Nt Sequence Identity Research Articles

Identification and molecular analysis of watermelon chlorotic stunt virus infecting snake gourd in Saudi Arabia

Snake gourd (Trichosanthes cucumerina) plants exhibiting typical begomovirus-like symptoms of stunted growth, leaf yellowing and mottling were observed at an open field in the Eastern region of Saudi Arabia. Sequencing analysis of the amplified complete DNA molecules revealed that the plants were infected with watermelon chlorotic stunt virus (WmCSV), which is a bipartite begomovirus prevalent mostly in the Old World and a serious threat to cucurbit production in the Arabian Peninsula, Middle East and Africa. The two WmCSV DNA-A isolates (SG31A and SG52A) were 98.9% identical and showed their highest nucleotide (nt) sequence identities (98.7%) with the isolates from Iran and Saudi Arabia. The DNA-B isolates (SG31B and SG52B), on the other hand, were 97.4% identical and exhibited their highest nt sequence identities (99.5 and 97%) with isolates reported from Iran and Oman. In the phylogenetic dendrograms the identified isolates clustered closely with previously reported WmCSV isolates from Iran and Saudi Arabia. Infectivity assays revealed that the DNA-A components alone could not induce infection in Nicotiana benthamiana plants however, together with DNA-B these isolates successfully caused typical begomovirus symptoms and both components were detected successfully using Southern blot hybridization. This study highlights the importance of conducting extensive future begomovirus surveillance to detect spillover events that could threaten native vegetable production in Saudi Arabia. This is crucial as begomoviruses pose a serious threat to vegetable cultivation throughout the Middle East.

Genotyping of infectious bronchitis virus in Canada.

From 2014-2023, infectious bronchitis virus (IBV) was detected in 6,589 samples from Canada, and partial nucleotide (nt) sequences of the IBV spike protein (S) gene were determined for 1,678 samples. Based on their S gene nt sequence identities and origin, Canadian IBVs could be classified into 4 groups: 1) 50.3% were variant viruses related to strains described in the United States; 2) 45.6% were vaccine-like viruses; 3) 2.1% were Eurasian viruses; 4) 2.0% were Canadian variants. Outbreaks with IBVs related to strains CAL1734/04, 4/91, and DMV/1639/11 were often associated with more severe disease in all chicken commodity groups. With the emergence of numerous IBV strains, the severity of infection and number of affected flocks increased. Outbreaks with various IBV strains overlapped in their emergence, peaked, and regressed, but the introduction of DMV/1639/11 has resulted in a continuous field challenge since its first detection in 2015.

Genotypic characterization of novel S-DEL variants of porcine epidemic diarrhea virus identified in South Korea.

The highly pathogenic genotype 2b (HP-G2b) of porcine epidemic diarrhea virus (PEDV), which caused a pandemic in 2013-2014, evolved in South Korea and became endemic, affecting the domestic pig industry. This study describes the genotypic traits of novel HP-G2b PEDV strains identified on affected farms experiencing low disease severity with < 10% neonatal mortality. Nucleotide sequencing revealed common deletion patterns, termed S-DEL2, resulting in a two-amino-acid deletion at positions 60 and 61, 61 and 62, or 63 and 64 in the N-terminal domain of the spike (S) protein of all isolates. The S barcode profiles of S-DEL2 variants differed from each other and shared 96.0-99.4% and 98.5-99.6% nt sequence identity with other South Korean HP-G2b PEDV strains in the S gene and in the complete genome sequence, respectively. Genetic and phylogenetic analysis showed that the S-DEL2 strains belonged to diverse domestic clades: CK, CK.1, CK.2, or NC. The emergence of novel S-DEL2 strains suggests that continuous evolution of PEDV occurs under endemic circumstances, resulting in genetic diversity and distinct clinical presentations. This study advances our knowledge regarding the genetic and pathogenic heterogeneity of PEDV and emphasizes the importance of active monitoring and surveillance to identify novel variants and determine their genotypic and phenotypic characteristics.

Leukolectins support lifelong innate immunity in lower vertebrates, and reveal dichotomies of several leukocytic lineages

Innate immunity is vital for animal homeostasis and survival. First-line immuno-defense for fish larvae involves mucus enriched with leukolectin (LL) secreted by dermal lectocytes. Later during the critical transition from yolk-nutrition to feeding, additional larval immuno-protection in zebrafish (zF) is provided by macrophages containing LL (lectophages). This work investigated new LL-expression in embryos and in blood, structures of fish leukocytic LL and LL-genes, and LL-presence in chicken leukocytes. In zF-embryos, lectophages appear ∼10 hpf, while later, cells co-expressing myeloperoxidase- and LL-mRNA were detected (∼19 hpf). Furthermore, protein-extracts of Atlantic salmon (Ssal) leukocytes contained LL-proteins, compartmentalized in the cytosol. Cloning and sequencing revealed 94 % nt-sequence identity between variants of Ssal-leukolectins. Highly conserved LLs allowed production of epitope-specific anti-LL IgGs. Immuno-fluorescence-analysis demonstrated that most Ssal-bloodcells were LL-negative, but both some large cells with protrusions and some small, rounded cells did express LL. Immunoperoxidase-staining method confirmed LL-expression in some Ssal-leukocytes, identified as macrophages, PMN-leukocytes, thrombocytes and dendritic cells. However, closer examination revealed a dichotomy of these cell-categories into either LL-positive, or LL-negative variants. In situ hybridization demonstrated profuse LL-expression in Ssal head kidney interstitial tissue, while LL-transcripts were absent in large kidney tubules. Both hematopoietic (non-pigmented) marrow cells and melano-macrophages expressed LL-mRNA, implying that leukolectins provide lifelong innate immuno-protection. PCR-amplification using Ssal-leukocytic DNA as template, and direct sequencing yielded a leukocytic ll-gene. Some cells in salmon, cod, halibut, oikopleura and zebrafish embryos express LL-proteins and/or LL-mRNA, and LL-mRNA is detected in salmon, cod and chicken leukocytes. However, current genomes for these species lack recognizable LL-loci except the Ssal_v3.1 Genome-assembly. The data demonstrate an unexpected dichotomy of some leukocyte lineages into LL-positive or LL-negative cell-variants. Such dichotomies suggest exploring differential impacts from the duplicated leukocyte-lineages in health and disease.

Complete genome sequence of a novel badnavirus infecting Fatsia japonica in China.

The complete genome sequence of a novel badnavirus, tentatively named "fatsia badnavirus 1" (FaBV1, OM540428), was identified in Fatsia japonica. The infected plant displayed virus-like symptoms on leaves, including yellowing and chlorosis. The genome of FaBV1 is 7313 bp in length and similar in size and organization to other members of the genus Badnavirus (family Caulimoviridae), containing four open reading frames (ORFs), three of which are found in all known badnaviruses, and the other of which is only present in some badnaviruses. The virus has the genome characteristics of badnaviruses, including a tRNAMet binding site (5'-TCTGAATTTATAGCGCTA-3') and two cysteine-rich domains (C-X-C-2X-C-4X-H-4X-C and C-2X-C-11X-C-2X-C-4X-C-2X-C). Pairwise sequence comparisons of the RT+RNase H region indicated that FaBV1 shares 61.4-71.2% nucleotide (nt) sequence identity with other known badnaviruses, which is below the threshold (80% nt sequence identity in the RT+RNase H region) used for species demarcation in the genus Badnavirus. Phylogenetic analysis revealed that FaBV1, ivy ringspot-associated virus (IRSaV, MN850490.1), and cacao mild mosaic virus (CMMV, KX276640.1) together form a separate clade within the genus Badnavirus, suggesting that FaBV1 is a new member of the genus Badnavirus in the family Caulimoviridae. To our knowledge, this is the first report of a badnavirus infecting F. japonica.

Complete genome characterization of cacao leafroll virus, a newly described cacao-infecting polerovirus.

The complete genome sequence of cacao leafroll virus (CaLRV; family Solemoviridae, genus Polerovirus) was determined by high-throughput sequencing of total RNA isolated from symptomatic cacao Theobroma cacao L. plants (n = 4). The CaLRV genome sequences ranged from 5,976 to 5,997 nucleotides (nt) in length and contained seven open reading frames (ORFs). Nucleotide and amino acid (aa) sequence comparisons showed that, among selected well-characterized poleroviruses, the CaLRV genome shared the highest nt sequence identity of 62% with that of potato leafroll virus (PLRV, NC_076505). A comparison of the predicted aa sequence of the CaLRV coat protein indicated that cotton leafroll dwarf virus (CLRDV, NC_014545) and melon aphid-borne yellows virus (MABYV, NC_010809) were the closest relatives, sharing 57% aa sequence identity. Bayesian phylogenetic analysis based on complete genome sequences showed that CaLRV grouped with well-characterized poleroviruses that cause diseases of cereal and vegetable crops. During the course of publishing this work, the nearly complete genome sequence of a member of the same polerovirus species, referred to as "cacao polerovirus" (OR605721), with which CaLRV shares 99% nt sequence identity, was reported.

The complete genome sequence of tomato necrotic ringspot virus in chilli in Thailand derived from next-generation sequencing.

Tomato necrotic ringspot virus (TNRV) was first reported in Thailand in 2011, where it continues to reduce the yield and quality of pepper and tomato crops. Here, we report the complete genome sequence of TNRV isolate chilli-CR derived from next-generation sequencing. The TNRV genome comprises 16,595 nucleotides (nt) on three RNA segments. The L RNA is 8,858 nt, the M RNA is 4,724 nt, and the S RNA is 3,013 nt in length. The genome structure and organization are typical of orthotospoviruses, encoding five proteins, named L, NSm, GNGC, NSs, and N. Pairwise comparison of each genomic RNA segment and its deduced amino acid (aa) sequence showed that TNRV chilli-CR shares 73.6-82.3% nt sequence identity and 81.1-91.9% aa sequence identity with pepper chlorotic spot virus (PCSV). Similar phylogenetic groupings were observed based on each genomic RNA or deduced aa sequence, and with concatenated genomic RNA sequences. The clustering of TNRV and PCSV in all phylogenetic analyses, and the 78.9% overall nt sequence identity observed using the concatenated genomic RNAs suggest that TNRV is a distinct orthotospovirus and that analysis of concatenated orthotospovirus genome sequences will be of value in future phylogenetic studies of this virus group.

First Report of Tobacco Mosaic Virus Infecting Bidens pilosa in China.

Bidens pilosa is an annual weed in family Asteraceae widely distributed in tropical and subtropical regions worldwide. It is also a natural host for at least five viruses including tomato spotted wilt orthotospovirus, tomato zonate spot orthotospovirus, pepper chlorotic spot orthotospovirus, Bidens mottle virus and Bidens mosaic virus, and therefore serve as a virus reservoir for various field crops (Yin et al. 2013; Xu et al. 2022; Wang et al. 2009). In August 2021, plants of B. pilosa displaying symptoms of chlorosis, mosaic and necrosis were observed surrounding a tobacco field in Kunming, Yunnan Province, China. Leaf samples were collected from four diseased B. pilosa plants and total nucleic acids were extracted using a CTAB based method (Li, R., et al. 2008). RT-PCR was carried out using virus-specific primers designed for the aforementioned five viruses as well as tobacco mosaic virus (TMV). The results indicated that none of the four samples tested positive for the 5 viruses, excepted for one sample, which produced an amplicon of the expected size (700 bp) with the TMV-specific primer pair of TMVF (CGGTCAGTGCCGAACAAGAA) and TMVR (TACGTGCCTGCGGATGTATATG). Cloning and sequencing the amplicon revealed a 717 nt fragment (accession no. OR136480) in the core cp region of TMV, showed the highest nt sequence identity of 99.6% with other TMV isolates (HE818450) in GenBank. TMV infection was also verified by dot-enzyme linked immunosorbent assay (DOT-ELISA) using antisera of TMV (Beijing Green Castle Agricultural Technology Co., Ltd.). To further confirm the TMV infection in B. pilosa plants, a TMV infectious clone (kindly provided by Dr. Fei Yan at Ningbo University, China) was inoculated into twelve healthy 3-week-old B. pilosa seedlings using Agrobacterium-mediated delivery. None of the inoculated B. pilosa plants exhibited distinct symptoms even at 30 days post-inoculation (dpi). Nevertheless, RT-PCR and Sanger sequencing results revealed that 2 of the inoculated B. pilosa plants were infected by TMV. The above results collectively indicate that TMV can infect B. pilosa under both natural and artificial conditions. However, it is possible that the symptoms observed on the diseased B. pilosa plants in the field may not be solely attributed to TMV but rather to the co-infection of TMV with other unidentified virus(es), which were not characterized in this study. TMV is considered one of the economically significant pathogens affecting crops such as tobacco (Nicotiana tabacum), pepper (Capsicum spp.), and tomato (Solanum lycopersicum). It is highly contagious and can be transmitted through various means, including seeds, soil and agricultural practice. B. pilosa is considered one of the most significant alien invasive weeds in China, mainly owing to its robust reproductive capacity. Furthermore, B. pilosa has the potential to act as a reservoir for various viruses that may affect field crops. The presence of TMV on B. pilosa plants may enhance the transmission efficiency of the virus in the field. Although TMV does not induce noticeable symptoms in B. pilosa, its presence on these plants could potentially increase the transmission efficiency of the virus in the field, posing a significant risk to field crops. Therefore, effective weed management and the diligent monitoring of TMV in B. pilosa should be recognized as essential sanitary practices for controlling viral diseases in field crops. To the best of our knowledge, this is the first report of TMV infecting B. pilosa in China.

High-throughput sequencing discovered diverse monopartite and bipartite begomoviruses infecting cucumbers in Saudi Arabia.

Limited research in Saudi Arabia has devolved into the prevalence and genetic diversity of begomoviruses. Utilizing Illumina MiSeq sequencing, we obtained 21 full-length begomovirus sequences (2.7-2.8 kb) from eight cucumber plants grown in fields and greenhouses. We found that two complete begomovirus genomes were variants of the Boushehr strain of tomato yellow leaf curl virus (TYLCV) with nucleotide (nt) sequence identities of 94.7-95.9%. Another full-length genome was a variant of TYLCV-Iran with 94.6% identity. Five full-length sequences closely matched the DNA-A of watermelon chlorotic stunt virus (WmCSV) isolates with 97.9-98.7% nt sequence identities, while five sequences had their highest nt sequence identities (95.8-96.3%) with the DNA-B of WmCSV isolates. Simultaneously, four sequences were 99.1-99.6% identical to the DNA-A of tomato leaf curl Palampur virus (ToLCPalV). Four sequences matched the DNA-B of ToLCPalV reported from Iran and Saudi Arabia with identities ranging from 96.2-100%. Four plants showed a mixed infection of these begomoviruses. Most ORFs showed evidence of negative selection pressure, suggesting that purifying selection plays a crucial role in shaping the diversity of these begomoviruses. Additionally, potential intra- and interspecies recombination events were detected in the TYLCV and WmCSV DNA-B genomic regions. The ToLCPalV isolates identified in this study formed a cluster with the other ToLCPalV isolates reported from Saudi Arabia, Iran and Iraq, representing a unique lineage distinct from ToLCPalV reported from Southeast Asia. High mutation rate and robust selection facilitated the independent evolution of ToLCPalV without recombination. Overall, this study offers valuable insights into the diversity and evolutionary dynamics of begomoviruses infecting cucumber crops in Al-Ahsa, Saudi Arabia.

Molecular identification of bovine gammaherpesvirus 6 in water buffaloes (Bubalus bubalis) with histological evidence of pulmonary and intestinal lesions

Bovine gammaherpesvirus 6 (BoGHV6), formerly known as bovine lymphotropic virus, belongs to the genus Macavirus, which includes the porcine lymphotropic herpesviruses (PLHV) and members collectively referred to as malignant catarrhal fever virus (MVFV) group. This study investigated the possible participation of BoGHV6 in the development of intestinal and pulmonary diseases of buffaloes. Intestinal and pulmonary fragments were obtained from 19 buffaloes from Goiás, Central-western Brazil. Histopathology revealed interstitial pneumonia in all pulmonary fragments evaluated, while two of these had suppurative bronchopneumonia. Furthermore, all intestinal fragments demonstrated atrophic enteritis. BoGHV6 DNA was amplified from 31.6% (6/19) of the buffaloes with interstitial pneumonia and in 26.3% (5/19) with atrophic enteritis. The phylogenetic evaluation revealed that the strain of BoGHV6 amplified from these buffaloes had 100% nucleotide (nt) sequence identity with the reference strains of BoGHV6, but only 69.5 to 73.7% and 65.8 – 69.5% nt sequence identity with members of the MCFV and the PLHV, respectively. Additionally, molecular assays to detect important pathogens of ruminants did not amplify the respective nucleic acids in the tissues evaluated. These results demonstrated that BoGHV6 was amplified from tissues of buffaloes with histopathologic diagnoses of interstitial pneumonia and atrophic enteritis, suggesting the possible participation of this virus in the development of the intestinal and pulmonary lesions herein identified.

First Report of Calystegia hederacea as a new host of sweet potato leaf curl Hubei virus.

Calystegia hederacea (Convolvulaceae) is one of the most problematic perennial weeds widely distributed around or in crop fields. Our previous studies showed that C. hederacea is natural reservoir of sweet potato chlorotic stunt virus isolate CH (SPCSV-CH) and sweet potato latent virus (SPLV) (Liu et al. 2020; Zhao et al. 2022). To shed further light on the role of C. hederacea in the epidemiology of sweet potato viruses, in May 2021, a total of seven C. hederacea plants (five asymptomatic, one curling and one mild vein-clearing) were collected from two different sweet potato fields in Xinxiang city of Henan Province in China. Total RNA was prepared from a pool of the seven leaf samples using the EZNA Plant RNA Kit (Omega Bio-Tek, Norcross, GA). A library was constructed from the ribosomal-depleted RNA using the NEBNext Ultra Directional RNA Library Prep Kit for Illumina (NEB, MA, USA) and sequenced using the Illumina HiSeq platform (Novogene, Tianjin, China). A total of 139,057,020 paired-end clean reads of 150 bp were obtained after removing adaptor sequences and low-quality reads and used for de novo assembly using the Trinity (v2.2.0) software. Blast searches of the assembled contigs longer than 200 bp against NCBI nucleotide and protein sequence databases revealed the presence of 37 contigs (237 to 4885 bp) and 19 contigs (261 to 758 bp) with high nucleotide (nt) identity with SPLV and SPCSV-CH, respectively. The occurrence of SPLV and SPCSV-CH on C. hederacea was previously reported, and thus the contig sequences related to SPLV and SPCSV-CH were not subjected to further verification in this study. In addition, one contig (2,827 bp) with the highest nt sequence identity of 94.94% with sweet potato leaf curl Hubei virus (SPLCHbV, genus Begomovirus, family Geminiviridae, accession no. MK931304) was assembled from 16,592 reads, with average coverage depth of 740.5X. These results suggested the presence of SPLCHbV in C. hederacea. To further confirm the RNA sequencing result, each of the seven samples was tested by PCR using partially overlapping (italicized nucleotides) forward and reverse primers (SweeIn-F1, 5`-GGAGGAAGCTAAGTACGAGAATCAGTTAGAG-3`; SweeIn-R1, 5`-GCTTCCTCCTTGTGATTGTAAGTAACATGG-3`) that were designed based on the SPLCHbV-related contig for amplification of circular DNA viral genome (approximately 2.7 kb). Two symptomatic and three symptomless C. hederacea samples were SPLCHbV positive, indicating that virus-like symptoms of the two C. hederacea samples were probably not induced by SPLCHbV. Two of the five amplified products were completely sequenced and deposited to GenBank (accession nos. OQ551733 and OQ551734). Sequences analysis showed that the complete genome sequences of two SPLCHbV C. headrace isolates (2,763 nt and 2,761 nt) had 96.53% nt identity with each other and 95.92 to 97.70% nt identity with that of SPLCHbV isolate Shandong7-2017 (MK931304). In August 2021, fourteen C. hederacea plants (three symptomatic, 11 asymptomatic) collected from natural fields from Zhumadian and Pingdingshan cities in Henan Province, were tested by PCR using SweeIn-F1/R1 primers for SPLCHbV, showing that eight samples were SPLCHbV positive. SPLCHbV belongs to the sweepoviruses, a group of phylogenetically distinct begomoviruses infecting sweet potato, and was reported to infect sweet potato from many provinces of China (Wang et al., 2021). To the best of our knowledge, this is the first report of SPLCHbV infection in C. hederacea, which expands the natural host range of SPLCHbV.

First Report of Narcissus late season yellows virus, Narcissus latent virus, and Narcissus mosaic virus in daffodil (Narcissus pseudonarcissus) in the United States.

Daffodils (family Amaryllidaceae, genus Narcissus) are important ornamental plants produced primarily for cut flowers. In 2019, daffodils sales in the US were $6.26 M (USDA-NASS, 2019). In May 2021, four symptomatic daffodil plants (Narcissus pseudonarcissus) were sampled from a flowerbed (<10% disease incidence) on the Utah State University campus, Logan, Utah. The plants had foliar mosaic and yellow striping symptoms like those caused by the infections of Narcissus degeneration virus (NDV, a potyvirus) and Narcissus mosaic virus (NMV, a potexvirus) (Hanks and Chastagner 2017), and tested positive for potyviruses by ELISA Potyvirus group test (Agdia, Elkhart, IN). A sample of two leaves from the only surviving plant was sent to the USDA Plant Pathogen Confirmatory Diagnostics Laboratory (PPCDL) for testing. Total RNA extracted from 0.2 g pooled tissues (0.1g per leaf) using RNeasy Plant Mini kit (Qiagen) was tested for potyvirus in RT-PCR using Nib2F & Nib3R primers (Zheng et al. 2010). Later, the sample was tested for Narcissus latent virus (NLV) and NMV by RT-PCR (He et al. 2018) after the viruses were detected by high throughput sequencing (HTS) described below. A second primer pair was designed in-house targeting NMV TGB1 protein (NMV-2F: CCTTACACCACCGATCCTAAAG & NMV-2R: GGAGCTGCAGTGATGACATATAG. Amplicon size =555bp). The nucleotide (nt) sequence of the potyvirus RT-PCR product obtained (281 bp; GenBank accession no. ON653017) shared 99.29% identity with Narcissus late season yellows virus (NLSYV) BC 37 isolate (MH886515). The nt sequence of NLV-specific primer amplified product (542 bp; ON653018) showed 97.60% identity with NLV NL isolate (KX979913), a maculavirus. The amplicons obtained using two NMV-specific primer pairs were 348 bp (ON653019) and 524 bp (ON653020) long and shared 89.37% and 91.98% nt sequence identities with NMV SW13-Iris isolate (KF752593) at two genomic regions (5613-6860 nt and 5477-6000 nt), respectively. To obtain full genome sequences of the viruses in the sample, HTS was done. A cDNA library was prepared from 500 ng total RNA using the Direct cDNA sequencing kit (SQK-DCS109). The library was loaded onto an R9.4.1 MinION flow cell and sequenced for 48 hours. A total of 372,000 raw reads were obtained with a N50 of 2,754 bp and mean read length of 1,890 bp with 8,085 reads mapped to the viral database. Reads were assembled using canu v 2.1.1 (Koren et al. 2017). Three full-length viral contigs, ON677368 (6955 nt), ON677369 (9624 nt), and ON677370 (8180 nt), were assembled from 4616, 301, and 699 reads, respectively. BLASTn search showed that the three contigs (ON677368, ON677369, and ON677370) shared 94.42% nt identity with NMV SW13-Iris (KF752593), 98.56% with NLSYV BC 37 (MH886515.1), and 98.60% with NLV NL (KX979913.1) isolates, respectively. The potexvirus group, which NMV is a member, has species demarcation of < 72% nt identity (or 80% aa identity) between their coat protein or replicase genes (ICTV 2021). The predicted replicase protein sequence (1643 aa) of the detected NMV (ON677368) showed 95% identity with a published NMV genome (P15059), confirming its identity. NDV was not detected in the sample by RT-PCR and HTS. This is the first report of NLMV, NLSYV, and NMV in daffodil plants in the United States. Daffodils are an important ornamental crop in United States and Europe. A reduction in flower quality, bulb size, and number has been observed in plants infected with these viruses (Ward et al. 2009) that can affect their marketability.

Sequence and phylogenetic analysis of a novel alphaendornavirus, the first virus described from the oomycete plant pathogen Phytophthora heveae

Here, we report the discovery and complete genome sequence of a novel virus, designated as “Phytophthora heveae alphaendornavirus 1” (PhAEV1), from a single isolate of the plant pathogenic oomycete Phytophthora heveae (kingdom Stramenipila) isolated from a tropical evergreen lowland rainforest in northern Vietnam. PhAEV1 was detected by both cellulose affinity chromatography of dsRNA and high-throughput sequencing of total RNA, and its presence and sequence were confirmed by RT-PCR and Sanger sequencing. The PhAEV1 genome, 12,820 nucleotides (nt) in length, was predicted to encode a single large polyprotein with the catalytic core domain of viral (superfamily 1) RNA helicase (HEL, amino acid [aa] positions 1,287-1,531), glycosyltransferase (GT, aa positions ca. 2,800-3,125), and RNA-directed RNA polymerase (RdRp, aa positions 3,875-4,112). PhAEV1 is the most similar to Phytophthora cactorum alphaendornavirus 3, sharing 39.4% and 39.1% nt and aa sequence identity, respectively. In addition to the first 5′-terminal AUG codon, three additional in-frame methionine codons were found in close proximity (nt 14-16, 96-98, and 176-178), suggesting potential additional translation initiation sites. Conserved RdRp motifs (A-E) similar to those detected in related endornaviruses were identified in PhAEV1, as well as in several previously described alphaendornaviruses from other Phytophthora species in which these motifs had not been identified previously. Phylogenetic analysis showed that PhAEV1 clusters with members of the genus Alphaendornavirus in the family Endornaviridae and is basal to two other alphaendornaviruses described from another oomycete, Phytophthora cactorum. PhAEV1 is the first virus reported in P. heveae.

First report of Tomato yellow mottle-associated virus infecting pepper (Capsicum annuum L.) in China.

Tomato yellow mottle-associated virus (TYMaV), is a member of the genus Cytorhabdovirus in the family Rhabdoviridae, which has been reported to infect tomato (Lycopersicon esculentum) (Xu et al. 2017), Solanum nigrum (Li et al., 2022) and Nicotiana benthamiana (Zhou et al. 2019). In July 2021, virus-like symptoms of chlorosis, mosaic, and ring spots were observed in pepper, tomato, and eggplant during a survey of viral symptoms in Huzhou City, Zhejiang Province, China. To identify viral agents potentially associated with these diseases, an Oxford Nanopore cDNA library from the mixed samples was generated and sequenced. Briefly, total RNA from 10 leaf tissue samples (3 pepper plants, 4 tomato plants, and 3 eggplant plants) was extracted using RNAiso Plus (TaKaRa, Tokyo, Japan) and pooled in equal amounts (100 ng/l each). The library was constructed using a PCR-cDNA sequencing kit (SQK-PCS109; Oxford Nanopore Technologies, Oxford, UK) in accordance with the manufacturer's instructions. Approximately 8.6 million reads were obtained from the Oxford MinION platform. After removing adapters and low-quality reads using iVar v1.3.1 (Grubaugh et al., 2019), the clean reads were subjected to BLASTn search in the GenBank database. We identified sequences derived from potato virus X (PVX), potato virus Y (PVY), cucumber mosaic virus (CMV), pepper mottle virus (PepMoV), and TYMaV. Of these reads, 339 with lengths ranging from 375 to 8651 nt were mapped to the genome of TYMaV (GeneBank Accession No. KY075646.1) at a 98.2% query coverage. To identify TYMaV-infected plants in the pooled samples, all 10 samples were analyzed by two-step RT-PCR using AMV reverse transcriptase (Takara, Tokyo, Japan) combined with random primers N6 (Takara, Dalian, China) and high-fidelity DNA polymerase KOD-Plus-Neo (Toyobo, Osaka, Japan) with primer pairs: N-F 5'- CAGGGAGAGAATGTACAAGTTGATC'/N-R 5'- GACCTTGCTCATCTGATGCAAC -3', amplifying 420 bp of the 3'end of nucleoprotein (N) gene. A pepper sample showing chlorosis symptom was positive for the TYMaV infection, but negative for PVX, PVY, CMV or PepMoV infection when tested using the primers listed in table S1. To confirm the genome sequence of TYMaV Zhejiang isolate (TYMaV-ZJ), we carried out two-step RT-PCR with seven primer pairs (Table S1) designed based on the reference TYMaV genome (GeneBank accession number KY075646.1). PCR products were cloned into pLB vector (Tiangen, Beijing, China) and Sanger sequenced in both directions. At least five independent clones of each fragment were sequenced to avoid possible mutations introduced by PCT. The sequences were assembled into a nearlyfull-length genome of TYMaV -ZJ which was composed of 13344nt (GeneBank accession number OP296980). Pairwise sequence comparison revealed that TYMaV -ZJ genome shared 91.50% and 85.59% nt sequence identity with that of the TYMaV tomato isolate (KY075646.1) and the Solanum nigrum isolate (MW527091.1), which is higher than the species demarcation threshold of 75% for the genus Cytorhabdovirus (Walker et al., 2022). To the best of our knowledge, this is the first report of TYMaV infecting pepper.

Occurrence of Tomato leaf curl New Delhi virus in tomato (Lycopersicon esculentum) in China.

Tomato leaf curl New Delhi virus (ToLCNDV), a member of the genus Begomovirus in the family Geminiviridae is naturally transmitted by the whitefly Bemisia tabaci (order Hemiptera, family Aleyrodidae) in a circulative and persistent manner (Moriones et al. 2017). ToLCNDV has occurred in Bangladesh, India, Indonesia, Iran, Italy, Malaysia, Pakistan, Sri Lanka, Spain, Thailand and Tunisia (Moriones et al. 2017). To date, The primary cultivated host of ToLCNDV has been identified as tomato (Lycopersicon esculentum), but the virus is also known to infect 43 other plant species from a range of families including Cucurbitaceae, Euphorbiaceae, Solanaceae, Malvaceae and Fabaceae (Zaidi et al. 2017). In August 2021, virus-like symptoms including leaf deformation and curing were observed on tomato (Lycopersicon esculentum) in a greenhouse of about 0.5 hectares in Zhejiang Province, China. To identify viral agents potentially associated with this disease, an Oxford Nanopore cDNA library from a symptomatic sample was generated and sequenced. Total RNA was extracted using RNAiso Plus (TaKaRa, Tokyo, Japan). Libraries were constructed using Oxford Nanopore PCR-cDNA Sequencing Kit (SQK-PCS109; Oxford Nanopore Technologies, Oxford, UK), as recommended. Approximately 8.7 million reads were obtained from the Oxford MinION platform. After removing the adapters and low-quality reads, the clean reads were subjected to BLASTn analysis against the nt database. Approximately 797 and 168 reads produced high nt identities to the genome of ToLCNDV DNA-A (GeneBank Accession No. U15015.2) and ToLCNDV DNA-B (GeneBank Accession No. U15017.2) respectively. We designed 6 primer pairs (Table S1) to obtain the sequence of ToLCNDV Zhejiang (ToLCNDV-ZJ) isolate DNA-A and DNA-B. Briefly, total DNA from ToLCNDV-infected tomato was extracted using standard cetyl trimethylammonium bromide method. Segments of ToLCNDV DNA-A and DNA-B were amplified using high-fidelity DNA polymerase KOD-Plus-Neo (Toyobo, Osaka, Japan). PCR products were cloned into the pLB vector (Tiangen, Beijing, China) and Sanger sequenced. The obtained sequences were assembled into complete sequences of ToLCNDV-ZJ DNA-A (2,739 nt, GeneBank Accession No. OP356207) and DNA-B (2,693 nt, GeneBank Accession No. OP356208). Pairwise sequence comparison revealed that the ToLCNDV -ZJ shared the highest nt sequence identities of 98.7% and 98.4% with the genome segments of New Delhi isolate (genome A: HM159454) and India:Delhi:Cucumis:2012 isolate (genome B: KC545813) respectively. Furthermore, we performed PCR detection on 10 collected samples using the primer pair P1F and P1R. All eight symptomatic plants showing upward leaf curling and leaf distortion tested positive for ToLCNDV infection, whereas two asymptomatic plants were ToLCNDV free. To our knowledge, this is the first report of ToLCNDV infecting tomato in China, and with the widespread presence of B. tabaci in green houses, ToLCNDV may be a potential threat to the cultivation of tomato in China. In addition, ToLCNDV is an exceptional Old World bipartite begomovirus. In China, monopartite DNA satellite-associated begomoviruses with mostly narrow geographical ranges predominate, and are widespread (Li et al., 2022). The occurrence of ToLCNDV in China, which indicates that the success of this virus would become an emerging threat to vegetable and fiber crops.

Mixed infections with new emerging viruses associated with jujube mosaic disease.

Jujube is an economically important fruit tree and native to China. Viral disease is a new threat to jujube production, and several new viruses have been identified infecting jujube plants. During our field survey, jujube mosaic disease was widely distributed in Beijing, but the associated causal agents are still unknown. Small RNA deep sequencing was conducted to identify the candidate viruses associated with jujube mosaic. Further complete genome sequences of the viruses were cloned, and the genomic characterization of each virus was analyzed. The field distribution of these viruses was further explored with PCR/RT-PCR detection of field samples. Mixed infection of four viruses was identified in a plant sample with the symptom of mosaic and leaf twisting, including the previously reported jujube yellow mottle-associated virus (JYMaV), persimmon ampelovirus (PAmpV), a new badnavirus tentatively named jujube-associated badnavirus (JaBV), and a new secovirus tentatively named jujube-associated secovirus (JaSV). PAmpV-jujube was 14,093 nt in length with seven putative open reading frames (ORFs) and shared highest (79.4%) nucleotide (nt) sequence identity with PAmpV PBs3. Recombination analysis showed that PAmpV-jujube was a recombinant originating from plum bark necrosis stem pitting-associated virus isolates nanjing (KC590347) and bark (EF546442). JaBV was 6449 bp in length with conserved genomic organization typical of badnaviruses. The conserved RT and RNAse H region shared highest 67.6% nt sequence identity with jujube mosaic-associated virus, which was below the 80% nt sequence identity value used as the species demarcation threshold in Badnavirus. The genome of JaSV composed of two RNA molecules of 5878 and 3337 nts in length, excluding the polyA tails. Each genome segment contained one large ORF that shared homology and phylogenetic identity with members of the family Secoviridae. Field survey showed JYMaV and JaBV were widely distributed in jujube trees in Beijing. Two new viruses were identified from jujube plants, and mixed infections of JYMaV and JaBV were common in jujube in Beijing.

Complete genome sequence of a tentative novel capillovirus isolated from Gerbera jamesonii.

The currently named gerbera virus A (GeVA) has been shown to be a novel capillovirus with a complete genome of 6929 nucleotides (nt) (GenBank accession no. OM525829.1). GeVA was detected in Gerbera jamesonii using high-throughput RNA sequencing analysis. The GeVA genome is a single linear RNA with two open reading frames (ORF), similar to those of other capilloviruses. The larger ORF encodes a polyprotein containing four domains, while the smaller ORF encodes a movement protein. The complete genome had 41.0-54.9% nt sequence identity to other those of capilloviruses, while the polyprotein and the movement protein had 26.5-36.4% and 13.1-32.2% amino acid (aa) sequence identity, respectively. Two UUAGGU promoters for subgenomic RNA (sgRNA) transcription were also identified in this study. BLAST analysis demonstrated that the GeVA genome shared the highest sequence similarity with rubber tree capillovirus 1 (MN047299.1) (complete nucleotide sequence identity, 68.54%; polyprotein amino acid sequence identity, 44.53%). Phylogenetic analysis based on complete genome and replication protein sequences placed GeVA alongside other members of the genus Capillovirus in the family Betaflexiviridae. These data suggest that GeVA is a new member of the genus Capillovirus.

Citrus Bright Spot Virus: A New Dichorhavirus, Transmitted by Brevipalpus azores, Causing Citrus Leprosis Disease in Brazil

Citrus leprosis (CL) is the main viral disease affecting the Brazilian citriculture. Sweet orange (Citrus sinensis L. Osbeck) trees affected by CL were identified in small orchards in Southern Brazil. Rod-like particles of 40 × 100 nm and electron lucent viroplasm were observed in the nucleus of infected cells in symptomatic tissues. RNA extracts from three plants, which proved negative by RT-PCR for known CL-causing viruses, were analyzed by high throughput sequencing and Sanger sequencing after RT-PCR. The genomes of bi-segmented ss(-)RNA viruses, with ORFs in a typical organization of members of the genus Dichorhavirus, were recovered. These genomes shared 98-99% nt sequence identity among them but <73% with those of known dichorhavirids, a value below the threshold for new species demarcation within that genus. Phylogenetically, the three haplotypes of the new virus called citrus bright spot virus (CiBSV) are clustered with citrus leprosis virus N, which is a dichorhavirus transmitted by Brevipalpus phoenicis sensu stricto. In CiBSV-infected citrus plants, B. papayensis and B. azores were found, but the virus could only be transmitted to Arabidopsis plants by B. azores. The study provides the first evidence of the role of B. azores as a viral vector and supports the assignment of CiBSV to the tentative new species Dichorhavirus australis.

First Report of Youcai Mosaic Virus Infecting Yam in China.

Yam (Dioscorea opposita Thunb.) is cultivated mainly as a functional food and for nutritional and medicinal purposes in China (1). It is propagated through tubers and this facilitates the spread and accumulation of viruses in the crop, eventually leading to yield losses (2). At present, different virus species belonging to the genera Aureusvirus, Badnavirus, Carlavirus, Comovirus, Cucumovirus, Fabavirus, Macluravirus, Potexvirus and Potyvirus have been reported in yams (3) and fifteen viruses in these genera have been detected in China. In July 2020, a survey of viral diseases on yam was conducted in plantations of Wenxian and Mengzhou counties in Henan Province, China. Fifty-four leaf samples of Dioscorea opposite showing mosaic and leaf discoloration (Supplementary Fig1) were collected from eight fields (five to ten plants per field). These leaf samples were ground in liquid nitrogen and total RNA was extracted from a portion of the mixed powder using RNAprep Pure Plant Plus Kit (TIANGEN Biotech, Beijing, China). A cDNA library was constructed using NEBNext Ultra RNA Library Prep Kit for Illumina (NEB, USA) after ribosomal RNA depletion using Ribo-off rRNA Depletion Kit (Vazyme Biotech, Nanjing, China), and sequenced on the Illumina NovaSeq 6000 system at the Berry Genomics Corporation (Beijing, China). A total of 87,075 contigs (>200 bp) were generated from de novo assembly (CLC Genomic Workbench 10.0) from a total of 34,656,172 paired-end reads. After BLASTn analysis, three contigs with the length of 1009, 1340 and 1859 nucleotides shared 96.33%, 96.72% and 96.29% nt identity respectively with youcai mosaic virus SX isolate, a tobamovirus (YoMV GenBank accession no. JX422022). In addition to YoMV, broad bean wild virus 2 and yam latent virus were also identified, which had previously been reported in yams in China. To confirm the NGS result, total RNAs were extracted from fifty-four above-mentioned samples and RT-PCR was carried out to amplify a 528 bp fragment of the coat protein (CP) of YoMV by using a pair of specific primers CP gene. PCR products with expected size were obtained from 26 out of 54 samples, and seventeen amplicons of YoMV-CP were sequenced (accession nos. ON052726 to ON052742). The nt sequence identities of CP gene among these seventeen isolates were 99.6%-100%. Furthermore, the near-full-length genomic sequence of YoMV-Do41 isolate was obtained from sample 41 by RT-PCR amplification of four overlapping fragments using the following primer pairs: YoMV-15F/YoMV-1910R, YoMV-1770F/YoMV-3750R, YoMV-3645F/YoMV-5404R and YoMV-4921F/YoMV-6280R (Supplementary Table1). The YoMV-Do41 isolate was 6, 274 nt in length (accession no. ON149803) and shared 89.65% and 97.31% nt identities to As1-2 isolate (GenBank accession no. MW307290) and to SX isolate (accession no. JX422022), respectively.To the best of our knowledge, this is the first report of YoMV infecting yam in China. YoMV has a wide host range including genera Impatiens, Rehmannia, Brassica, Chelidonium, Trifolium, Crossandro, Alstroemeria, Stellaria. This study will serve as an important reference for the host range of YoMV. According to the detection rate infections with YoMV in yam are common in these producing regions. Further studies will be required to determine the infection rate in other producing regions and the potential threat posed by YoMV on yam production should be considered.

First report of Watermelon crinkle leaf-associated virus 2 infecting watermelon (Citrullus lanatus) in Oklahoma.

Watermelon (Citrullus lanatus) is one of the major cucurbit crops in Oklahoma, which is grown on >1,200 acres. It contributes $16 million to the state's economy (Shrefler et al., 2017; NASS, 2022). During the 2021 growing season, virus-like symptoms on watermelon plants were observed in a grower's field in Blaine County, Oklahoma. These symptoms included mottling, crinkled leaf edges, and a unique yellow mosaic pattern (Fig. 1). Leaf tissue samples were randomly collected from nine plants and total RNA was extracted using Spectrum Plant Total RNA Kit (Sigma-Aldrich). Total RNA from one sample (named BL13) was subjected to high-throughput sequencing (HTS) on the NextSeq 500/550 High-Output kit v2.5 (Illumina, USA) at the genomic facility of Oklahoma State University. A total of 21,52,786 trimmed pair-end reads were assembled using CLC Genomics Workbench (v12.0.3) (Qiagen, Inc.) and subjected to BLASTn analysis. Of these, three contigs of 6,626 bp, 1,383 bp and 1,233 bp (average coverage 20,658X) showed 99% nucleotide (nt) sequence identity with RNA1 of a watermelon crinkle leaf-associated virus (WCLaV-2) isolate from Brazil (LC636073). The HTS data for BL13 samples also revealed three contigs of 263 pb, 567 bp and 1,066 bp that matched with cucumis melo crytpic virus isolate CmCV-HLI but was not confirmed by RT-PCR. The presence of WCLaV-2 in the BL13 sample was confirmed by RT-PCR using primers (RNA1-F: 5'-CAAAACGCCCATAAG AATAG-3'and RNA1-R: 5'- CTCCATTAATGAGAACTAGGAG-3') which amplified a 1.2 kb segment of the RNA1. The PCR product was confirmed on 1% agarose gel, cloned and three independent recombinant clones Sanger sequenced (Eurofins Genomics LLC, Louisville, KY, USA). The resulting consensus sequence (1.2 Kb) (ON453838) was subjected to a BLASTn search against the Genbank databases, resulting in 99.76% nt identity with WCLaV-2 RNA1 (Accession no. LC636073). Screening of the remaining eight symptomatic samples by RT-PCR revealed another positive sample (named BL7) for WCLaV-2. Consensus nt sequence (1.2 Kb) analysis for the virus isolate from the BL7 sample (Accession no. ON453839) shared 99.84% nt identities with WCLaV-2 RNA1 (LC636073). Total RNA from BL13 and BL7 samples, as well as the remaining seven samples, were tested against three major potyviruses (PRSV-W, WMV, and ZYMV) by multiplex RT-PCR (Rajbanshi & Ali, 2019). Both BL13 and BL7 samples were negative to all three potyviruses but the other eight samples were positive to one or two of the potyviruses. WCLaV-2 is a negative-sense ssRNA virus (family Phenuiviridae) and has been recently reported from watermelon in China (Xin et al., 2017) and Brazil (Maeda et al. 2022). In the United States, it has been reported from Florida (Hendrick et al., 2021), Georgia (Adeleke et al., 2022), and Texas (Hernandez et al., 2021). The mode of transmission of WCLaV-2 and its direct effect on watermelon fruit is not known (Xin et al., 2017; Maeda et al., 2022). Our results report for the first time the occurrence of WCLaV-2 infecting watermelon naturally in Oklahoma and show a further potential threat to watermelon production in the State. Further studies are needed to determine the incidence of WCLaV-2 in other counties of Oklahoma.