Nucleic Acid Data Banks Research Articles

First detection of Pseudomonas viridiflava, the causal agent of blossom blight in apple by using specific designed primers

This study was conducted for detection and identification of the causal agent of blossom blight of apple, which results in blast of whole tree. During spring 2011, a newly occurring disease was observed in 4 to 5 years-old Malus domestica (cv. Mutsu) trees in Northern area of Iran. A bacterial population was repeatedly isolated from the infected plants. Koch’s postulate (pathogenicity test) was fulfilled on potted plants under controlled environmental conditions (greenhouse). Based on morphological, physiological, biochemical and pathological tests, the causal agent was identified as Pseudomonas viridiflava. Polymerase chain reaction (PCR) identification of the bacterial isolates was done based on newly designed consensus primer pair (PsV-F and PsV-R). The consensus primers were achieved by alignment of P. viridiflava 16S rRNA gene sequences available in nucleic acid data bank, National Centre for Biotechnology Information (NCBI) database. This primer set was successful for detection of P. viridiflava strains. Deoxyribonucleic acid (DNA) fragments amplified by this primer set gave a specific amplification band of ~180 bp. Sequencing was done directly (PCR products). Single bands of two isolates were extracted and sequenced for molecular characterization and compared with sequences available in Gene Bank (NCBI), using BLAST search tool. The results showed complete identity of isolates with those of the P. viridiflava strains in the databases. This to our knowledge is the first report of the occurrence of P. viridiflava on apple.

A quantitative measure of chirality inside nucleic acid databank

We show the capability of a chirality index (Pietropaolo et al., Proteins 2008;70:667-677) to investigate nucleic acid structures because of its high sensitivity to helical conformations. By analyzing selected structures of DNA and RNA, we have found that sequences rich in cytosine and guanine have a tendency to left-handed chirality, in contrast to regions rich in adenine or thymine which show strong negative, right-handed, chirality values. We also analyze RNA structures, where specific loops and hairpin motifs are characterized by a well-defined chirality value. We find that in nucleosome the chirality is exalted, whereas in ribosome it is reduced. Our results illustrate the sensitivity of this descriptor for nucleic acid conformations.

Shape, flexibility and packing of proteins and nucleic acids in complexes

Determining the change in topological properties like shape, flexibility and packing of proteins and nucleic acids on complexation is important in characterizing the role of induced structural changes and various interactions which control the functional specificity of proteins and nucleic acids. To this end, we have analyzed and compared the three dimensional structures of several protein-protein, protein-DNA and protein-RNA complexes available in the Protein Data Bank (PDB) and the Nucleic Acid Data Bank (NDB). The size of complexed proteins and nucleic acids, as measured by the radius of gyration, follows Flory's scaling law. The change in the scaling exponents for proteins, RNA and DNA reflects the changes in their respective sizes due to complexation. The anisotropy in the shape of proteins, DNA and RNA in complexes is measured by considering the asphericity and shape parameter, which are calculated from the eigenvalues of the moment of inertia tensor. The distribution of asphericity and shape shows that complexed proteins are mostly spherically symmetrical, while DNA and RNA in complexed states are largely prolate and considerably more aspherical compared to the proteins. Persistence length characterizes the intrinsic flexibility/rigidity of proteins and nucleic acids. The flexibility of all biomolecules decreases with the chain length. For small DNA molecules (6-147 base pairs), persistence length is larger compared to RNA and proteins in protein-protein and protein-RNA complexes. The flexibility of DNA increases, while RNA decreases, in their respective complexed states as compared to that of proteins which remain almost unchanged. The two body contact analysis confirms that the side-chain-backbone contacts are predominant compared to sidechain-sidechain and backbone-backbone contacts in the complexed proteins. The average packing density of proteins decreases in their complexed states, which is measured by the mean value of the contact density of their alpha carbon atoms. The average number of hydrogen bonds are found to be less in the interface region of protein-protein complexes compared to that in protein-DNA and protein-RNA complexes.

Production and application of recombinant haemagglutinin neuraminidase of Newcastle disease virus

Objective To discuss the possibility of expressing the haemagglutinin-neuraminidase (HN) protein in prokaryotic system such as Escherichia coli (E. coli) cells by cloning the full length HN gene. Methods The full length HN gene of Newcastle Disease Virus (NDV) of size 1 734 bp was preciously isolated by RT-PCR. The sequence was assessed and submitted to Nucleic Acid Databank (NCBI) and the gene ID was EU215390.1 after cloning and sequencing. Now the assessed HN gene was subcloned into pET 32 a+ expression vector for production the HN protein in E. coli, BL21 (DE3) P LYSS cells following standard protocols. The crude lysate protein from the induced positive clone was size assessed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and their haemagglutination (HA) property against chicken RBC was assessed by standard micro HA test. Results The molecular size of the full HN gene of NDV as assessed by cloning and digesting the positive clone to release the insert was 1.7 kb. The expressed protein in both crude and pure form was assessed to be 63 kDa and 81 kDa, respectively. The HA activity of the crude protein of the positive clone was 1 in 40. Conclusions This finding indicates that the fusion protein retains the biological activity of native protein in the crude form and therefore could be used as a diagnostic reagent for antibody detection and for routine assessment of immune status in commercial layer forms.

Size, shape, and flexibility of proteins and DNA

Size, shape, and flexibility are the important topological parameters which characterize the functional specificity and different types of interactions in proteins and DNA. The size of proteins and DNA, often measured by the radius of gyration (R(G)), are determined from the coordinates of their respective structures available in Protein Data Bank and Nucleic Acid Data Bank. The mean square radius of gyration obeys Flory's scaling law given by R(G) (2) approximately N(2nu) where N is the number of amino acid residues/nucleotides. The scaling exponent nu reflects the different characteristic features of nonglobular proteins, natively unstructured proteins, and DNA. The asymmetry in the shapes of proteins and DNA are investigated using the asphericity (Delta) parameter and the shape parameter (S), calculated from the eigenvalues of the moment of inertia tensor. The distributions of Delta and S show that most nonglobular proteins and DNA are aspherical and prolate (S>0). Natively unstructured proteins are comparatively spherically symmetrical having both prolate and oblate shapes. The flexibility of these molecules is characterized by the persistence length (l(p)). Persistence length for natively unstructured proteins is determined by fitting the distance distribution function P(r) to the wormlike chain (WLC) model in the limit of r>>R(G). For nonglobular proteins and DNA, l(p) may be computed from the Benoit-Doty approximation for unperturbed radius of gyration of the WLC. The flexibilities of the proteins and DNA increases with the chain length. This is due to an increase in the nonlocal interactions with the increase in N, needed to minimize the conformational fluctuations in the native state. The persistence length of these proteins has not yet been measured directly. Analysis of the two-body contacts for the proteins reveals that the nonglobular proteins are less densely packed compared to the natively unstructured proteins with least side-chain side chain contacts even though side-chain backbone contacts predominate in the two types of proteins.

A fast variational method for the construction of resolution adaptive [formula omitted]-smooth molecular surfaces

We present a variational approach to smooth molecular (proteins, nucleic acids) surface constructions, starting from atomic coordinates, as available from the protein and nucleic acid data banks. Molecular dynamics (MD) simulations traditionally used in understanding protein and nucleic acid folding processes, are based on molecular force fields, and require smooth models of these molecular surfaces. To accelerate MD simulations, a popular methodology is to employ coarse grained molecular models, which represent clusters of atoms with similar physical properties by psuedo-atoms, resulting in coarser resolution molecular surfaces. We consider generation of these mixed-resolution or adaptive molecular surfaces. Our approach starts from deriving a general form second order geometric partial differential equation in the level-set formulation, by minimizing a first order energy functional which additionally includes a regularization term to minimize the occurrence of chemically infeasible molecular surface pockets or tunnel-like artifacts. To achieve even higher computational efficiency, a fast cubic B-spline C 2 interpolation algorithm is also utilized. A narrow band, tri-cubic B-spline level-set method is then used to provide C 2 smooth and resolution adaptive molecular surfaces.

SeqX: a tool to detect, analyze and visualize residue co-locations in protein and nucleic acid structures

BackgroundThe interacting residues of protein and nucleic acid sequences are close to each other – they are co-located. Structure databases (like Protein Data Bank, PDB and Nucleic Acid Data Bank, NDB) contain all information about these co-locations; however it is not an easy task to penetrate this complex information. We developed a JAVA tool, called SeqX for this purpose.ResultsSeqX tool is useful to detect, analyze and visualize residue co-locations in protein and nucleic acid structures. The usera. selects a structure from PDB;b. chooses an atom that is commonly present in every residues of the nucleic acid and/or protein structure(s)c. defines a distance from these atoms (3–15 Å). The SeqX tool detects every residue that is located within the defined distances from the defined "backbone" atom(s); provides a DotPlot-like visualization (Residues Contact Map), and calculates the frequency of every possible residue pairs (Residue Contact Table) in the observed structure. It is possible to exclude +/- 1 to 10 neighbor residues in the same polymeric chain from detection, which greatly improves the specificity of detections (up to 60% when tested on dsDNA). Results obtained on protein structures showed highly significant correlations with results obtained from literature (p < 0.0001, n = 210, four different subsets). The co-location frequency of physico-chemically compatible amino acids is significantly higher than is calculated and expected in random protein sequences (p < 0.0001, n = 80).ConclusionThe tool is simple and easy to use and provides a quick and reliable visualization and analyses of residue co-locations in protein and nucleic acid structures.Availability and requirements SeqX, Java J2SE Runtime Environment 5.0 (available from [see Additional file 1] ) and at least a 1 GHz processor and with a minimum 256 Mb RAM. Source codes are available from the authors.

Rapid Diagnosis of Pseudomonas syringae pv. papulans, the Causal Agent of Blister Spot of Apple, by Polymerase Chain Reaction Using Specifically Designed hrpL Gene Primers

ABSTRACT The identification and detection of Pseudomonas syringae pv. papulans, the causal agent of blister spot of apple, on apple leaves and fruit was achieved by polymerase chain reaction amplification of a specific DNA fragment of the hrpL sequence. The consensus primers hrpL(1) and hrpL(2) were designed based on the alignment of pseudomonad hrpL gene sequences available in nucleic acid data banks. This primer set produced a 631-bp amplicon from 37 of the 57 pseudomonads strains tested. These strains belonged to genomospecies 1 and 2, as described by Gardan et al. (8). The amplicon obtained from 30 of these strains was digested with eight restriction enzymes. Three different restriction patterns were produced from strains belonging to genomospecies 1, resulting in A1 and A2 patterns, while strains belonging to genomospecies 2 were characterized by a B pattern. Patterns A1 and A2 differed at only two sites, a Bsp 143I site located at nucleotide 360 and a MseI site located at nucleotides 22-24. Group A2 consisted solely of P. syringae pv. papulans strains. The hrpL gene in P. syringae pv. papulans strain CFBP3323 was sequenced. Two primer sets, Pap1/Pap2 and Pap1/Pap3, were designed and tested for specificity to P. syringae pv. papulans. These primers amplified expected fragments of 242 and 303 bp, respectively. Pap1/Pap2 amplified a fragment only with P. syringae pv. papulans DNA, while Pap1/Pap3 amplified all tested strains belonging to genomospecies 1. A diagnostic procedure using the Pap1/Pap2 primer set was successful for the detection of P. syringae pv. papulans in diseased fruit and artificially inoculated leaves.

Molecular cloning of candidate antigens recognized by anti-endothelial cell antibodies

Anti-endothelial cell antibodies (AECA) have been reported in such a vast array of conditions associated with vasculitis that the related autoantigens have become extremely difficult to identify. We have, therefore, used a molecular cloning approach to define endothelial cell (EC) target structures by screening a human umbilical vein EC (HUVEC) cDNA expression library. Total RNA was extracted from HUVECs and purified by oligo-dT cellulose chromatography. A commercial kit was used to synthesize cDNA which was inserted into the EcoRI/XhoI-digested and dephosphorylated lambda ZAP Express vector. The construct was incorporated into phages and transformed with E. coli strain XL1 Blue. After the addition of AECAs, positive clones were isolated in suspending medium, purified and incorporated again into the XL1. The insert-containing phagemids were exised from recombinant phages and introduced into E. coli XLOLR strain. The restriction fragments, obtained from the cDNA inserts by EcoRI endonuclease digestion, were sequenced by the dideoxy-chain termination method with two primers, T3 (AATTAACCCTCACTAAAGGG) and T7 (CGGGATATCACTCAGCATAATG). The sequences were examined for analogy in the GenBank and EBML nucleic acid data banks. Two sera, one from a patient with systemic lupus erythematosus (SLE) and another from a patient with Wegener's granulomatosis (WG), both strongly AECA-positive in our in-house cell-ELISA, were used to screen the bank. The SLE serum recognized methyltransferase, NADH dehydrogenase and unidentified components, whereas the WG serum recognized methyltransferase, GAPDH and unidentified structures. AECAs could thus be associated with a bulk of autoantibodies targeting various enzymes, or get inside the ECs to bind to such proteins.

Purification and Characterization of a Wound-Inducible Cell Wall Cationic Peroxidase from Carrot Roots

We have isolated a novel cell wall, cationic peroxidase (pI>9.3) from roots of the carrot plant,Daucus carota.The purified isozyme, referred to as CP>9.3, has a molecular mass of 45 kilodaltons and an Reinheitzahl value of 2.3. Amino-acid composition analysis and N-terminal sequencing have been performed with CP>9.3. The N-terminal sequence shows no homology to any sequence in the protein and nucleic acid data banks. CP>9.3 activity is induced by wounding in carrot leaves and petioles; this activity is also present in carrot roots but is unaltered by wounding. Enhanced CP>9.3 activity is seen at 12 hr post-wounding and continues for at least 60 hr in leaves and petioles. Based on studies using cycloheximide, early activation of CP>9.3 is not due tode novoprotein synthesis, but rather to enzyme activation. Temperature and pH optima for CP>9.3 using guaiacol as a substrate have been determined to be 32°C and 4.9.

The SBASE protein domain library, Release 4.0: a collection of annotated protein sequence segments.

SBASE 4.0 is the fourth release of SBASE, a collection of annotated protein domain sequences that represent various structural, functional, ligand binding and topogenic segments of proteins. SBASE was designed to facilitate the detection of functional homologies and can be searched with standard database search tools, such as FASTA and BLAST3. The present release contains 61 137 entries provided with standardized names and cross-referenced to all major protein, nucleic acid and sequence pattern collections. The entries are clustered into 13 155 groups in order to facilitate detection of distant similarities. SBASE 4.0 is freely available by anonymous ftp file transfer from ftp.icgeb.trieste.it. Individual records can be retrieved with the gopher server at icgeb.trieste.it and with a World Wide Web server at http://www.icgeb.trieste.it. Automated searching of SBASE with BLAST can be carried out with the electronic mail server sbase@icgeb.trieste.it, which now also provides a graphic representation of the homologies. A related mail server, domain@hubi.abc.hu, assigns SBASE domain homologies on the basis of SWISS-PROT searches.

The SBASE protein domain library, release 2.0: a collection of annotated protein sequence segments.

SBASE 2.0 is the second release of SBASE, a collection of annotated protein domain sequences. SBASE entries represent various structural, functional, ligand-binding and topogenic segments of proteins [Pongor, S. et al. (1993) Prot. Eng., in press]. This release contains 34,518 entries provided with standardized names and it is cross-referenced to the major protein and nucleic acid databanks as well as to the PROSITE catalog of protein sequence patterns [Bairoch, A. (1992) Nucl. Acids Res., 20 suppl, 2013-2018]. SBASE can be used for establishing domain homologies using different database-search tools such as FASTA [Lipman and Pearson (1985) Science, 227, 1436-1441], FASTDB [Brutlag et al. (1990) Comp. Appl. Biosci., 6, 237-245] or BLAST3 [Altschul and Lipman (1990) Proc. Natl. Acad. Sci. USA, 87, 5509-5513] which is especially useful in the case of loosely defined domain types for which efficient consensus patterns can not be established. SBASE 2.0 and a set of search and retrieval tools are freely available on request to the authors or by anonymous 'ftp' file transfer from mean value of ftp.icgeb.trieste.it.

The SBASE domain library: a collection of annotated protein segments.

SBASE is a database of annotated protein domain sequences representing various structural, functional, ligand binding and topogenic segments of proteins. The current release of SBASE contains 27,211 entries which are provided with standardized names in order to facilitate retrieval. SBASE is cross-referenced to the major protein and nucleic acid databanks as well as to the PROSITE catalog of protein sequence patterns [Bairoch, A. (1992) Nucleic Acids Res., 20, Suppl., 2013-2118]. SBASE can be used to establish domain homologies through database search using programs such as FASTA [Lipman and Pearson (1985) Science, 227, 1436-1441], FASTDB [Brutlag et al. (1990) Comp. Appl. Biosci., 6, 237-245] or BLAST3 [Altschul and Lipman (1990) Proc. Natl. Acad. Sci. USA, 87, 5509-5513], which is especially useful in the case of loosely defined domain types for which efficient consensus patterns cannot be established. The use of SBASE is illustrated on the DNA binding protein Brain-4. The database and a set of search and retrieval tools are freely available on request to the authors or by anonymous 'ftp' file transfer from < ftp.icgeb.trieste.it >.

Serum vitamin D-binding protein is a third member of the albumin and alpha fetoprotein gene family.

A near full-length cDNA encoding the human vitamin D-binding protein (hDBP) was isolated from a human liver mRNA expression library. Complete sequence analysis of this clone predicts the full-length amino acid sequence of the pre-hDBP. Comparison of the sequence of the hDBP mRNA and protein to existing protein and nucleic acid data banks demonstrates a strong and highly characteristic homology of the hDBP with human albumin (hALB) and human alpha-fetoprotein (hAFP). Based upon this structural comparison, we establish that DBP is a member of the ALB and AFP gene family.