Non-cultivated Hosts Research Articles

Begomovirus populations in single plants are complex and may include both well-adapted and poorly-adapted viruses

Begomoviruses (single-stranded DNA plant viruses transmitted by whiteflies) are economically important pathogens causing epidemics worldwide. Tomato-infecting begomoviruses emerged in Brazil in the 1990′s following the introduction of Bemisia tabaci Middle East-Asia Minor 1. It is believed that these viruses evolved from indigenous viruses infecting non-cultivated hosts. However, tomato-infecting viruses are rarely found in non-cultivated hosts, and vice-versa. It is possible that viral populations in a given host are composed primarily of viruses which are well adapted to this host, but also include a small proportion of poorly adapted viruses. Following transfer to a new host, the composition of the viral population would shift rapidly, with the viruses which are better adapted to the new host becoming predominant. To test this hypothesis, we collected tomato and Sida plants growing next to each other at two locations in 2014 and 2018. Total DNA was extracted from tomato and Sida samples from each location and year and used as a template for high-throughput sequencing. Reads were mapped following a highly stringent set of criteria. For the 2014 samples, >98% of the Sida reads mapped to Sida micrantha mosaic virus (SiMMV), but 0.1% of the reads mapped to tomato severe rugose virus (ToSRV). Conversely, >99% of the tomato reads mapped to ToSRV, with 0.18% mapping to SiMMV. For the 2018 samples, 41% of the Sida reads mapped to three Sida-adapted viruses and 0.1% of the reads mapped to ToSRV, while 99.9% of the tomato reads mapped to ToSRV. These results are consistent with the hypothesis that viral populations in a single plant are composed primarily of the virus that is better adapted to the host but also include a small proportion of viruses that are poorly adapted.

Multilocus Phylogenetic Analyses of Colletotrichum gloeosporioides Species Complex Causing Crown Rot on Strawberry in Florida.

Colletotrichum gloeosporioides is the causal agent of Colletotrichum crown rot of strawberry in the southern United States. Recent multigene studies defined C. gloeosporioides as a complex species comprised of 37 species. In our study, we phylogenetically characterized C. gloeosporioides isolates from strawberry and other noncultivated plants around strawberry fields. One hundred fifteen strawberry isolates and 38 isolates from noncultivated hosts were sequenced for five genomic regions: internal transcribed spacer, actin, calmodulin, chitin synthase, and glyceraldehyde-3-phosphate dehydrogenase. Phylogenetic analysis using the maximum likelihood and Bayesian inference methods, based on partition-specific models, revealed that most of the isolates in Florida (86%) were closely related to C. siamense, whereas 14 isolates were closely related to C. theobromicola (syn. C. fragariae), four isolates were C. fructicola, and three isolates were C. clidemiae. However, only the first three species were pathogenic to strawberry. Morphological characteristics evaluated show that mycelial growth of all species is approximately 5 mm/day, but colony morphology varies by species and incubation conditions. In vitro mating of the isolates demonstrated that C. fructicola is homothallic whereas C. siamense and C. theobromicola isolates are heterothallic. The biological importance of these different Colletotrichum species is currently being investigated to determine whether different management strategies are needed in strawberry production fields.

Fusarium graminearum isolates obtained from wheat and wild grasses in northeastern New York display comparable range of phenotypes, including virulence on crop hosts

The crop pathogen Fusarium graminearum often colonizes non-cultivated grasses, but the phenotypic variation found in isolates recovered from these hosts has not been thoroughly investigated or compared to that observed in isolates collected from crop hosts. Fusarium graminearum growth, perithecia formation, and virulence on crops (maize seedlings, wheat seedlings, wheat spikes) were measured in laboratory and greenhouse experiments using isolates (n = 24) recovered from three non-cultivated grasses (Bromus inermis, Dactylis glomerata, and Phalaris arundinacea) and winter wheat (Triticum aestivum) found at a single research farm in northeastern New York. While individual isolates varied significantly for all phenotypes measured, grass and wheat derived isolates displayed a comparable range of phenotypic values. Trichothecene genotypes were determined from the TRI12 and TRI1 loci, and mycotoxin production was quantified in mature wheat spikes. Trichothecene genotype and phenotype were largely concordant and were not related to isolate source. These findings support consideration of non-cultivated hosts as sources of diverse pathogen inoculum that may cause crop disease.

Distribution and Relative Abundance of Insect Vectors of Xylella fastidiosa in Olive Groves of the Iberian Peninsula.

The phytosanitary emergency caused by the spread of Xylella fastidiosa in the Mediterranean has raised demands for a better understanding of the ecology of its presumed and candidate insect vectors. Here, we present the results of a two-year survey carried out in olive groves across southern, eastern and Central Spain and northeastern Portugal. Several sampling methods were tested and compared to select the most appropriate to estimate population levels of potential vectors of X. fastidiosa. The spittlebugs Philaenus spumarius and Neophilaenus campestris (Hemiptera: Aphrophoridae) were the main species associated with olive groves. Both species were widely present on herbaceous ground vegetation within the olive groves; P. spumarius mainly associated with Asteraceae and N. campestris with Poaceae. Due to the patchy distribution of spittlebugs within the olive groves, sweep nets were the most effective and least time-consuming sampling method for the estimation of population size both in the ground cover and tree canopies. Trends in population density showed that spittlebugs can be abundant on ground vegetation but very rare on olive canopies. Spittlebugs disperse in late spring to non-cultivated hosts that act as natural reservoirs. In late fall, adults return to the olive groves for oviposition. However, olive trees may act as transient hosts for spittlebugs and high population densities of these insect vectors should be avoided in areas where X. fastidiosa is present.

Molecular Characterization of a Novel Begomovirus Infecting Malva (Gaya guerkeana K. Schum.)

The genus Begomovirus (family Geminirvidae) comprises circular single-stranded DNA viruses that infect both cultivated and non-cultivated hosts, being transmitted by the insect vector Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae). This study aimed to conduct the molecular characterization of a novel begomovirus infecting the non-cultivated plant Gaya guerkeana K. Schum. (Malvaceae). A leaf sample of G. guerkeana was collected in the State of Pernambuco, Brazil, in 2010. Viral genomic components were amplified via RCA, cloned, and commercially sequenced. The full-length DNA-A sequence was used for phylogenetic analysis and pairwise comparisons with other previously reported begomoviruses. The begomovirus DNA-A from G. guerkeana was most closely related to the Sida mottle Alagoas virus (SiMoAV, JX871386), having 84.8% nucleotide identity. Using the ≥ 91% identity criteria for DNA-A established by the Geminivirus Study Group of the International Committee on Taxonomy of Viruses, this isolate was considered a putative new begomovirus species, and the name Gaya yellow mosaic virus (GaYMV) is suggested. The GaYMV isolate grouped with SiMoAV and other begomoviruses infecting Sida spp. from the State of Alagoas, Brazil. This is the first report of a begomovirus infecting G. guerkeana, indicating that this non-cultivated plant can act as a reservoir/source of begomoviruses.

Host Plants of the Wheat Stem Sawfly (Hymenoptera: Cephidae).

Wheat stem sawfly (Cephus cinctus Norton) is a pest of economic importance across much of the wheat (Triticum aestivum L.)-growing areas of the western Great Plains of North America as well as an ecologically important insect owing to its wide range of grass hosts. Little research has been published regarding the noncultivated native and invasive grasses attacked by this insect. Knowledge of the complete host range of C. cinctus can inform future research about potential new sources of genetic resistance, improve understanding of the biology and spread of natural enemies, and better define this insect's role in grassland and agricultural systems. The aim of this review is to compile a checklist of reported host plants of C. cinctus and present data from an extensive survey of noncultivated hosts used by C. cinctus.

First Report of Macroptilium yellow spot virus in Desmodium glabrum in Brazil

HomePlant DiseaseVol. 100, No. 3First Report of Macroptilium yellow spot virus in Desmodium glabrum in Brazil Previous DISEASE NOTES OPENOpen Access licenseFirst Report of Macroptilium yellow spot virus in Desmodium glabrum in BrazilR. S. Fontenele, R. Poppiel, V. O. R. L. Matos, F. Costa, J. C. Faria, and S. G. RibeiroR. S. FonteneleSearch for more papers by this author, R. PoppielSearch for more papers by this author, V. O. R. L. MatosSearch for more papers by this author, F. CostaSearch for more papers by this author, J. C. Fariahttp://orcid.org/0000-0002-8125-7654Search for more papers by this author, and S. G. RibeiroSearch for more papers by this authorAffiliationsAuthors and Affiliations R. S. Fontenele R. Poppiel V. O. R. L. Matos , Embrapa Recursos Genéticos e Biotecnologia, Brasília, Brazil F. Costa , Instituto Agronômico de Pernambuco, Recife, Brazil J. C. Faria , Embrapa Arroz e Feijão, Goiânia, Brazil S. G. Ribeiro , Embrapa Recursos Genéticos e Biotecnologia, Brasília, Brazil. Published Online:29 Jan 2016https://doi.org/10.1094/PDIS-09-15-1086-PDNAboutSections ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat Macroptilium yellow spot virus (MaYSV) is a begomovirus (family Geminiviridae) described infecting common beans (Phaseolus vulgaris) and other leguminous noncultivated hosts in northeastern Brazil (Ramos-Sobrinho et al. 2014; Silva et al. 2012). In a recent virus survey in common beans and associated noncultivated plants in the state of Pernambuco, four Desmodium glabrum plants presenting yellow mosaic, leaf curling, rugosity, and leaf deformation symptoms were collected at the periphery of a bean field in Caruaru, in August 2013. Total DNA was extracted and a PCR reaction using universal degenerate begomovirus primers pAL1v1978 and pAR1c496 (Rojas et al. 1993) amplified fragments of the expected size of ∼1.2 kb. The sequences of the amplicons were nearly identical, and BLASTn comparisons suggested the infection of the four plants by MaYSV. To obtain full-length viral DNA components, genomic DNA from two samples was amplified by rolling-circle amplification (RCA) (Inoue-Nagata et al. 2004) and concatemer products were digested with HindIII and KpnI restriction enzymes rendering ∼2.6-kb fragments which were cloned into pBluescript II KS(+). Four independent DNA-A clones obtained from the two samples were sequenced using primer walking and had identities higher than 99% among them (GenBank Accession Nos. KT779561, KT779562, KT779564, and KT779565). Species Demarcation Tool (SDT) (v.1.0) (Muhire et al. 2014) analysis resulted in identities varying from 87 to 99% with DNA-A from different MaYSV isolates from common bean, lima bean, Macroptilium lathyroides, Calopogonium mucunoides, and Canavalia spp. collected in the states of Alagoas, Paraíba, and Sergipe (Silva et al. 2012), confirming that the D. glabrum plants were infected by MaYSV. DNA-B was amplified by PCR from total plant DNA using primers MaYSV-B-F (5′ACATACGTAATTGAAGACTGTTGGT3′) and MaYSV-B-R (5′ACGTACGTAGAGTCTCAGCGTGATG3′) overlapping in a SnabI restriction site present in most MaYSV DNA-B cloned in our laboratory. The resulting ∼2.6-kb PCR fragments were cloned into pTOPO2.1. Four DNA-B clones (KT779558, KT779559, KT779560, and KT779563) retrieved from the same plants from which DNA-A clones were obtained were completely sequenced. The DNA-B clones had identities ranging from 92 to 100% among them and shared 92 to 99% identity with genomic MaYSV DNA-B isolates from common bean and Macroptilium spp. Desmodium glabrum is a widely distributed neotropical plant occurring from Mexico to Argentina. In Brazil, D. glabrum can be found as invasive plants in northeastern, central, and southeastern regions in open fields, pasture areas, riparian forests, and also in anthropized and degraded areas. To date, MaYSV has been described only in Brazilian northeastern states; however, pervasive plants such as D. glabrum as well as other reported leguminous noncultivated MaYSV hosts may facilitate the spread of MaYSV to cultivated legume crops such as common bean and soybean in the main cultivated areas.

Brazilian begomovirus populations are highly recombinant, rapidly evolving, and segregated based on geographical location.

The incidence of begomovirus infections in crop plants sharply increased in Brazil during the 1990s following the introduction of the invasive B biotype of the whitefly vector, Bemisia tabaci. It is believed that this biotype transmitted begomoviruses from noncultivated plants to crop species with greater efficiency than indigenous B. tabaci biotypes. Either through rapid host adaptation or selection pressure in genetically diverse populations of noncultivated hosts, over the past 20 years various previously unknown begomovirus species have became progressively more prevalent in cultivated species such as tomato. Here we assess the genetic structure of begomovirus populations infecting tomatoes and noncultivated hosts in southeastern Brazil. Between 2005 and 2010, we sampled and sequenced 126 DNA-A and 58 DNA-B full-length begomovirus components. We detected nine begomovirus species in tomatoes and eight in the noncultivated host samples, with four species common to both tomatoes and noncultivated hosts. Like many begomoviruses, most species are obvious interspecies recombinants. Furthermore, species identified in tomato have probable parental viruses from noncultivated hosts. While the population structures of five well-sampled viral species all displayed geographical subdivision, a noncultivated host-infecting virus was more genetically variable than the four predominantly tomato-infecting viruses.

Synonymous site variation due to recombination explains higher genetic variability in begomovirus populations infecting non-cultivated hosts

Begomoviruses are ssDNA plant viruses that cause serious epidemics in economically important crops worldwide. Non-cultivated plants also harbour many begomoviruses, and it is believed that these hosts may act as reservoirs and as mixing vessels where recombination may occur. Begomoviruses are notoriously recombination-prone, and also display nucleotide substitution rates equivalent to those of RNA viruses. In Brazil, several indigenous begomoviruses have been described infecting tomatoes following the introduction of a novel biotype of the whitefly vector in the mid-1990s. More recently, a number of viruses from non-cultivated hosts have also been described. Previous work has suggested that viruses infecting non-cultivated hosts have a higher degree of genetic variability compared with crop-infecting viruses. We intensively sampled cultivated and non-cultivated plants in similarly sized geographical areas known to harbour either the weed-infecting Macroptilium yellow spot virus (MaYSV) or the crop-infecting Tomato severe rugose virus (ToSRV), and compared the molecular evolution and population genetics of these two distantly related begomoviruses. The results reinforce the assertion that infection of non-cultivated plant species leads to higher levels of standing genetic variability, and indicate that recombination, not adaptive selection, explains the higher begomovirus variability in non-cultivated hosts.

Russian wheat aphid (Hemiptera: Aphididae) reproduction and development on five noncultivated grass hosts

The Russian wheat aphid, Diuraphis noxia (Kurdjumov), is a small grains pest of worldwide economic importance. The Russian wheat aphid is polyphagous and may encounter differential selective pressures from noncultivated grass hosts. Aphid biotypic diversity can disrupt the progress of plant breeding programs, leading to a decreased ability to manage this pest. The goal of this research was to quantify Russian wheat aphid biotype 2 (RWA2) reproductive and development rates on five common noncultivated grass hosts to gain information about host quality, potential refuges, and sources of selection pressure. First, RWA2 reproduction was compared on crested wheatgrass (Agropyron cristatum, (L.) Gaertn.), intermediate wheatgrass (Elytrigia intermedia, (Host) Nevski), slender wheatgrass (Elymus trachycaulus, (Link) Gould ex Shinners), western wheatgrass (Pascopyrum smithi, (Rydb.) A. Love), and foxtail barley (Hordeum jubatum, (L.) Tesky) at 18–24°C. Second, RWA2 reproduction was compared on intermediate and crested wheatgrass at three temperature regimes 13–18°C, 18–24°C, and 24–29°C. At moderate temperatures (18–24°C), the intrinsic rate of increase values for all five hosts ranged from 0.141 to 0.199, indicating the possibility for strong population sources on all tested hosts. Aphids feeding on crested and intermediate wheatgrass at the 13–18°C temperature had lower fecundity, less nymph production days, longer generational times, and lower intrinsic rate of increase than aphids feeding at the 18–24°C temperature regime. Aphids feeding at 24–29°C did not survive long enough to reproduce. The positive intrinsic rates of increase in Russian wheat aphid on the wheatgrasses suggest that these grasses can support aphid populations at moderate to low temperatures.

Ocorrência e desempenho de Euschistus heros (F.) (Heteroptera: Pentatomidae) em plantas hospedeiras alternativas no Rio Grande do Sul

The Neotropical brown stink bug Euschistus heros (F.) can reach high densities in some soybean areas in Brazil. Besides soybean, it also feeds on other plants, but little is known on the alternative hosts of E. heros in Rio Grande do Sul state. In this study, wild non-cultivated hosts of E. heros at Norwest of Rio Grande do Sul state were determined, and the E. heros performance was compared when fed on soybean and on wild hosts. Bugs were sought in plants located inside and on the edge of soybean fields during 2004/2005 and 2005/2006 seasons. Adults were recorded feeding on seeds of Amaranthus retroflexus (Amaranthaceae), and on fruits of three Solanaceae, mainly Vassobia breviflora. Immature survivorship on soybean (86.7%) and on V. breviflora (81.8%) was the same, but nymphs fed on A. retroflexus did not reach adulthood. The host plant used during immature development greatly affected adult weight, with V. breviflora yielding the heaviest adults; however, adult survivorship and longevity when fed on different host plants were the same. Females fed on soybean laid larger egg masses than those fed on V. breviflora , but the overall fecundity was not affected.

Seasonal Presence of the Russian Wheat Aphid (Hemiptera: Aphididae) on Alternate Hosts in Colorado

Abstract. Russian wheat aphid populations have been monitored for the development of biotypes since the pest first appeared in the United States. Recent studies have confirmed the presence of five unique Russian wheat aphid biotypes in Colorado (Haley et al. 2004, Weiland et al. 2008), two of which were found on noncultivated grass hosts. The objective of this study was to confirm that while the Russian wheat aphid has undergone many changes as a species, the important grass hosts have not changed and are consistent each season. Species of noncultivated grass hosts were inventoried at field sites in four Colorado counties, Baca County, Montezuma County, Washington County, and Weld County, and the presence of Russian wheat aphids on the identified hosts was documented. Field sites were sampled in spring and fall 2005–2006 and the number and species of grass hosts were recorded and compared to look at host consistency across different geographic locations. Twenty-three grass species were identified across a...

Differential invasion success among biotypes: case of Bemisia tabaci

Studies on success or failures of biological invasions by different insect biotypes are scarce and could provide interesting insights into the traits that determine greater or lower ability to invade. Life history traits of invasive whiteflies Bemisia tabaci of the B biotype (known as a worldwide invasive biotype) and of the indigenous biotype Ms (not known as an invader anywhere in the world), both from the island of La Reunion (Indian Ocean), were compared for this purpose. In our study we demonstrated that within a cultivated host plant (tomato), the B biotype differs from the Ms by a combination of several life-history traits. This combination gives the invasive biotype an advantage over the resident both in terms of rapid demographic growth (increased intrinsic rate of increase and associated traits such as short developmental times and high fecundity) and in terms of competition (large adult and offspring sizes), without any recorded trade off. However, in the field the resident biotype remains dominant on non-cultivated hosts (weeds) and in a particular climate (high humidity). This suggests that invasive biotypes are characterized by physiological, morphological and biological adaptations to a disturbed environment created by anthropic activities at different places in the world, while resident biotypes may persist in less altered habitats.

Nymph and adult biology of Dichelops melacanthus (Dallas) (Heteroptera: Pentatomidae) feeding on cultivated and non-cultivated host plants

The biology of the pentatomid Dichelops melacanthus (Dallas) feeding on cultivated and non-cultivated plants was studied in the laboratory. Nymph mortality varied from approximately 60 on corn (seed mature) to 77% on wheat (ear immature); no nymphs survived on seedlings of corn or wheat. Nymph developmental time on soybean, corn or wheat (seed, pod or ear) varied from 25.5 to 32.8 days. Body weight at adult emergence was similar and greater on most foods than on wheat ear. Nymphs fed preferentially on soybean (pod immature). On non-cultivated hosts, nymphs showed high mortality (73%) on crotalaria (pod immature); on tropical spiderwort (stem) all nymphs died. Nymphs took longer time to develop on crotalaria and/or on spiderwort than on soybean. Body weight at adult emergence did not differ on crotalaria or soybean. Survivorship decreased with time on most foods, with approximately 50% of adults alive at day 30. On corn and wheat seedlings approximately 80% of adults were dead on day 20. Adult longevity ranged 31-43 days, except on corn and wheat seedlings < 15 days. Females % ovipositing peaked ( approximately 76%) on soybean (pod or seed immature), and was minimum ( approximately 9%) on wheat ear (immature); no females reproduced on seedlings of corn or wheat. Preoviposition period was shorter ( approximately 12 days) on soybean (immature pod or seed) and longer ( approximately 37 days) on wheat (ear immature). Fecundity was similar and higher on all foods than on wheat (ear immature). Body weigh gain occurred on all foods, but on corn and wheat seedlings. Adults fed preferably on soybean (pod immature and seed mature); wheat (seedling) was the least preferred food.

Biology and Biotype Determination of Greenbug, &lt;I&gt;Schizaphis graminum&lt;/I&gt; (Hemiptera: Aphididae), on Seashore Paspalum Turfgrass (&lt;I&gt;Paspalum vaginatum&lt;/I&gt;)

Greenbug, Schizaphis graminum (Rondani) (Hemiptera: Aphididae), was first discovered damaging seashore paspalum (Paspalum vaginatum Swartz) turfgrass in November 2003 at Belle Glade, FL. Inquiries to several golf courses with seashore paspalum turf across southern Florida indicated infestation was wide spread by April 2004. Damage symptoms progress from water soaked lesions surrounding feeding sites within 24 h to chlorosis and necrosis of leaf tips within 96 h. Problems caused by greenbug feeding were initially misdiagnosed as fertilizer, disease, other insects, or water management problems because aphids were not previously found on warm season turfgrasses. Greenbug development and fecundity studies were conducted on six seashore paspalum varieties: 'Aloha,' 'SeaDwarf,' 'SeaGreen,' 'SeaIsle,' 'SeaWay,' and 'SeaWolf.' Greenbug did not survive on 'SeaWolf.' Development rates (mean +/- SEM) ranged from 7.6 +/- 0.2 to 8.2 +/- 0.2 d on the remaining varieties. Greenbug longevity and fecundity on 'Aloha' were significantly less than on the other varieties. The estimated intrinsic rate of natural increase (r(m)) for greenbug ranged from 0.24 to 0.26 across tested varieties. Values for net reproductive rate (R(o)) ranged from 12.3 on 'Aloha' to 40.4 on 'SeaWay.' In feeding trials on indicator plants, the Florida isolate of greenbug exhibited a unique biotypic profile most commonly found on noncultivated grass hosts. It was virulent on the wheat variety GRS1201 that is resistant to the principal agricultural biotypes attacking small grains and to all currently available resistant sorghum varieties.

Nonsystemic Bunt Fungi—Tilletia indica and T. horrida: A Review of History, Systematics, and Biology

The genus Tilletia is a group of smut fungi that infects grasses either systemically or locally. Basic differences exist between the systemically infecting species, such as the common and dwarf bunt fungi, and locally infecting species. Tilletia indica, which causes Karnal bunt of wheat, and Tilletia horrida, which causes rice kernel smut, are two examples of locally infecting species on economically important crops. However, even species on noncultivated hosts can become important when occurring as contaminants in export grain and seed shipments. In this review, we focus on T. indica and the morphologically similar but distantly related T. horrida, considering history, systematics, and biology. In addition, the controversial generic placement and evolutionary relationships of these two species are discussed in light of recent molecular studies.

Biotypic Diversity in Greenbug (Hemiptera: Aphididae): Characterizing New Virulence and Host Associations

Biotypic diversity of the greenbug, Schizaphis graminum (Rondani) (Hemiptera: Aphididae), was assessed among populations collected from cultivated wheat, Triticum aestivum L., and sorghum, Sorghum bicolor (L.) Moench, and their associated noncultivated grass hosts. Greenbugs were collected during May through August 2002 from 30 counties of Kansas, Nebraska, Oklahoma, and Texas. Discounting the presumptive biotype A, five of the remaining nine letter-designated greenbug biotypes were collected; however, biotypes C, F, J, and K were not detected. Biotypes E and I exhibited the greatest host range and were the only biotypes collected in all four states. Sixteen greenbug clones, collected from eight plant species, exhibited unique biotype profiles. Eleven were collected from noncultivated grasses, three from wheat, and two from sorghum. The most virulent biotypes were collected from noncultivated hosts. The great degree of biotypic diversity among noncultivated grasses supports the contention that the greenbug species complex is composed of host-adapted races that diverged on grass species independently of, and well before, the advent of modern agriculture.

Genetic and Pathogenic Analyses of Colletotrichum gloeosporioides Isolates from Strawberry and Noncultivated Hosts

ABSTRACT Colletotrichum crown rot of strawberry in Florida is caused primarily by Colletotrichum gloeosporioides. To determine potential inoculum sources, isolates of Colletotrichum spp. from strawberry and various noncultivated plants growing in the areas adjacent to strawberry fields were collected from different sites. Species-specific internal transcribed spacer primers for C. gloeosporioides and C. acutatum were used to identify isolates to species. Random amplified polymorphic DNA (RAPD) markers were used to determine genetic relationships among isolates recovered from noncultivated hosts and diseased strawberry plants. Selected isolates also were tested for pathogenicity on strawberry plants in the greenhouse. In all, 39 C. gloeosporioides and 3 C. acutatum isolates were recovered from diseased strawberry crowns, and 52 C. gloeosporioides and 1 C. acutatum isolate were recovered from noncultivated hosts. In crown inoculation tests, 18 of the 52 C. gloeosporioides isolates recovered from noncultivated hosts were pathogenic to strawberry. Phylogenetic analysis using RAPD marker data divided isolates of C. gloeosporioides from noncultivated hosts into two separate clusters. One cluster contained 50 of the 52 isolates and a second cluster contained 2 isolates that were homothallic in culture. Isolates from strawberry were interspersed within the cluster containing the 50 isolates that were recovered from noncultivated hosts. The results are not inconsistent with the hypothesis that C. gloeosporioides isolates obtained from strawberry and noncultivated hosts adjacent to strawberry fields are from the same population and that noncultivated hosts can serve as potential inoculum sources for Colletotrichum crown rot of strawberry.

Over-Summering and Biotypic Diversity ofSchizaphis graminum(Homoptera: Aphididae) Populations on Noncultivated Grass Hosts

Greenbug, Schizaphis graminum (Rondani), populations over-summering on noncultivated grass hosts may be implicated in early fall infestations in wheat. The purpose of this study was to examine the relationship between over-summering greenbugs on noncrop hosts and fall infestations on wheat. Since greenbug populations on noncultivated hosts may also act as reservoirs of virulence genes, the biotypes of collected aphids were also determined. The grass species present at three sites (two in Oklahoma and one in Kansas) were identified and a species richness curve was generated. Greenbugs were collected at these sites and their hosts and biotypes determined. At Hays, KS, a persistent over-summering greenbug population lead to an early fall infestation in wheat. At the sites in Oklahoma, where over-summering greenbugs were not detected, the fall infestation occurred 3 months later. Biotypes G, I, K, and a new biotype (i.e., previously undescribed) were found on noncultivated hosts at Hays, but only biotypes I and K were found on the cultivated wheat. Finding a new biotype supports the hypothesis that biotypic diversity (new combinations of virulence genes) is generated and maintained on noncultivated grasses, which may then act as reservoirs of virulence genes found in populations on crops.

Mitochondrial DNA sequence divergence among Schizaphis graminum (Hemiptera: Aphididae) clones from cultivated and non-cultivated hosts: haplotype and host associations.

A 1.0 kb region of the mitochondrial cytochrome oxidase subunit I gene from the greenbug aphid, Schizaphis graminum (Rondani), was sequenced for 24 field collected clones from non-cultivated and cultivated hosts. Maximum likelihood, maximum parsimony and neighbour-joining phylogenies were estimated for these clones, plus 12 previously sequenced clones. All three tests produced trees with identical topologies and confirmed the presence of three clades within S. graminum. Clones showed no relationship between biotype and mtDNA haplotype. At least one biotype was found in all three clades, suggesting exchange among clades of genetic material conditioning for crop virulence, or the sharing of a common ancestor. However, there was a relationship between host and haplotype. Clade 1 was the most homogeneous and contained 12 of 16 clones collected from cultivated hosts and five of the six collected from johnsongrass, Sorghum halepense, a congener of cultivated sorghum, S. bicolor. Four of the six clones collected from Agropyron spp. were found in clade 2. Clade 3 contained two clones from wheat, Triticum aestivum, and four from non-cultivated hosts other than Agropyron spp. A partitioning of populations by mtDNA haplotype and host suggests the occurrence of host adapted races in Schizaphis graminum.