location of each LBV-infected or healthy plant in arbitrarily selected plots of sizes 16 by 30, 20 by 30, and 18 by 50 m in Salinas, Gonzales, and Santa Maria in California. Data were arrayed into different quadrat sizes by rearrangement, and disease incidence was calculated for each quadrat. Frequency distribution analysis and spatial autocorrelation analyses were performed on this data. LBV incidence was aggregated in all furrow-irrigated fields, four of five subsurface drip-irrigated fields, and two of three sprinkler-irrigated fields. The remaining fields had a random distribution. As the quadrat size increased, index of aggregation decreased, and vice versa. In fields under sprinkler irrigation, regardless of whether the spatial pattern of LBV was random or aggregated, no directional orientation occurred. However, under furrow or subsurface drip irrigation, the aggregation mostly occurred across the rows. Although irrigation type influenced LBV distribution pattern and incidence in lettuce fields, the differential effects of irrigation type on vector O. brassicae could not be discerned in this study. The sprinkler irrigation practiced in lettuce production until thinning may influence the vector distribution and the subsequent irrigation methods adapted for the remainder of the season in individual fields may play a significant role in disease incidence.

First Report of Freesia sneak virus in Commercial Freesia hybrida Cultivars in Korea

In order to investigate the virus infection rate of commercial freesia cultivars in early February 2013, 19 freesia cultivars showing necrotic purple speckles or streaks on leaves, purple streaks parallel to the midrib, and necrotic speckles on leaves were collected from three different regions (Suwon and Icheon in Gyeonggi Province and Jeonju in North Jeonla Province) and used for virus detection. Nucleic acid extracts were analyzed for detection of major freesia-infecting viruses including Freesia sneak virus (FreSV) by reverse transcription (RT)-PCR with specific primer pairs. The FreSV CP gene was amplified using primer pair FreSV-F (5'-TTAGATAGTGAATCCATAAGCTGC-3') and FreSV-R (5'-ATGTCTGGAAAATACTCCGTCCAA-3'). The approximately 1.3-kb fragment of the FreSV amplified product was cloned and sequenced (GenBank Accession No. KC771891 to 98). The nucleotide sequences of CP gene of FreSV korean isolates showed 99.2 to 99.8% similarity to other FreSV isolates DQ885455, FJ807730, and GU071089, which are registered in GenBank. FreSV was detected from 71.7% of 138 plants tested while the infection rate of Freesia mosaic virus (FreMV) was 34.8%. Neither Bean yellow mosaic virus (BYMV) nor Tobacco rattle virus (TRV) were detected from any plants tested in this study. In certain cultivars, such as 'Bluebau' (II) and 'Pretty women,' most plants planted in the field showed purple streak symptoms on the leaves. In conclusion, FreSV was detected from some symptomatic freesia cultivars showing purple streak or speckles on leaves with or without necrotic spots and necrotic speckles on leaves. FreSV is currently widespread in Korea and some freesia plants were mixed infected with FreMV. FreSV has been occurring in the Netherlands for over 40 years (2). It is a plant virus in the family Ophioviridae and Ophiovirus genus. Once it occurs in freesia plantation fields, eradication is almost impossible because FreSV is transmitted by zoospores of Olpidium brassicae, which is a soilborne root-infecting fungus (3). Resting spores of O. brassicae can remain dormant in the soil and can be infective for 20 years (1). To produce virus-free freesia plants, growers should consider whether or not their fields are contaminated with O. brassicae carrying FreSV. To our knowledge, this is the first report of FreSV in freesia plants in Korea.

First Report of Freesia sneak virus Associated with Foliar Necrosis of Freesia refracta in Bulgaria.

In the early spring of 2011 and 2012, severe necrotic leaf symptoms were observed on freesia (Freesia refracta, family Iridaceae) in several greenhouses around Plovdiv (south central Bulgaria). The disease spread and symptom severity in several cultivars (Medeo, Calvados, and Pink Fountain) led to nearly complete production failure for some growers. Initial symptoms consisted of scattered pale, chlorotic, interveinal lesions that coalesced. Later, irregular brown to black necrotic blotches partially covered the leaves. Flower break was also observed. Diseased plants were collected in late April 2012 from one of the surveyed greenhouses, where >90% of Medeo (white-flowered) and 35 to 40% of Pink Fountain (pink) plants were symptomatic. Total RNA was extracted from three pooled samples of ~10 plants each and analyzed for Freesia sneak virus (3) (FreSV, Ophiovirus, Ophioviridae) infection by RT-PCR. A generic Ophiovirus RT-PCR (4) yielded the diagnostic 136-bp product, while primers FOV1 (TGCTCGAATAGCCGGAACTGAA) and FOV2 (TGCTTCCAGGTGTAAGATGGCA), designed from the Italian FreSV coat protein gene (RNA3; GenBank DQ885455), specifically amplified a 466 bp fragment. This FreSV-specific fragment was amplified from all samples, pooled, purified, and subjected to direct sequencing using the same primers. The deduced amino acid sequence had 99.8% identity to that of DQ885455, confirming FreSV infection in the symptomatic Bulgarian freesias. FreSV RNA3 (about 1.5 kbp) was also detected by northern blotting using a specific Digoxigenin-DNA probe (PCR-DIG Probe Synthesis Kit, Roche) amplified with primers FOV1/2. Due to severe symptoms present on freesias, a mixed infection was suspected. Several other viruses have been reported to infect cultivated freesia (1), so diagnostic primers for Cucumber mosaic virus (CMV, Cucumovirus, Bromoviridae), Tobacco rattle virus (TRV, Tobravirus, Virgaviridae), and Potyvirus genus (4) were used in RT-PCR assays with random-primed cDNA from infected freesias as the template. No CMV or TRV PCR products were detected; a generic potyvirus PCR product was identified as Freesia mosaic virus (FreMV, Potyvirus, Potyviridae) by sequencing of five independent clones. Severe leaf necrosis syndrome was described in freesia in The Netherlands before 1970, as well as in England and Germany; FreSV is a putative agent of freesia leaf necrosis, being reported in strong association with the disease in Italy, The Netherlands, the United States, and New Zealand, and also infects Lachenalia hyb. (Hyacinthaceae) (2,3,4). However, additional unidentified synergistic viral agents cannot be ruled out and must be identified to aid control of soilborne severe leaf necrosis syndrome. The vector of FreSV, Olpidium brassicae, may persist in soil for years (3). To our knowledge, this is the first report of FreSV on F. refracta in Bulgaria; identifying the disease and vector may allow growers to implement preventive control measures to reduce economic damage.

A Brief Outline of Infectious Diseases of Olive

Abstract: Virus infections of olive (Olea europaea), to which littte attention has been paid up to a relatively recent past, are surprisingly widespread, as shown by: (i) the very high presence (above 50% in average) of double-stranded ribonucleic acids (dsRNAs) in the plants analysed in the course of field surveys carried out especially in the Mediterranean and Middle Eastern countries; (ii) the identification in these plants of 15 different viruses with diverse taxonomic allocation. Infections are generally symptomless. When shown, symptoms consist of deformations of fruits and leaves and of foliar discolourations ranging from chlorosis to bright yellowing. “Bumpy fruits” and the “Leaf yellowing complex” are the only two diseases whose viral aetiology seems to be convincingly ascertained. Virus identification is not based on biotests (mechanical transmission to herbaceous hosts is unreliable and there are no differential woody indicators available) nor on immunoenzymatic assays (ELISA), which are also unreliable, but on nucleic acid-based techniques (various RT-PCR protocols). The economic impact of infections has not been determined although recent reports indicate that some viruses seem to affect the yield and the quality of the oil. For an ultimate answer, a comparison needs to be done between selected and sanitazied accessions and their infected counterparts. Equally scanty is the information on the epidemiology of olive-infecting viruses, except for three necroviruses (OLV-1, TNV-D and OMMV), whose transmission through soil, direct or mediated by Olpidium brassicae, has been experimentally ascertained. Olive latent virus 1 (OLV-1) and Cherry leafroll virus (CLRV) are transmitted through seeds and seedlings and, like all the other viruses, with propagating material (nursery productions), which is the major responsible for their worldwide distribution. Viral infections have been detected in 22 countries in the five continents. Preventive control through certification schemes is desirable. One of such schemes designed and implemented in Italy, is based on the pomological and sanitary selection and sanitation of mother stocks.

A Brief Outline of Infectious Diseases of Olive

Abstract: Virus infections of olive (Olea europaea), to which littte attention has been paid up to a relatively recent past, are surprisingly widespread, as shown by: (i) the very high presence (above 50% in average) of double-stranded ribonucleic acids (dsRNAs) in the plants analysed in the course of field surveys carried out especially in the Mediterranean and Middle Eastern countries; (ii) the identification in these plants of 15 different viruses with diverse taxonomic allocation. Infections are generally symptomless. When shown, symptoms consist of deformations of fruits and leaves and of foliar discolourations ranging from chlorosis to bright yellowing. “Bumpy fruits” and the “Leaf yellowing complex” are the only two diseases whose viral aetiology seems to be convincingly ascertained. Virus identification is not based on biotests (mechanical transmission to herbaceous hosts is unreliable and there are no differential woody indicators available) nor on immunoenzymatic assays (ELISA), which are also unreliable, but on nucleic acid-based techniques (various RT-PCR protocols). The economic impact of infections has not been determined although recent reports indicate that some viruses seem to affect the yield and the quality of the oil. For an ultimate answer, a comparison needs to be done between selected and sanitazied accessions and their infected counterparts. Equally scanty is the information on the epidemiology of olive-infecting viruses, except for three necroviruses (OLV-1, TNV-D and OMMV), whose transmission through soil, direct or mediated by Olpidium brassicae, has been experimentally ascertained. Olive latent virus 1 (OLV-1) and Cherry leafroll virus (CLRV) are transmitted through seeds and seedlings and, like all the other viruses, with propagating material (nursery productions), which is the major responsible for their worldwide distribution. Viral infections have been detected in 22 countries in the five continents. Preventive control through certification schemes is desirable. One of such schemes designed and implemented in Italy, is based on the pomological and sanitary selection and sanitation of mother stocks.

Impact of shortened crop rotation of oilseed rape on soil and rhizosphere microbial diversity in relation to yield decline.

Oilseed rape (OSR) grown in monoculture shows a decline in yield relative to virgin OSR of up to 25%, but the mechanisms responsible are unknown. A long term field experiment of OSR grown in a range of rotations with wheat was used to determine whether shifts in fungal and bacterial populations of the rhizosphere and bulk soil were associated with the development of OSR yield decline. The communities of fungi and bacteria in the rhizosphere and bulk soil from the field experiment were profiled using terminal restriction fragment length polymorphism (TRFLP) and sequencing of cloned internal transcribed spacer regions and 16S rRNA genes, respectively. OSR cropping frequency had no effect on rhizosphere bacterial communities. However, the rhizosphere fungal communities from continuously grown OSR were significantly different to those from other rotations. This was due primarily to an increase in abundance of two fungi which showed 100% and 95% DNA identity to the plant pathogens Olpidium brassicae and Pyrenochaeta lycopersici, respectively. Real-time PCR confirmed that there was significantly more of these fungi in the continuously grown OSR than the other rotations. These two fungi were isolated from the field and used to inoculate OSR and Brassica oleracea grown under controlled conditions in a glasshouse to determine their effect on yield. At high doses, Olpidium brassicae reduced top growth and root biomass in seedlings and reduced branching and subsequent pod and seed production. Pyrenochaeta sp. formed lesions on the roots of seedlings, and at high doses delayed flowering and had a negative impact on seed quantity and quality.

Organic fertilization alters the community composition of root associated fungi in Pisum sativum

Organic fertilization is well known to affect individual functional groups of root associated fungi such as arbuscular mycorrhizal (AM) fungi and root pathogens, but limited information is available on the effect of organic fertilization at the fungal community composition level. The main objective of the present study was to examine the response of communities of root associated fungi in Pisum sativum to Protamylasse, an organic fertilizer used in pea production. Plants were grown in pots with field soil amended with four different levels of Protamylasse. 454 pyrosequencing was employed to examine diversity of root associated fungi and revealed in total 164 non-singleton operational taxonomic units (OTUs). Principle component analysis (PCA) showed response of fungal community structure of the 15 most abundant OTUs to the four fertilization levels. Obligate biotrophic fungi such as the AM fungi Glomus mosseae and Glomus caledonium, and the chytridiomycete Olpidium brassicae markedly increased in relative abundance with increasing levels of Protamylasse, whereas the relative abundance of the facultative pathogen Fusarium oxysporum decreased with increasing levels of Protamylasse. In conclusion, the organic fertilizer Protamylasse clearly affects communities of root associated fungi, which seems to be linked to the life strategy of the different functional groups of root associated fungi.

Occurrence and Partial Characterization of Lettuce big vein associated virus and Mirafiori lettuce big vein virus in Lettuce in Iran.

Mirafiori lettuce big vein virus (MiLBVV) and lettuce big vein associated virus (LBVaV) were found in association with big vein disease of lettuce in Iran. Analysis of part of the coat protein (CP) gene of Iranian isolates of LBVaV showed 97.1-100% nucleotide sequence identity with other LBVaV isolates. Iranian isolates of MiLBVV belonged to subgroup A and showed 88.6-98.8% nucleotide sequence identity with other isolates of this virus when amplified by PCR primer pair MiLV VP. The occurrence of both viruses in lettuce crop was associated with the presence of resting spores and zoosporangia of the fungus Olpidium brassicae in lettuce roots under field and greenhouse conditions. Two months after sowing lettuce seed in soil collected from a lettuce field with big vein affected plants, all seedlings were positive for LBVaV and MiLBVV, indicating soil transmission of both viruses.

The relationship of Olpidium brassicae (Wor.) Dang. to the big-vein disease of lettuce

Summary Inoculation of lettuce with tobacco-necrosis virus isolated from big-vein plants did not cause big-vein symptoms. Olpidium brassicae was always found in roots of lettuce grown in big-vein-infected soil but not in two gardens where big vein did not occur. Olpidium resting spores were sedimented from big-vein root sap by low-speed centrifuging. Inoculation of lettuce with resuspended sediment produced big-vein symptoms while inoculation with the supernatant liquid did not. Veronica tournefortii Gmel., Stellaria media (L) Vill., and Spergula arvensis L. were found to be hosts of O. brassicae. Inoculation of lettuce with root sap of these species gave rise to big-vein symptoms. Soil treatment with captan, phygon, copper oxychloride, and thiram, all reduced incidence of big vein. These results suggest that O. brassicae is the cause of big-vein disease of lettuce.

Biology and molecular characterization of necroviruses affecting Olea europaea L.: a review

Three necroviruses, family Tombusviridae, are known to infect Olea europaea L., Olive latent virus 1 (OLV-1), Olive mild mosaic virus (OMMV) and Tobacco necrosis virus D (TNV-D), often asymptomatically. OLV-1 has a wide geographical distribution whereas that of OMMV and TNV-D is not known as their discovery is recent, dating from 2005 and 2009, respectively. OMMV has received special attention because of its origin, likely to have resulted from a recombination event between TNV-D, with which it shares a coat protein (CP) amino acid identity of 86% and OLV-1 sharing an RNA-dependent RNA polymerase amino acid identity of 91%. Due to these properties OMMV and TNV-D are indistinguishable by serology or Reverse Transcription – Polymerase Chain Reaction assays that use primers hybridizing in the CP gene region, rendering ambiguous earlier TNV-D identifications based on such tests. OLV-1 and OMMV are transmitted through the soil to roots of host plants in the absence of any vectors but the transmission rate of OMMV increases to more than double in the presence of Olpidium brassicae zoospores that vector this virus in an in vitro manner. A point mutation leading to an amino acid substitution located in an inner region of the virion is responsible for the loss of biologically assisted transmission, probably by altering the particle conformation rendering the binding site inaccessible to the zoospore receptors. The field occurrences of necrovirus multiple infections are common and increase the chances for recombination events, the epidemiological implications of which are still uncertain. The biological and molecular properties of the necroviruses identified in olive trees are the main focus of this review.

NEW INSIGHTS IN FREESIA LEAF NECROSIS DISEASE

Although freesia leaf necrosis disease (FLN) is known in freesia cultures for over forty years, the causal agent(s) is/are still under investigation. In plants with FLN symptoms a virus belonging to the genus Ophiovirus was found; this virus is now known as Freesia sneak virus (FreSV). The virus was mechanically inoculated to and artificially maintained in host plants and purified from these plants. An antiserum was raised and an ELISA-based detection method for FreSV was developed. Mechanical inoculation from indicator plants to freesia seedlings was never successful. Transmission of FreSV using resting spores from Olpidium brassicae was tested to establish whether FreSV is the cause of FLN. The detection of FreSV was evaluated in several surveys using freesias with symptoms (66 lots), without symptoms (98 lots) and by random testing (45 lots). More than 40 different cultivars were surveyed. FreSV was found associated with FLN symptoms, although not in all the freesia lots with FLN-like symptoms. In such lots often Freesia mosaic virus (FreMV) was present and in some lots neither FreSV nor FreMV could be detected. Implications of these findings will be discussed

Specific amino acids of Olive mild mosaic virus coat protein are involved in transmission by Olpidium brassicae

Transmission of Olive mild mosaic virus (OMMV) is facilitated by Olpidium brassicae (Wor.) Dang. An OMMV mutant (OMMVL11) containing two changes in the coat protein (CP), asparagine to tyrosine at position 189 and alanine to threonine at position 216, has been shown not to be Olpidium brassicae-transmissible owing to inefficient attachment of virions to zoospores. In this study, these amino acid changes were separately introduced into the OMMV genome through site-directed mutagenesis, and the asparagine-to-tyrosine change was shown to be largely responsible for the loss of transmission. Analysis of the structure of OMMV CP by comparative modelling approaches showed that this change is located in the interior of the virus particle and the alanine-to-threonine change is exposed on the surface. The asparagine-to-tyrosine change may indirectly affect attachment via changes in the conformation of viral CP subunits, altering the receptor binding site and thus preventing binding to the fungal zoospore.

Evidence of olive mild mosaic virus transmission by Olpidium brassicae

Transmission of three strains of OMMV by an Olpidium sp. was evaluated and compared. The three strains were 1) an OMMV wild type (WT) recovered from olive trees, 2) an OMMV variant (L11) obtained after 15 serial passages of single local lesions induced in Chenopodium murale plants, and 3) a construct OMMV/OMMVL11 in which the coat protein (CP) gene replaced that of the wild type. A single-sporangial culture derived from Chinese cabbage (Brassica pekinensis) used as a bait plant grown in soil of an olive orchard, was identified as Olpidium brassicae based on the size and sequence of the generated amplicon in PCR specific tests. Each of the three virus strains was soil transmitted to cabbage roots in the absence of the fungus at similar rates of 30 to 40%. Separate plant inoculation by O. brassicae zoospores incubated with each viral strain resulted in enhanced transmission of OMMV, reaching 86% of infection whereas that of the other two strains remained practically unaffected at ca. 34%. Binding assays showed that the amount of virus bound to zoospores, estimated spectrophotometrically, was 7% in the case of OMMV, and practically nil in the case of the other two viral strains. Substitution of the coat protein (CP) gene of OMMV by that of the OMMV L11 strain, drastically reduced viral transmissibility in the presence of zoospores to the level of that observed in their absence. Our data shows that OMMV soil transmission is greatly enhanced by O. brassicae zoospores and that the viral CP plays a significant role in this process, most likely by facilitating virus binding and later entrance into the host plant roots.