Okra In India Research Articles

Copy number variation of two begomovirus acquired and inoculated by different cryptic species of whitefly, Bemisia tabaci in Okra.

The whitefly, B.tabaci is a major pest of agricultural crops which transmits begomovirus in a species-specific manner. Yellow vein mosaic disease (YVMD) and okra leaf curl disease (OLCD) caused by distinct begomovirus are a major limitation to production of okra in India. In this framework the present investigation reports, for the first time, comparative study of begomovirus species viz. yellow vein mosaic virus (YVMV) and okra enation leaf curl virus (OELCuV) ingested and egested by two cryptic species (Asia I and Asia II 5) of B.tabaci at different time interval using detached leaf assay. A gradual increase of both virus copies were observed with increased feeding exposure in Asia I and Asia II 5. Both the genetic groups of whitefly could acquire the viruses within just 5 minutes of active feeding however, a significant amount of variation was noted in virus uptake by the both. At 24 hours of active feeding Asia II 5 acquired more of YVMV whereas, Asia I ingested more OELCuV. Similarly, the genetic group acquiring higher titre of virus egested higher amount during inoculation period. On the whole, it can be presumed that Asia I is a more effective transmitter of OELCuV whereas, Asia II 5 of YVMV further suggesting increased risk of virus pandemics (both YVMV and OELCuV) in regions where Asia I and Asia II 5 is dominant.

Phenotypic screening of cultivated and wild okra germplasm against yellow vein mosaic and enation leaf curl diseases of okra in India

Okra yellow vein mosaic (OYVMD) and enation leaf curl diseases (OELCuD) caused by whitefly (Bemisia tabaci) transmitted begomoviruses are important constraint for improvement and production okra in India. Okra germplasms consists of 178 cultivated/advanced lines (147 Advances okra lines + 31 popular varieties) and 146 accessions from 14 wild species originally collected from different national institutes located at different agro-climatic zones of India were evaluated for their response against OYVMD and OELCuD. The resistance levels both cultivated and wild species were assessed by visual scoring of symptoms in the field under natural conditions for two consecutive years in 2015 and 2016. None of the cultivated genotypes and wild species tested was found to be disease free except Abelmoschus enbeepeegeearnse, however, considerable variation in responses against OYVMD and OELCuD was observed among the genotypes. Of the 178 cultivated/advanced lines screened against OYVMD and OELCuD, seven genotypes showed highly resistant, one resistant, 2 moderately resistant and 146 accessions from 14 wild species, 17 accessions were showed highly resistant reaction, one accession resistant, 5 accessions moderately resistant for OYVMD. Similarly, for OELCuD, fifty-two okra genotypes showed highly resistant, three moderately resistant in cultivated/advanced lines and 125 accessions were found to be highly resistant, two resistant and three moderately resistant in wild accessions. The resistance cultivated/advanced lines could be used directly as varieties to manage OYVMD and OELCuD after adaption to various agro-climatic regions. The resistance in wild accessions could be used in future breeding programmes to develop okra cultivars resistant against both OYVMD and OELCuD.

Identification of Elite Parental Lines in Cultivated and Wild Okra (Abelmoschus esculentus L. Moench) Accessions for Yellow Vein Mosaic Virus Disease Resistance Using Multivariate Analysis

Yellow vein mosaic virus (YVMV) is the most destructive viral disease of okra, has become a limiting factor in the successful cultivation and production of okra in India, resulting in yield losses ranging from 17.09 to 96.49 per cent. As a result, it is critical that breeders continue to develop superior varieties or hybrids with long-lasting resistance to overcome this major devastating disease. In this context present investigation was carried with 74 elite okra lines to discover potential parents for a resistance breeding programme. On the basis of D2 values the 74 genotypes were divided into seven groups. Cluster I constituted the highest number of genotypes followed by cluster II, III, IV, V, VI and VII. The traits per cent disease index of YVMV contributed maximum towards divergence followed by total phenolic content, peroxidase activity, fruit yield per plant, number of primary branches and number of fruit per plant. PCA showed four principal components with Eigen values more than one viz., 3.87, 3.21, 1.89 and 1.64 and accounted 81.56 per cent of the total genetic variation. Principal component analysis revealed that PC1 captured potential traits viz., total phenolic content, peroxidase activity, polyphenol oxidase, number of fruits per plant, number of primary branches per plant and fruit yield per plant, which could be used in future breeding programmes for high yield and YVMV resistance. The present study it was revealed that, eleven accessions viz., AE-65, AE-66, AE-CBE-921, Pusa Bhendi-5, SB-2, IC112449, AE-CBE-94, AE-CBE-943, AE-CBE-934, AE-CBE-92 and AE-CBE-93 appeared to be very promising lines for future use in resistant breeding programmes

DETERMINATION OF SPIROMESIFEN, QUINOLPHOS, MONOCROTOPHOS, CARBENDAZIM AND ACEPHATE RESIDUE BEHAVIOUR IN OKRA (ABELMOSHUS ESCULENTUS) BY LIQUID CHROMATOGRAPHY AND MASS SPECTROPHOTOMETRY AND THEIR DECONTAMINATION USING HOUSE HOLD PROCESSES

Objective: Field experiments were conducted at Agricultural University, Rajendra Nagar, Hyderabad, Telanagana to study the dissipation kinetics of carbendazim, monocrotophos, spiromesifen, acephate and quinalphos in okra fruit. Decontamination study was also conducted to evaluate quality of okra pods by reducing the residues of carbendazim, monocrotophos, spiromesifen, acephate and quinalphos by using different processes such as 2% salt solution, acetic acid, biowash, butter milk, cooking, drying, Formula 1(T7), frying, lemon water, sodium bicarbonate, tamarind water and tap water.
 Methods: All the pesticide residues with one test dose at two spray i.e., first spray at flowering stage and second spray after an interval of ten days was carried out. The samples drawn at specific periods were analyzed by liquid chromatography and mass spectrophotometry (LC-MS/MS).
 Results: The initial deposit of carbendazim, monocrotophos, spiromesifen, acephate and quinalphos in okra was found to be 2.239, 2.586, 2.401, 1.39, 0.78 mg/kg respectively. More than 98 % of carbendazim, spirofesifin, acephate and quinolphos dissipated after 15 d and monocrotophos was dissipated after 10 d. Sodium bicarbonate and 2% salt solution are the best methods for decontamination after cooking. The decontamination values of frying and formula 1 seems to be almost same. After these two methods biowash thought to be the method of choice.
 Conclusion: These results are helpful in setting up maximum residual limit (MRLs) of these pesticides in okra in India. From the results, it could be recommended that cooking suits best for almost all of the pesticide residues.

Development and method validation for determination of 54 pesticides in Okra by LC-MS/MS analysis

The presence of pesticide residues in primary and derived agricultural products raises serious health concerns for consumers across the globe. The aim of the present study was to assess the level of pesticide residues in Okra in India. A multi-residue method for the quantification of fifty-four pesticides in okra is described in this work. The present study employed a modified quick, easy cheap, effective rugged and safe (QuEChERS) extraction procedure followed by UHPLC-MS/MS (Ultra-High-Performance Liquid Chromatography coupled to Tandem Mass Spectrometry) analysis. Validation of the method was according to the guidelines given by European Union SANCO/12571/2013. The levels of validation were 10.0, 50.0 and 100 µg kg-1. The following parameters such as linearity, the limit of detection (LOD) (nearer to 0.005 mg kg-1) and limit of quantification (LOQ) (nearer to 0.01 mg kg-1) were set to be acceptable. The trueness of the method for 54 pesticides in all Okra commodities was between 80-110% with satisfactory repeatability and within-run reproducibility except for the pesticide residues such as Thiamethoxam and Fenamidone. The measurement of uncertainty for each of the pesticide was below 50% and was estimated to be in the range of 5.37% - 10.71%, which meets the criteria established in the SANCO/12571/2013 document (European Union, 2013). This method is concluded to be applicable for the determination of pesticide residues in Okra.

Recombinant Tomato leaf curl New Delhi virus is associated with yellow vein mosaic disease of okra in India

Okra is the important vegetable crop grown across tropical and subtropical regions of the world. Yellow vein mosaic (YVMD) and enation leaf curl (ELCuD) diseases caused by begomoviruses are the major threat for cultivation and production of okra in India. Survey conducted between 2006 and 2010 revealed the incidence of begomovirus diseases ranged from 55 to 90% in okra growing states (ten states and two union territories) of the country. Three hundred forty-three okra leaf samples showing symptoms such as yellow mosaic, vein thickening, petiole bending, complete yellowing and upward leaf curling of leaves were collected from the surveyed locations across India. The PCR detection for begomovirus in the okra samples and subsequent cloning of partial genome sequencing of DNA A (1.2 kb fragment) indicated, 290 samples are associated with monopartite virus and 53 samples were associated with bipartite virus. Among the isolates showing highest identity with ToLCNDV, one isolate from each from five states was selected for amplification of full-length genomes (both DNA A and DNA B). The sequence analysis of DNA A and B components of five isolates revealed presence of nucleotide (nt) identity of >90% with ToLCNDV infecting tomato, eggplant, and potato. Phylogenetic and recombination analysis indicated that both DNA A and DNA B components of ToLCNDV infecting okra has the recombinant origin from BYVMV, ToLCNDV, and SLCCNV as the foremost parents. Further, dot blot hybridization for detection of ToLCNDV was developed for using CP and NSP gene probe. This is the first report of ToLCNDV associated with yellow vein mosaic disease of okra in India.

DNA-A sequences of whitefly transmitted begomovirus infecting okra (Abelmoschus esculentus) in India are extensively diverse

Okra or bhendi (Abelmoschus esculentus) is one of the most popular and widely grown vegetable crops in India. Whitefly (Bemisia tabaci) transmitted begomoviruses cause heavy economic loss in the okra cultivation in India. In the present study, full length annotated DNA-A (~ 2.7 kb) sequences of 134 begomoviruses infecting okra in India available in NCBI database were retrieved, analyzed and compared following with other begomovirus sequences. The sequence analysis reveals extensive genetic diversity among the begomoviruses infecting okra in India showing 69–100% nt identity among them. The present phylogenetic analysis displays an extensive genetic diversity among begomoviruses infecting okra in India showing occurrence of at least 14 Types begomoviruses. Majority of the present sequences fell into two major Types; 45 sequences into Type-5 i.e., Bhendi yellow vein mosaic virus (BYVMV-[IN-Mah-NOL751]EU589392) strain and 44 sequences into Type-9 i.e., BYVMV-Har[IN-Har-07]FN645923 and/or BYVMV-IN[IN-Mad]AF241479 strain. Five Indian sequences fell into Type-7 i.e., BYVMV-TN[IN-Coi4-04]FJ179372 and/or BYVMV-[PK-Fai201-95]AJ002451 strain and eight sequences into Type 1 i.e., Okra enation leaf curl virus (OELCuV,GU111996). Four sequences in Type-13 i.e., Tomato leaf curl New Delhi (ToLCNDV), three in Type-6 i.e., Cotton leaf curl Alabad (CLCuAlV), two in Type 14 i.e., Bhendi yellow vein mosaic Bhubaneswar (BYVBhV) and three in Type-2 i.e., Mesta yellow vein mosaic virus (MeYVMV). The other sequences were distributed into another six distinct types or putative species. Recombination analysis showed that most of the present begomovirus types identified were recombinants. The present study reports that DNA-A sequences of begomovirus infecting okra in India are extensively diverse and originated from recombination events involving diverse begomovirus sequences.

Diverse and recombinant begomoviruses and various satellites are associated with Bhendi yellow vein mosaic disease of okra in India

Bhendi/Okra, a common vegetable in the Indian subcontinent, is highly susceptible to the viral disease Bhendi yellow vein mosaic disease (BYVMD), resulting in considerable yield loss to the crop. As a first step towards formulating novel strategies against BYVMD, the identities of the viruses and associated satellite molecules were investigated in BYVMD-affected okra leaf samples taken from ten widely separated locations in India. The amplified nucleotide sequence representing the viral coat protein from the samples indicated the presence of the begomoviruses Bhendi yellow vein mosaic virus (BYVMV) in seven and Mesta yellow vein mosaic virus (MeYVMV) in three samples. Subsequent analysis of the full-length viral sequences revealed the presence of a recombinant viral DNA, having MeYVMV and Malvastrum yellow vein Yunnan virus (MYVYNV), a virus not previously reported from India, as parents. Betasatellite sequences were very similar to previous reports. Analysis of the symptomatic samples by Rolling circle amplification showed, in addition to BYVMV-like sequences, begomoviral sequences reported earlier from cotton and mint and alphasatellites reported previously from cotton and Cyamopsis tetragonoloba were also present. This study indicated that the diversity of begomoviruses and satellites associated with BYVMD is much higher than previously thought.

Evidence for two predominant viral lineages, recombination and subpopulation structure in begomoviruses associated with yellow vein mosaic disease of okra in India

Yellow vein mosaic disease (YVMD) caused by whitefly‐transmitted begomoviruses is an economically significant viral disease of okra. In this study, a survey of begomoviruses associated with YVMD was carried out in eight states and two union territories of India. A total of 92 full‐length DNA‐A components were sequenced and characterized. Sequence comparisons and population structure analysis revealed the existence of four begomovirus species. Two novel species were detected with several recombinationally derived genome fragments that probably originated from begomoviruses known to infect malvaceous and non‐malvaceous hosts. Among the four species, Bhendi yellow vein Maharastra virus (BYVMaV) and Bhendi yellow vein Madurai virus (BYVMV) were found to be predominant in okra, with BYVMV having a pan‐India distribution. There was evidence for a high degree of genetic variability and subpopulation structure within these four species. Neutrality tests suggested the occurrence of purifying selection acting upon these populations. The results of the current study have uncovered the diversity and genetic structure of okra‐infecting begomoviruses in India and generated potentially useful information for developing management strategies for YVMD.

Association of a recombinant Cotton leaf curl Bangalore virus with yellow vein and leaf curl disease of okra in India.

A begomovirus isolate (OY136A) collected from okra plants showing upward leaf curling, vein clearing, vein thickening and yellowing symptoms from Bangalore rural district, Karnataka, India was characterized. The sequence comparisons revealed that, this virus isolate share highest nucleotide identity with isolates of Cotton leaf curl Bangalore virus (CLCuBV) (AY705380) (92.8%) and Okra enation leaf curl virus (81.1-86.2%). This is well supported by phylogentic analysis showing, close clustering of the virus isolate with CLCuBV. With this data, based on the current taxonomic criteria for the genus Begomovirus, the present virus isolate is classified as a new strain of CLCuBV, for which CLCuBV-[India: Bangalore: okra: 2006] additional descriptor is proposed. The betasatellite (KC608158) associated with the virus is having more than 95% sequence similarity with the cotton leaf curl betasatellites (CLCuB) available in the GenBank.The recombination analysis suggested, emergence of this new strain of okra infecting begomovirus might have been from the exchange of genetic material between BYVMV and CLCuMuV. The virus was successfully transmitted by whitefly and grafting. The host range of the virus was shown to be very narrow and limited to two species in the family Malvaceae, okra (Abelmoschus esculentus) and hollyhock (Althaea rosea), and four in the family Solanaceae.

Molecular characterization of a new species of begomovirus associated with yellow vein mosaic of bhendi (Okra) in Bhubhaneswar, India

Yellow vein mosaic disease of okra is major constraint for the production of okra in India. It is caused by whitefly transmitted begomoviruses and results in severe economic losses of the crop. In the present study a new begomovirus (OYBHU isolate) infecting okra showing yellow vein symptoms from Bhubhaneswar, India was characterized. The complete genome sequence (homologous to DNA-A) was determined and it comprised 2757 nucleotides. Attempts to amplify DNA- B were not successful. However, the association of a betasatellite suggests that the isolate is monopartite and typical of the begomoviruses infecting malvaceous hosts in the Old World. The genome organization is characteristic of begomoviruses, encoding seven ORFs with two ORFs [AV1 (CP) and AV2] in virion sense strand and five ORFs (AC1-AC5) in complementary strand. Comparisons of the virus genome sequence with other known begomoviruses suggests that OYBHU virus isolate is distinct, with Croton yellow vein mosaic virus being its nearest relative, sharing the 81.4 to 86.1 % sequence identity. This is further supported by phylogenetic analyses with clustering of BYVBV on a well supported branch separated from all other begomoviruses. The name Bhendi yellow vein Bhubhaneswar virus (BYVBV) is proposed for virus isolate OYBHU with the additional descriptor [India: Bhubhaneswar:OYBHU:06]. Recombination analyses with BYVBV suggest that it is a recombinant and may have originated by the exchange of genomic segments between the begomoviruses Croton yellow vein mosaic virus, Bhendi yellow vein mosaic virus, Cotton leaf curl multan virus and Mesta yellow vein mosaic virus.

Begomovirus characterization, and development of phenotypic and DNA-based diagnostics for screening of okra genotype resistance against Bhendi yellow vein mosaic virus.

The leaf sample from okra plants showing the yellow vein mosaic disease symptoms was collected in Karnataka state, India. The genome of the virus was amplified, cloned and sequenced. Sequence analysis revealed that the viral genome (GU112065) is 2,741 bp in length and genome is similar to that of monopartite begomoviruses originating from the Old World, with seven conserved ORFs. Further nucleotide (nts) sequence comparisons showed that the genome has the highest sequence identities of 96.1 % with Bhendi yellow vein mosaic virus (BYVMV) (GU112057) and 89.7 % with okra yellow vein mosaic virus (OYVMV) (AJ002451) infecting okra in India and Indian subcontinent. These results suggested that the isolate is a new strain of BYVMV. To identify the resistance source to BYVMV, the okra genotypes were screened under both artificial and natural conditions. None of the genotypes showed immunity to the disease. However, the genotypes Nun 1145 and Nun 1144 showed moderate resistance and genotypes M10, Nun 1142, Nun 1140 showed moderately susceptible reactions under both glass house and field conditions. Further, dot-blot hybridization using nonradioactive (digoxigenin) DNA probe showed that the virus was also detected in the symptomless plants.

First report of Radish leaf curl virus infecting okra in India

Okra (Abelmoschus esculentus) is one of the important vegetable crops of India cultivated in 452 hectares and yielding 4803 tonnes (Anonymous, 2010). In Bihar State, India, leaf curl disease on okra was observed in the field causing crop…

Diversity and phylogeography of Begomovirus-associated beta satellites of Okra in India.

BackgroundOkra (Abelmoschus esculentus; family Malvaceae) is grown in temperate as well as subtropical regions of the world, both for human consumption as a vegetable and for industrial uses. Okra yields are affected by the diseases caused by phyopathogenic viruses. India is the largest producer of okra and in this region a major biotic constraint to production are viruses of the genus Begomovirus. Begomoviruses affecting okra across the Old World are associated with specific, symptom modulating satellites (beta satellites). We describe a comprehensive analysis of the diversity of beta satellites associated with okra in India.ResultsThe full-length sequences of 36 beta satellites, isolated from okra exhibiting typical begomovirus symptoms (leaf curl and yellow vein), were determined. The sequences segregated in to four groups. Two groups correspond to the beta satellites Okra leaf curl beta satellite (OLCuB) and Bhendi yellow vein beta satellite (BYVB) that have previously been identified in okra from the sub-continent. One sequence was distinct from all other, previously isolated beta satellites and represents a new species for which we propose the name Bhendi yellow vein India beta satellite (BYVIB). This new beta satellite was nevertheless closely related to BYVB and OLCuB. Most surprising was the identification of Croton yellow vein mosaic beta satellite (CroYVMB) in okra; a beta satellite not previously identified in a malvaceous plant species. The okra beta satellites were shown to have distinct geographic host ranges with BYVB occurring across India whereas OLCuB was only identified in northwestern India. Okra infections with CroYVMB were only identified across the northern and eastern central regions of India. A more detailed analysis of the sequences showed that OLCuB, BYVB and BYVIB share highest identity with respect βC1 gene. βC1 is the only gene encoded by beta satellites, the product of which is the major pathogenicity determinant of begomovirus-beta satellite complexes and is involved in overcoming host defenses based on RNAi.ConclusionThe diversity of beta satellites in okra across the sub-continent is higher than previously realized and is higher than for any other malvaceous plant species so far analyzed. The beta satellites identified in okra show geographic segregation, which has implications for the development and introduction of resistant okra varieties. However, the finding that the βC1 gene of the major okra beta satellites (OLCuB, BYVB and BYVIB) share high sequence identity and provides a possible avenue to achieve a broad spectrum resistance.

Tobacco streak virus infecting faba bean (Vicia faba) reported for the first time

During the period December 2005 to January 2006, unusual leaf symptoms suggestive of a virus infection were observed in faba bean (Vicia faba) in fields in the Gezira area and northern parts of Sudan. Symptoms in beans were coincident with a high level of crop infestation by Aphis craccivora that might play a role in the transmission of the virus. Chlorotic mottling and/or mosaic symptoms were accompanied by black streaks on stems and leaf petioles. In some bean varieties, severe leaf chlorosis subsequently developed into browning and blackening of the entire leave), resulting in plant death. Extracts from bean leaves were mechanically inoculated on to range of host plants, and Nicotiana benthamiana and Chenopodium quinoa were identified as suitable propagation hosts. Electron microscope analysis of leaf extracts from infected C. quinoa revealed virus-like particles with isometric particles approximately 30 nm in diameter. A specific antiserum raised against the purified virus was produced, and in Western-immunoblot analysis the size of the putative coat protein was estimated to be between 29 and 30 kDa. Using several reference viruses available at the DSMZ collection in Braunschweig, Germany, for a serological comparison, the virus isolated from faba bean was found to be related to Tobacco streak virus (TSV) (Scott, 2001), a virus that is a serious pathogen of groundnut, sunflower and okra in India (Reddy et al., 2002; Bhat et al., 2002; Krishnareddy et al., 2003). The identity of the faba bean virus isolate was confirmed by reverse transcription-polymerase chain reaction (RT-PCR) and sequence analysis. A fragment of 717 nucleotides corresponding to the complete TSV coat protein region was sequenced by using specific TSV primers (TSV Cps ATGAATACTTTGATCCAAGG–TSVCPcTCAGTCTTGATTCACCAGGA) (GenBank Acc. No. CAP71888). A comparison of the deduced 237 aa coat protein sequence revealed between 90 and 92% sequence identity with the coat proteins of TSV isolates from sunflower, cotton and a number of other crops in India (ABU55372, AY061928 and AF515824). The closest relationship (98% aa cp identity) of TSV from the Sudan was found with a TSV isolate from the ornamental Impatiens neuguinea (DSMZ PV-0909, origin unknown). An analysis of TSV isolates from legumes including Vicia faba revealed a 92% amino acid sequence identity with a soybean isolate from India (ABM 53 867) and only a distant relationship to a TSV soybean isolate from Brazil (AAQ 99 137, 83%). This shows a distinct geographic distribution of the TSV isolates from faba bean in Sudan. This is the first report of the natural occurrence of TSV in Vicia faba.

Fruit Distortion Mosaic Disease of Okra in India.

Okra (Abelmoscus esculentus (L.) Moench) is an important vegetable crop of India and other subropical and tropical countries. In 2000 and 2001, in the states of Karnataka and Tamil Nadu, okra was severely affected by a new disease. Since that time, the disease has spread to other states: Andhra Pradesh, Madhya Pradesh, Haryana, and Maharashtra. Chlorotic spots, chlorotic leaf blotches, distortion of leaves, chlorotic streaking, distortion of fruits, and severe yield losses as much as 63% characterize the disease. The causal virus induces local and systemic chlorotic and necrotic lesions on Vigna unguiculata (L.) Walp. cv. C-152 and Chenopodium amaranticolor Coste & Reyne., chlorotic local lesions and mosaic on Cucumis sativus L., necrotic local lesions on Gossypium hirsutum L. and black gram (Vigna mungo L.), and chlorotic local lesions and systemic necrosis on sunflower (Helianthus annuus L.). Host reactions on these species are similar to those described for the ilarvirus Tobacco streak virus (TSV) (3). Electron microscopic observation of leafdip preparations from field samples and partially purified virus preparations revealed the presence of isometric virus particles measuring 25 to 30 nm in diameter. The virus was purified from mechanically inoculated okra by differential and sucrose density gradient centrifugation, and disease symptoms were reproduced in okra mechanically inoculated with the purified virus. In direct antigen coated enzyme-linked immunosorbent assay and immunosorbent electron microscopy tests, the purified virus and sap extracts reacted positively with polyclonal antibodies to TSV, the ilarvirus associated with sunflower necrosis and peanut stem necrosis diseases (1,2), but did not react positively to Turnip mosaic virus and Okra mosaic virus that are previously reported to infect okra. In reverse transcription-polymerase chain reaction (RT-PCR), using oligonucleotide primers designed to amplify the entire coat protein region of TSV, an approximately 800-bp DNA fragment was obtained from purified virus and okra displaying fruit distortion mosaic disease (OFDM) but not from healthy okra. On the basis of host range, serological relationship, electron microscopy, and RTPCR amplification, the virus causing OFDM is an ilarvirus closely related to TSV. To our knowledge, this is the first report of the occurrence of an ilarvirus in okra, and is the third and most recent report of an ilarvirus related to TSV causing disease in crops on the Indian subcontinent (1,2).

Detection and relationships of cotton leaf curl virus and allied whitefly‐transmitted geminiviruses occurring in Pakistan

Summary.A stock culture of cotton leaf curl virus from Pakistan (CLCuV‐PK), was transmitted by whiteflies (Bemisia tabaci) to seven plant species, including French bean, okra, tobacco and tomato, and caused vein thickening and leaf curl symptoms. It was readily detected in triple antibody sandwich ELISA (TAS‐ELIS A) by 11 out of 31 monoclonal antibodies raised against the particles of three other geminiviruses: African cassava mosaic, Indian cassava mosaic and okra leaf curl viruses. Reaction strength was enhanced when the tissue extraction fluid contained sodium sulphite. Minor variations in epitope profile were found among virus isolates from cotton (Gossypium hirsutum) collected from different districts in Pakistan over a 5‐year period. These epitope profiles were distinguishable from that of cotton leaf curl virus from G. barbadense in southern India but indistinguishable from the profiles of viruses causing yellow vein disease of okra in India or Pakistan, or leaf curl of okra {Abelmoschus esculentus), Hibiscus tiliaceus, radish or sunflower in Pakistan, suggesting that these plants are putative natural hosts of CLCuV‐PK. The viruses in cotton, and in okra with leaf curl or yellow vein symptoms, were also detected by PCR with three pairs of CLCuV‐PK‐specific primers.Five additional whitefly‐transmitted geminiviruses were found among isolates from 11 other naturally‐infected species in Pakistan, and were distinguished by their epitope profiles. These viruses were associated, respectively, with tobacco leaf curl, squash yellow blotch, tomato yellow leaf curl, watermelon leaf crinkle and soybean yellow mosaic diseases. The first four of these viruses were detected readily by PCR with geminivirus general primers but only weakly, if at all, with two pairs of CLCuV‐PK‐specific primers. Pakistani crops are infected with a range of distinguishable but relatively closely related whitefly‐transmitted geminiviruses, some of which resemble those found in India.

‘Parbhani Kranti’, a Yellow Vein Mosaic-resistant Okra

Abstract ‘Parbhani Kranti’ (PBNO 57) is an okra [Abelmoschus esculentus (L.) Moench] resistant to yellow vein mosaic (YVM) disease. YVM is the most serious disease of okra in India, and the causative virus is transmitted by the white fly (Bemisia tabaci Gen.). The disease not only reduces yield substantially (10% to 93%) but also affects marketability of the fruits. There is no source of resistance in the cultivated species (2, 7). Some related species are resistant to the YVM disease (1, 8). YVM resistance of A. manihot (L.) Medic., a related wild species, is controlled by a single dominant gene (3).