Non-inoculated Seedlings Research Articles

Light Drought Stress Positively Influenced Root Morphological and Endogenous Hormones in Pinus massoniana Seedlings Inoculated with Suillus luteus

Aims An ectomycorrhizal fungus (ECMF) may enhance plant drought resistance. However, there is limited information regarding the effects of ECMFs on drought resistance in Pinus massoniana Lamb., a native species representing an afforestation pioneer tree in subtropical regions of China. Methods In this study, a pot experiment was conducted to determine the effects of ECMF Suillus luteus inoculation on the root morphology and endogenous hormones of P. massoniana, including roots, leaves, and stems, under various water treatment conditions. Four water levels (regular, light, moderate, and severe drought) and three inoculations (inoculated Suillus luteus, numbered S12 and S13, and non-ECMF-inoculated) were compared using a factorial design. Results Under drought stress, P. massoniana seedlings inoculated with S12 and S13 had significantly increased root morphology development (p < 0.05). Light drought positively influenced root development, resulting in a more than twofold increase in root length and root surface area compared to non-inoculated seedlings. Concentrations of gibberellic acid (GA), zeatin riboside (ZR), and indole-3-acetic acid (IAA) in roots, stems, and leaves of inoculated S12 and S13 plants were elevated, whereas abscisic acid (ABA) concentrations were significantly lower, compared to non-inoculated seedlings. The ABA concentrations in the roots of S12 and S13 inoculated seedlings under light drought stress were 1.5 times lower than those in non-inoculated controls. Moreover, root development was positively correlated with plant total GA, IAA, and ZR but negatively correlated with ABA. ConclusionsS. luteus can promote the root growth and development of P. massoniana seedlings, notably by regulating the balance in the concentration of endogenous hormones, thus improving the drought resistance of P. massoniana seedlings.

Chemical and physical characteristics of wheat root mucilage influenced by Serendipita indica symbiosis: a comparison among four cultivars.

Although there is evidence to suggest that the endophytic fungus Serendipita indica plays a crucial role in enhancing plant tolerance against biotic/abiotic stressors, less is known about the impacts of this symbiosis association on root mucilage chemical composition and its physical functions. The mucilage of inoculated and non-inoculated seedlings of four wheat cultivars (i.e., Roshan, Ghods, Kavir and Pishtaz) were extracted using an aeroponic method. Total solute concentration (TCm), carbon content (Cmucilage), electrical conductivity (EC), pH, fatty acids, surface tension (σm), and viscosity (ηm) of mucilage were measured. Ghods and Kavir had the highest and lowest root colonization percents, respectively. Saturated fatty acids, including palmitic and stearic acids, were dominant over unsaturated fatty acids in wheat root mucilage. However, their compositions were significantly different among wheat cultivars. S. indica colonization, especially for Ghods, increased the TCm, Cmucilage, and palmitic acid. Moreover, root mucilage of S. indica-inoculated Ghods had lower σm and greater ηm. An increased amount of powerful surfactants like palmitic acid in the mucilage of S. indica inoculated treatments led to lower σm and greater ηm. Such studies provide further support for the idea that plant-released mucilage plays a major role in modifying the physical environment of the rhizosphere. This knowledge toward truly understanding the rhizosphere can be potentially used for improving the rhizosphere soil quality and increasing crop growth and yield.

First report of Root-Knot Nematode Meloidogyne hapla infecting Siegesbeckia orientalis L. in Shaanxi, China.

Siegesbeckia orientalis L., belonging to the family of Asteraceae and also known as 'Xi-Xian Cao' or Herba Siegesbeckiae, has been an important traditional Chinese medicine since the Tang Dynasty (Wang et al., 2021). As the dried aerial parts have medicinal values, S. orientalis is widely grown in China, Japan, Korea, and Vietnam. One almost 600 m2 block of S. orientalis plants with stunting and leaf withering symptoms was found in Luonan County (110.26 E, 34.06 N), Shaanxi Province, in August 2022. Many galls were observed on the roots of these plants, and densities of second-stage juveniles (J2s) were 260~370 per 100 cm3 of soil. Females and eggs were dissected from infected roots, and J2s and males were extracted from the soil for species identification. The perineal patterns of females (n=20) were oval-shaped, with minor dorsal arches, distinct lateral fields, and tiny punctations around anus. The head caps of males were high and obviously narrower than head region which broadened out of the first body annuli. Morphological measurements of females (n=20) were: body length (L) = 897.66 ± 50.89 (860.96-949.74) μm, body width (BW) = 577.69 ± 51.01 (489.91-638.65) μm, stylet length (ST) = 14.03 ± 0.63 (13.25-14.97) μm, dorsal pharyngeal gland orifice to stylet base (DGO) = 4.96 ± 0.47 (4.08-5.37) μm, vulval slit length = 18.82 ± 1.97 (17.24-22.02) μm, vulval slit to anus distance = 13.62 ± 1.22 (12.34-16.18) μm. Measurements of males (n=10) were: L = 1298.73 ± 95.96 (1202.77-1394.69) μm, BW = 28.24 ± 2.38 (25.93-30.55) μm, ST = 20.23 ± 0.78 (19.42-21.04) μm, DGO = 4.89 ± 0.44 (4.56-5.22) μm, spicule length = 28.98 ± 1.68 (26.94-31.02) μm. Measurements of J2s: L = 375.35 ± 14.02 (341.01-400.46) μm, BW = 15.09 ± 1.47 (12.02-16.82) μm, ST = 12.74 ± 0.61(11.46-13.84) μm, DGO = 2.58 ± 0.59 (1.61-3.7) μm, tail length= 74.15 ± 13.73 (50.92-95.09) μm, hyaline tail terminus= 11.36 ± 2.27 (9.53-17.85) μm. These morphological characteristics were consistent with those of Meloidogyne hapla Chitwood, 1949 as described by Whitehead (1968). The DNA of single females (n=10) was isolated using the Proteinase K method for molecular identification (Kumari and Subbotin, 2012). The sequence of rDNA-ITS region was amplified and sequenced with the primers rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al., 1992). The 768 bp sequence (GenBank OP542552) was 99.74% identical to the rDNA-ITS sequences of M. hapla (JX024147 and OQ269692). Then the D2/D3 fragments of the 28S rRNA were amplified and sequenced with the primers D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA) (McClure et al., 2012). The 762 bp fragment (OP554218) showed 100% identical to sequences of M. hapla (MN752204 and OM744204). To confirm the pathogenicity of the population, six 2-week-old healthy S. orientalis seedlings cultured in sterilized sand were each inoculated with 2,000 J2s hatched from egg masses. Four non-inoculated seedlings served as negative controls. After maintenance at 25°C for 60 days, galls appeared on the roots of inoculated plants, being consistent with the symptoms observed in field, while the negative controls showed no symptoms. Females collected from inoculated plants were identified as M. hapla with species-specific primer JWV1/ JWV (Adam et al., 2007), which amplified a fragment of 440 bp. Parasitism was also confirmed by the average recovery of 3,814 J2s per inoculated plant with the reproductive factor of 1.91. This is the first report of S. orientalis being a host of M. hapla. The disease reduces the quality and yield of S. orientalis, and much more efforts would be made for its control in production.

The use of Pisolithus albus found in saline areas to improve the growth of Eucalyptus seedlings under high salinity conditions

ABSTRACT Salinity is an abiotic factor limiting plant fitness and therefore forest crop productivity, and salt-affected areas have been expanding throughout the world. Ectomycorrhizal (ECM) fungi can improve the salt tolerance of woody plants, including Eucalyptus species To screen for salt-resistant Pisolithus albus (PA) isolates, 16 PA isolates were cultivated on modified Melin-Norkrans agar containing NaCl at concentrations of 0, 10, 20, and 30 dS m−1. The P. albus isolate PA33 had the greatest salt resistance under 10 and 20 dS m−1 NaCl, which are soil salinity levels in salt-affected areas of Thailand. We studied the effect of PA33 on Eucalyptus camaldulensis × E. pellita cuttings under salt stress (0 and 16 dS m−1) for 1 month. PA enhanced the growth of the Eucalyptus seedlings, as indicated by higher relative growth rates in height and root collar diameter of inoculated seedlings compared with non-inoculated seedlings. Moreover, the inoculated seedlings had less cell damage from NaCl, as indicated by significantly lesser leaf thickness and electrolyte leakage than the controls. These findings could lead to practices conferring socioeconomic and environmental benefits, as abandoned salt-affected areas could be reclaimed using such Eucalyptus seedlings inoculated with salt-tolerant ECM fungi.

No synergy between P and AMF inoculation to improve Sun Protection Factor production in Anadenanthera colubrina (Vell.) Brenan leaves

Secondary metabolite production in medicinal plants and other plants is improved by arbuscular mycorrhizae, plant stress, as well as nutritional factors. The compounds responsible for Sun Protection Factor from Anadenanthera colubrina (Vell.) such as flavonoids and proanthocyanidins may also increase by manipulation of plant stress or nutrient status, and inoculation with arbuscular mycorrhizal fungi (AMF). However, specific gaps regarding the viability of this agricultural tool need clarification, especially regarding the role of Phosphorus (P), one of the mycorrhizal symbiosis regulators and widely employed in plant cultivation. Therefore, this study aimed to understand the role of P in regulating SPF in Anadenanthera colubrina when cultivated in association with arbuscular mycorrhizal fungi (AMF). To this end, two concentrations of P2O5 (8 mg dm−3 and 50 mg dm−3) were evaluated, and two inoculation treatments were tested: control and seedlings inoculated with AMF inoculant. After 150 days in a greenhouse, the leaves were collected to obtain the ethanolic extracts and used to assess the SPF, production of flavonols, proanthocyanidins, saponins, pigments, and in vitro antioxidant activity. The presence of higher P levels in the soil (50 mg dm−3) renders mycorrhizal inoculation dispensable for the enhancement of SPF, production of photoprotective compounds, and antioxidant activity as plants grown under this condition showed a six-fold increase compared to non-inoculated seedlings kept in soil with a lower P level. On the other hand, leaves of A. colubrina seedlings inoculated with AMF and cultivated in soil supplemented with 8 mg P dm−3 displayed a SPF with a 4.9-fold increase and the biosynthesis of photoprotective and antioxidant compounds enhanced by more than five-fold compared to those not inoculated. Despite these benefits, these cultivation practices did not increase the accumulation of carotenoids and chlorophylls. Mycorrhizal inoculation and phosphate fertilization are agricultural practices that, independently, contribute to the increased SPF, biosynthesis of secondary metabolites, and antioxidant activity in A. colubrina leaves.

Colonization of root endophytic fungus Serendipita indica improves drought tolerance of Pinus taeda seedlings by regulating metabolome and proteome.

Pinus taeda is an important forest tree species for plantations because of its rapid growth and high yield of oleoresins. Although P. taeda plantations distribute in warm and wet southern China, drought, sometime serious and long time, often occurs in the region. To explore drought tolerance of P. taeda and usage of beneficial microorganisms, P. taeda seedlings were planted in pots and were inoculated with root endophytic fungus Serendipita indica and finally were treated with drought stress for 53 d. Metabolome and proteome of their needles were analyzed. The results showed that S. indica inoculation of P. taeda seedlings under drought stress caused great changes in levels of some metabolites in their needles, especially some flavonoids and organic acids. Among them, the levels of eriocitrin, trans-aconitic acid, vitamin C, uric acid, alpha-ketoglutaric acid, vitamin A, stachydrine, coumalic acid, itaconic acid, calceolarioside B, 2-oxoglutaric acid, and citric acid were upregulated more than three times in inoculated seedlings under drought stress, compared to those of non-inoculated seedlings under drought stress. KEGG analysis showed that some pathways were enriched in inoculated seedlings under drought stress, such as flavonoid biosynthesis, ascorbate and aldarate metabolism, C5-branched dibasic acid metabolism. Proteome analysis revealed some specific differential proteins. Two proteins, namely, H9X056 and H9VDW5, only appeared in the needles of inoculated seedlings under drought stress. The protein H9VNE7 was upregulated more than 11.0 times as that of non-inoculated seedlings under drought stress. In addition, S. indica inoculation increased enrichment of water deficient-inducible proteins (such as LP3-1, LP3-2, LP3-3, and dehydrins) and those involved in ribosomal structures (such as A0A385JF23). Meanwhile, under drought stress, the inoculation caused great changes in biosynthesis and metabolism pathways, mainly including phenylpropanoid biosynthesis, cutin, suberine and wax biosynthesis, and 2-oxocarboxylic acid metabolism. In addition, there were positive relationships between accumulation of some metabolites and enrichment of proteins in P. taeda under drought stress. Altogether, our results showed great changes in metabolome and proteome in inoculated seedlings under drought stress and provided a guideline to further study functions of metabolites and proteins, especially those related to drought stress.

Mycorrhizal colonization and calcium spraying modulate physiological and antioxidant responses to improve pepper growth and yield under salinity stress

Abiotic stresses, such as salt and drought, limit plant growth, reduce crop production, and pose the greatest challenge to the sustainability of agricultural development in arid and semi-arid countries. Arbuscular mycorrhizal fungi (AMF) and calcium can play an important role in alleviating the adverse effects of abiotic stresses on plants. Therefore, this study was conducted to evaluate the effect of two levels of mycorrhizal inoculation (inoculated seedlings and non-inoculated seedlings) and three levels of foliar spraying with calcium (0, 0.5%, and 1%), separately or in combination, on growth, physiology, and yield of salt-stressed pepper (Capsicum annuum L.). The experiment was conducted in an open field with saline soil and irrigation water, in a randomized complete block design with split plot arrangement. Mycorrhizal inoculation and calcium spray have been shown to facilitate nutrient uptake, modulate physiological responses, and activate the antioxidant system, enhancing salt stress tolerance and improving the growth and yield of salt-stressed pepper. Combined treatment plants grown from inoculated seedlings and sprayed with 1% Ca recorded the best results, alleviating salt stress-induced oxidative damage by activating the antioxidant system including antioxidant enzymes [Superoxide dismutase (SOD) and catalase (CAT)], and non-enzymatic antioxidants (ascorbic acid and phenols), reducing H2O2 and malondialdehyde (MDA) accumulation, enhancing physiological activities (relative water content (RWC %) and chlorophyll content), and improving nutrient balance (increasing N, P, K and reducing Na content), leading to increased pepper growth and yield parameters. Our results indicated that mycorrhizal inoculation and calcium spray can be recommended as a practical alternative and environmentally friendly approach to enhance plant tolerance to salt stress by improving nutritional status, physiological processes, and antioxidant activities, thus increasing the morphological and yield traits of stressed plants.

First report of Fusarium solani causing Fusarium wilt of Bletilla striata (hyacinth orchid) in Zhejiang province of China.

Bletilla striata, a member of the family Orchidaceae, is a perennial herbaceous plant used in Chinese medicine. It is a commonly cultivated economic crop in the Yangtze River Basin provinces of China, as its roots are used to treat bleeding and inflammation. In Zhejiang province, Bletilla striata has a planting area of 1400 hectares with a total production of approximately 2.6×106 kg. In October 2021, over 40% of B. striata plants showed severe wilt in a traditional Chinese medicine plantation (ca. 10 ha) in Xianju City, Zhejiang Province, China. In July, leaf curling, crinkling, and leaf-edge browning of the diseased plants were first noticed in the field. Then, necrotic streaks gradually spread to the roots. Stems displayed chlorosis and withering and when they were cut vertically, symptoms such as vascular bundle discoloration, appeared. After October, the individual plants slowly wilted and died, their aboveground parts became filamentous, and the epidermis detached from the corm's fibrous roots. Diseased plants were easily removed as the corm root had fractured. White mycelia were clearly seen in the stem. Three symptomatic leaves and three stems were cut, their surfaces disinfected, and plated on potato dextrose agar (PDA). Six strains were subsequently isolated from all samples. Fungal colonies with white to cream-colored mycelia from all tissues appeared after 3 d of incubation at 26 °C. Pure cultures obtained after monospore isolation were examined for their morphological characteristics. The colonies grew rapidly, were fluffy and appressed, and had cottony white to pale cream coloration. Microconidia were hyaline, oval to reniform, with zero or one-septate (4.0-12.0 × 1.0-5.5 µm), and usually formed on elongated monophialidic conidiogenous cells. Macroconidia were wide, fusiform, or slightly curved with one or three septa (23.0-36.0 × 4.5-7.0 μm). Chlamydospores were spherical and were abundant on carrot agar (CA) medium within 2 wk. Fresh mycelia and conidia that grew at 26 ℃ for 7 d were collected from PDA plates. Next, DNA was extracted using the Ezup Column Fungi Genomic DNA Purification kit (Sangon Biotech, Shanghai, China). We amplified a portion of RNA polymerase II second largest subunit gene (RPB2) using primers 5f2/7cr (O'Donnell et al. 2010), the internal transcribed spacer (ITS) region using primers ITS1F/ITS4 (White et al. 1990), and the partial translation elongation factor-1α gene using primers EF1/ EF2 (O'Donnell et al. 1998) from the genomic DNA and sent the PCR amplicons for sequencing at Tsingke Biotechnology Co., Ltd., Wuhan, China. A BLAST search of the obtained sequences (GenBank accessions OP743920, OP913183, and OP913180) showed 99-100% homology with the respective sequences of the Fusarium solani reference isolate NRRL46702 (O'Donnell et al. 2008). Based on the morphological and molecular characteristics and BLAST search, the fungus was identified as F. solani (Leslie and Summerell 2006). Pathogenicity of the purified F. solani isolate was assessed by inoculateing a F. solani spore suspension of 1×106 conidia/mL (20 mL per seedling) on corm wounds made with a toothpick. Four inoculated and three non-inoculated seedlings (sterilized water as a negative control) were grown in a greenhouse at 26 °C under natural sunlight and covered with plastic bags to maintain humidity for 72 h. After 15 d, leaf browning on leaf edges, new leaf bases, and corm epidermis was observed. Symptoms, similar to those detected in the original sample, developed on the inoculated leaves, whereas the controls remained asymptomatic. Fusarium solani was successfully re-isolated from all four inoculated seedlings, and their identity confirmed by generating partial Tef1 and RPB2 sequences, thereby fulfilling the Koch's postulate. To our knowledge, F. solani has not been previously reported as a pathogen of B. striata.

Halotolerant Rhizobacteria Promote Plant Growth and Decrease Salt Stress in Carya illinoinensis (Wangenh.) K. Koch

Pecan cultivation holds significant global importance. Salinity negatively affects the physiology and metabolism of the plant. However, certain plant growth-promoting rhizobacteria (PGPR) have the ability to reduce salt stress in plants. The objective was to analyze the effects of the rhizobacteria Bacillus paralicheniformis strain LBEndo1 on the development of pecan seedlings under salinity stress conditions. Two factors were analyzed: the presence of saline stress and the bacterial inoculation. The bacterial application was conducted at a concentration of 1 × 108 CFU/mL, and irrigation was administered every third day with 80 mL of water containing 50 mM NaCl. The results show that the rhizobacteria has a maximum tolerance of 15% salinity. Furthermore, the inoculation of PGPR significantly increased the biomass of the seedlings, including the dry weight of leaves, stem, and roots, as well as the stem diameter and height. Furthermore, seedlings that interacted with the rhizobacteria exhibited superior development under saline conditions, with significant increases of 105.5% in chlorophyll concentration and 112% in proline accumulation compared to non-inoculated seedlings. Additionally, a remarkable reduction in leaf damage caused by salt stress was observed. In conclusion, the LBEndo1 rhizobacteria, being a strain resistant to salinity and possessing multiple mechanisms to promote growth while mitigating salt stress, has the potential to be utilized in pecan seedlings to alleviate stress caused by salinity and increases biomass.

Effect of mycorrhization on growth and physiology performance of Quercus species

The development of mycorrhiza could contribute to strengthening the resilience of forest ecosystems to climate change. Several mycorrhizal fungi are known for their valuable effect in increasing plant performances and adaptation to stressful environmental conditions. Thereby, this research aims to investigate how Terfezia boudieri (Chatin) mycorrhizal fungi affects the growth (primary root length, above-ground plant weight) and the physiological behaviour (net photosynthesis, responses to intercellular [CO2] and the intensity of photosyntically active radiation) of Quercus subsp. coccifera and Q. suber L. Inoculated and non-inoculated seedlings of the two Quercus species were grown in one-liter pots in the greenhouse, with a temperature that ranged from 25 to 30 °C, natural lighting and an irrigation applied twice a week with top water. Results revealed that primary root length and the above-ground biomass increased with mycorrhization. In addition, mycorrhization promoted net photosynthesis (at 400 ppm and at saturation point), the apparent quantum yield, the water use efficiency, and the photosynthetic pigments contents. However, inoculation decreased the light compensation point for both species. Effectiveness of T. boudieri inoculation on Quercus sp. performance, highlights the potential of the mycorrhization process to improve forest management and resilience to climate change.

Effects of AMF inoculation on the growth, photosynthesis and root physiological morphology of root-pruned Robinia pseudoacacia seedlings.

Root pruning hinders the absorption and utilization of nutrients and water by seedlings in the short term. Arbuscular mycorrhizal fungi (AMF) are an important source of nutrient and water for seedlings except for the root system. However, the mechanism by which AMF affect the physiological growth of seedlings after root pruning has rarely been studied. In this study, a pot experiment was conducted through a three-compartment partition system to clarify the effects of Funneliformis mosseae (F. mosseae) strain BGC XJ07A on the physiological growth of root-pruned Robinia pseudoacacia seedlings. Five root pruning treatments (zero, one-fifth, one-fourth, one-third and one-half of the taproot length were removed) were applied to noninoculated seedlings and those inoculated with F. mosseae. The results showed that the presence of F. mosseae significantly increased the shoot and root biomasses, leaf photosynthetic rate, stomatal conductance and transpiration rate. The root projected area, root surface area, average root diameter, root density, root volume and number of root tips of the inoculated seedlings were higher than those without inoculation in all root pruning treatments. The root cytokinin, gibberellins and indole-3-acetic acid concentrations, but root abscisic acid concentration, were higher than those measured in the absence of inoculation in all root pruning treatments. Moreover, the changes in the root endogenous hormone concentrations of the seedlings were closely related to the root morphological development and seedling biomass. The AMF increased the soil available nitrogen, soil available phosphorus, soil available potassium and soil organic matter concentrations compared with the noninoculated treatment. These results indicate that AMF can alleviate the adverse effects of root pruning on the physiological growth of R. pseudoacacia and soil properties, and can provide a basis for AMF application to forest cultivation and the sustainable development of forest ecosystems.

Arbuscular Mycorrhizae Alter Photosynthetic Responses to Drought in Seedlings of Artemisia tridentata.

The establishment of Artemisia tridentata, a keystone species of the sagebrush steppe, is often limited by summer drought. Symbioses with arbuscular mycorrhizal fungi (AMF) can help plants to cope with drought. We investigated this possible effect on A. tridentata seedlings inoculated with native AMF and exposed to drought in greenhouse and field settings. In greenhouse experiments, AMF colonization increased intrinsic water use efficiency under water stress and delayed the decrease in photosynthesis caused by drought, or this decrease occurred at a lower soil water content. In the field, we evaluated the effect of AMF inoculation on colonization, leaf water potential, survival, and inflorescence development. Inoculation increased AMF colonization, and the seedlings experienced water stress, as evidenced by water potentials between -2 and -4 MPa and reduced stomatal conductance. However, survival remained high, and no differences in water potentials or survival occurred between treatments. Only the percentage of plants with inflorescence was higher in inoculated than non-inoculated seedlings. Overall, the greenhouse results support that AMF colonization enhances drought tolerance in A. tridentata seedlings. Yet, the significance of these results in increasing survival in nature remains to be tested under more severe drought than the plants experienced in our field experiment.

Trichoderma longibrachiatum Inoculation Improves Drought Resistance and Growth of Pinus massoniana Seedlings through Regulating Physiological Responses and Soil Microbial Community.

Drought stress poses a serious threat to Pinus massoniana seedling growth in southern China. Trichoderma species, as beneficial microorganisms, have been widely used in agriculture to enhance plant growth and drought tolerance, but the interaction mechanisms remain unclear. To investigate the effect of drought-resistant Trichoderma longibrachiatum inoculation on P. massoniana growth under drought stress, the plant physiological indicators and rhizosphere microbiome diversity were measured to identify Trichoderma-activated mechanisms. Trichoderma longibrachiatum inoculation significantly promoted P. massoniana growth under drought treatment, and enhanced nitrogen, phosphorus, and potassium absorption compared with those of non-inoculated seedlings. Trichoderma longibrachiatum treatment alleviated the damage to cell membranes and needle tissue structure, and significantly increased antioxidant enzyme activities, osmotic substance contents, and photosynthesis in P. massoniana in response to drought stress. Soil nutrient contents, activities of sucrase, phosphatase, and urease as well as the relative abundances of the dominant genera Burkholderia, Rhodanobacter, and Trichoderma were elevated in the rhizosphere soil of P. massoniana inoculated with T. longibrachiatum under drought stress. A network analysis showed that certain crucial dominant taxa driven by T. longibrachiatum inoculation, including Penicillium, Trichoderma, Simplicillium, Saitozyma, Burkholderia, Bradyrhizobium, Sinomonas, and Mycobacterium, had more correlations with other microorganisms in the soil. Trichoderma longibrachiatum enhanced P. massoniana seedling growth under drought stress by regulating physiological responses and soil microbial community.

First Report of the Root-Knot Nematode Meloidogyne enterolobii infecting Acalypha australis in China.

Copperleaf (Acalypha australis; Euphorbiaceae), widely cultivated in China, is a traditional Chinese herbal medicine that is used for clearing heat and detoxifying, astringency and hemostasis (Zhang and Zhang 1994). In September 2021, wild Asian copperleaf plants showed leaf yellowing in a corner outside a greenhouse (22°50' N; 108°17' E), Guangxi Province, China. Galls and egg masses were observed on the plant roots on approximately 60% of plants. Females and second-stage juveniles (J2) were dissected and extracted from roots with galls. The perineal pattern of females was dorsal-ventrally oval with low and round dorsal arches, lacking clear lateral lines. Morphological measurements of females (n=20; mean ± standard error) were body length (BL) 697.7 ± 17.3 μm, maximum body width (BW) 521.5 ± 18.3 μm, stylet length 14.8 ± 0.3 μm, and dorsal pharyngeal gland orifice to stylet base (DGO) 5.1 ± 0.2μm. J2s (n = 20) were vermiform, had a slender tail, with a tapering to rounded tip with distinct hyaline region at the tail terminus and had the following morphological measurements: BL 475.5 ± 32.7 μm, BW 16.7 ± 0.6 μm, stylet length 14.4 ± 1.4 μm, DGO 3.9 ± 0.1 μm, hyaline tail length 18.0 ± 0.6 μm, and tail length 50.1 ± 1.2 μm. These morphological characteristics fit the description for Meloidogyne enterolobii (Yang and Eisenback 1983). In order to confirm species identification, genomic DNA was extracted from 12 single J2 (Luo et al. 2020). Species identity was further explored by the rDNA-internal transcribed spacer (ITS) region using primers V5367/26S (Vrain et al. 1992), and the D2-D3 fragment of the 28S ribosomal RNA gene using primers D2A/D3B (De Ley et al. 1999). The sequences for the target genes were 733 bp (GenBank accession no. OM168996) and 734 bp (GenBank accession no. OM177195), respectively. Homologies were 99 to 100% identical with those in GenBank for known sequences of M. enterolobii. Furthermore, species identification was confirmed using PCR to amplify a portion of the rDNA-IGS2 with M. enterolobii-specific primers Me-F/Me-R (Long et al. 2006). Koch's postulates was tested in a greenhouse at 25 to 28˚C temperature. Eggs were multiplied on tomato in the greenhouse using a single egg mass hand-picked from originally natural infected A. australis roots. Fifteen A. australis seedlings maintained in 14.5-cm diameter and 10-cm high pots containing autoclaved sandy soil (sand/soil = 3:1), one seedling/pot, inoculated with 5,000 eggs/plant, and five noninoculated seedlings were used as controls. After 60 days, all inoculated plants showed galling root symptoms and the control plants displayed no symptoms. The reproduction factor (Rutter et al. 2021) on A. australis was 4.3. Furthermore, the morphological and molecular characterization of the nematode was identical to the original samples. To our knowledge, this is the first report of M. enterolobii infecting Asian copperleaf that is cultivated in 29 provinces/regions of China. The growers should be aware of this nematode and take measures to avoid spread and serious economic losses.

Occurrence of the Reniform Nematode Rotylenchulus reniformis on Sponge Gourd (Luffa cylindrica) in Yunnan Province, China.

Sponge gourd (Luffa cylindrica) is an important annual climbing herbaceous crop used as edible vegetable, industrial material and medicine crop. It is widely cultivated in China. In October 2019, six root and rhizosphere soil samples were collected from a field growing sponge gourd (cv. Zaoxiu 6) in Caoba Town, Mengzi City, Yunnan Province, China. Sponge gourd roots exhibited distinct brown lesions, while above-ground symptoms of plants were not observed in this field at sampling. Nematodes were extracted from soil using the modified tray method, and nematodes in root tissues were observed using the acid fuchsin method (Whitehead and Hemming 1965; Bybd et al. 1983). Reniform nematodes (Rotylenchulus) were found in all samples with population densities of 447 ± 120 nematodes/100 g of soil and 52 ± 21 nematodes/1.0 g of root. The immature females were vermiform and ventrally curved to spiral-shaped upon fixation, with a conoid and continuous lip region, slender and well-developed stylet with rounded basal knobs and oesophageal glands overlapping the intestine laterally and mostly ventrally. The tails was slightly tapering to a rounded tip with distinct hyaline tail terminus. Morphological measurements of immature females (n = 20) included body length (L) = 392.3 ± 20.4 μm (352.8 to 436.7 μm), stylet = 18.6 ± 0.5 μm (17.6 to 19.4 μm), tail length= 25.9 ± 2.2 μm (20.1 to 29.9 μm), a = 25.2 ± 1.1 (23.5 to 27.3), b = 3.2 ± 0.4 (2.6 to 4.0), c = 15.2 ± 1.2 (13.6 to 18.6), c' = 2.9 ± 0.3 (2.2 to 3.3), V = 70.3 ± 1.0 (68.5 to 72.6). The males were vermiform with poorly developed stylet and esophageal median bulb, ventrally arcuate spicule, and indistinct bursa. Measurements of males (n = 20) were L = 426.7 ± 31.0 μm (368.1 to 463.9 μm), stylet = 12.8 ± 0.8 μm (11.2 to 14.1 μm), tail length= 26.3 ± 1.8 μm (24.3 to 29.4 μm), spicule = 20.6 ± 0.9 μm (19.6 to 22.7 μm), a = 27.7 ± 2.2 (25.2 to 30.7), b = 4.5 ± 0.4 (3.9 to 4.8), c = 15.5 ±0.9 (14.7 to 16.8), c' = 2.8 ± 0.3 (2.5 to 3.2). These morphological characters were similar to those described for R. reniformis (Palomares-Rius et al. 2018). Genomic DNA was extracted from single immature females as described by Song et al. (2021). The rDNA-ITS region and D2-D3 region of the 28S rRNA gene were amplified using primers 18s/26s (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) and D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA), respectively (Vrain et al. 1992; Subbotin et al. 2006). The obtained rDNA-ITS sequence (1003 bp, GenBank accession No. MT332839) and D2-D3 region of the 28S rRNA gene sequence (787 bp, MT328542) showed more than 99% identity with several R. reniformis sequences deposited in the GenBank database (e.g., MT209977, KP018557, GU003947; KJ755184, MT225542, HM131858). In greenhouse pathogenicity tests, 12 two-leaf stage sponge gourd seedlings (cv. Zaoxiu 6) maintained in 14-cm-diameter and 12-cm-height pots with sterilized commercial soil (pH 5.5-7.0; organic matter 35%), were inoculated with 500 mixed vermiform stage nematodes of R. reniformis extracted from the infested field soil samples per plant. Eight non-inoculated seedlings were used as controls. After 60 days, all inoculated plants exhibited slight symptoms of root browning compared with the control. The nematode reproduction factor (final population/initial population) was 12.4. No nematodes and root browning were observed on control plants. R. reniformis has been reported on sponge gourd in Shanghai, Fujian, Guangdong, and Hainan provinces of China (Ding et al., 2015). To our knowledge, this is the first report of R. reniformis infecting sponge gourd in Yunnan Province, China. Yunnan Province is one of the biggest sponge gourd producing areas in China. Since R. reniformis is a highly pathogenic nematode and damages sponge gourd, control measures should be taken to avoid its spread to other regions or host crops in China.

First Report of Meloidogyne graminicola Naturally Infecting Cyperus difformis in China.

Cyperus difformis is a problematic annual weed in rice fields and is widely distributed throughout tropical to warm temperate regions of the world. In June 2019, many galls were observed on the roots of C. difformis growing in rice fields in Heshan District, Hengyang City, Hunan Province, China. The infected plants did not exhibit obvious aboveground symptoms. Females, males, eggs, and second-stage juveniles (J2s) of Meloidogyne spp. were found within galls after dissection. The perineal patterns of females were dorsoventrally oval shape with low and round dorsal archs, smooth striae, and lacking distinct lateral lines. Morphological measurements of females (n = 20) included body length (L) = 589.4 ± 64.7 (482.1 to 693.8) μm, body width (BW) = 362.2 ± 84.6 (267.6 to 505.9) μm, stylet = 11.7 ± 1.5 (9.7 to 14.4) μm, dorsal pharyngeal gland orifice to stylet base (DGO) = 3.8 ± 0.6 (3.3 to 5.0) μm, vulval slit length = 23.7 ± 4.4 (15.5 to 28.9) μm, vulval slit to anus distance = 16.8 ± 2.7 (13.1 to 19.4) μm. The J2s were vermiform and had a long and slender tail with tapering hyaline tail terminus. Measurements of J2s (n = 20) were L = 464.4 ± 31.7 (415.0 to 508.3) μm, BW = 16.9 ±1.7 (14.1 to 19.7) μm, stylet = 13.2 ± 0.6 (12.5 to 14.9) μm, DGO = 3.3 ± 0.5 (2.6 to 4.4) μm, tail = 71.6 ± 5.5 (65.1 to 82.0) μm, hyaline tail length = 19.4 ± 2.6 (15.3 to 23.9) μm. These morphological characteristics were similar to those previously described for M. graminicola (Golden and Birchfield 1965). Genomic DNA extracted from a single J2 was used for molecular identification. The ITS rRNA gene and the mtDNA COII-16S rRNA region were amplified using primers 18s/26s (TTGATTACGT CCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) and C2F3/1108 (GGTCAATGT TCAGAAATTTGTGG/TACCTTTGACCAATCACGCT), respectively (Powers and Harris 1993; Vrain et al. 1992). Both the ITS rRNA gene sequence (790 bp, GenBank accession no. MZ656127) and the mtDNA COII-16S rRNA region sequence (531 bp, OM161973) showed 100% identity with sequences of M. graminicola (e.g., MN647593, MG773553, MF320126; MG356945, MH332687, JN241939). Furthermore, species identification was also further validated using the M. graminicola-specific primers SCAR-MgFW/SCAR-MgRev (GGGGAAGACATTTAATTGATGATCAAC/GGTACCGAAACTTAGGGAAAG) (Bellafiore et al. 2015). The PCR products yielded the expected fragment size of 640 bp, which was identical to that previously reported for M. graminicola (Bellafiore et al. 2015). To verify the pathogenicity of this nematode, 15 30-day-old C. difformis seedlings planted in pots with sterilized soil were inoculated with 400 freshly hatched J2s from the original population of M. graminicola per plant, and five non-inoculated seedlings were used as controls. All plants were grown in a greenhouse at 26 to 28 °C with a 16 h light/8 h dark photoperiod. At 30 days after inoculation, all inoculated plants showed gall symptoms on the roots identical to those observed in the fields. The nematode reproduction factor (final population/initial population) was 12.6. No symptoms were observed on non-inoculated plants. These results confirmed the pathogenicity of M. graminicola on C. difformis. To our knowledge, this is the first report of M. graminicola naturally infecting C. difformis in China. C. difformis is an alternative host of M. graminicola and could serve as a potential reservoir for M. graminicola in field. Therefore, weed management could be an effective way to reduce the disease by eliminating source of infection of M. graminicola.

First Report of Puccinia engleriana Causing Leaf Rust of Tabernaemontana bufalina in Hainan, China.

Tabernaemontana bufalina Lour. is extensively cultivated as an ornamental plant in Hainan, Guangdong, and other regions of southern China. In January 2020, we observed a rust disease on T. bufalina leaves in Sanya (18.15。N and 109.30。E) Hainan, China, and the rust occurred all year-round. In the early stage of rust, yellow chlorotic spots appeared, and then uredinia on the abaxial leaf surface became visible. Uredinia (approximately 200-700 µm in diameter) were mostly yellowish-brown in color, solitary, and irregularly scattered. In the late stage of the disease, spots were connected into lesions, and eventually, the whole leaf became severely chlorotic. Urediniospores were light brown, subglobose, measured 25-30 µm × 20-25 µm. They had two pores and were echinulate with spines spaced 2-5 µm. The teliospores were naked, scattered, or aggregated on severely infected leaves. They were two-celled, measured 33-40 µm × 25-30 µm, elliptic, dark brown, and covered with tiny spines. The teliospores had a colorless pedicel at one end which was approximately 28-34 µm long and enlarged at the lower part. The morphological characteristics of the spores were consistent with the descriptions of Puccinia engleriana Henn. (Hennings 1905). In China, P. engleriana was first identified on the leaves of Tabernaemontana divaricata (L.) in Yunnan province, and recorded as new to China in 2012 (Zhuang 2012). Untill now, no leaf rust caused by P. engleriana has been reported in Hainan. Urediniospores were collected and DNA was extracted using a Quick-DNA extraction Kit (TIANGEN Biotech, Beijing, China). The nuclear large subunit (28S) region of the ribosomal DNA repeat was amplified with primers Rust28SF (Aime et al. 2018) and LR5 (Vilgalys and Hester 1990) following the protocol of Aime and McTaggart (2021). The length of the large subunit sequence was 1,010 bp. When searched the GenBank database, the sequence showed 97.07% homology to the large subunit ribosomal RNA gene (Sequence ID: MW147048.1) of P. engleriana, and 92.5% similarity with 18S ribosomal RNA gene (Sequence ID: KM249855.1) of P. hemerocallidis. This result was consistent with the morphological identification. As for the 3% difference in large subunit ribosomal RNA gene, it was speculated that it may be related to the differences of geographical distribution and host plants, as the reference P. engleriana was obtained from Tabernaemontana orientalis in Australia (Aime and McTaggart 2021). The large subunit sequence was submitted into the GenBank database, with accession No. MZ314895. T. bufalina cutting seedlings with 4 available leaves were used in the Koch's postulate test. These seedlings were planted in a greenhouse with a 14 h/10 h light/dark photoperiod at 28°C and 65% humidity. The urediniospores suspension (5107/ml in 0.05% Tween 20 solution) was sprayed on 6 healthy seedlings and other 6 seedlings were sprayed with 0.05% Tween 20 solution as a negative control. Two weeks after inoculation, leaf chlorosis and yellowish uredinia were observed on the inoculated seedlings, whereas the non-inoculated seedlings stayed healthy. To our knowledge, this is the first report of P. engleriana causing leaf rust on T. bufalina in Hainan province. This report will provide the reference for future investigation of T. bufalina leaf rust, and for further improvement on the knowledge of the geographical distribution of P. engleriana in China.

Arbuscular Mycorrhizal Fungi Improve Growth and Phosphate Nutrition of Acacia seyal (Delile) under Saline Conditions

Many plant species adapted to semi-arid environments are grown in the Sahelian region in northern Africa. One such species is Acacia seyal (Delile), a multipurpose leguminous tree grown in various agroecological zones, including saline soils. These challenging arid and semi-arid environments harbor a diversity of arbuscular mycorrhizal fungi (AMF) communities that can develop symbiotic associations with plants to improve their hydromineral nutrition. This study compared the effects of native AMF communities isolated from semi-arid sites (high, moderate, and low salinity zones Ndiafate, Ngane, and Bambey, respectively) and the AMF Rhizoglomus aggregatum on the development and phosphate nutrition of A. seyal seedlings subject to three salinity treatments (0, 340, and 680 mM). Plant height, dry matter weight of the shoots and roots, and phosphorus uptake from the soil were measured. Plants inoculated with AMF native species from each site that were provided with up to 340 mM of NaCl had greater shoot height than plants grown under 680 mM salinity. At NaCl concentrations above 340 mM, shoot and root development of A. seyal seedlings diminished. However, dry matter production of shoots (7%) and roots (15%) improved following AMF inoculation compared with the control (respectively 0.020 and 0.07 g for shoots and roots). When inoculated with AMF isolates from the high salinity zone (Ndiafate), phosphate content/nutrition was increased by 10% around 30 days after inoculation compared with non-inoculated seedlings (2.84 mg/kg of substrate). These results demonstrate that native AMF inoculants are capable of helping plants withstand environmental constraints, especially those exposing plants to harsh climatic conditions. We discuss insights on how AMF influences the interplay between soil phosphorus and perceived salinity that may have implications for broader relationships between plants and symbiotic fungi.

Application of plant growth promoting bacteria enhances the growth of yerba mate (Ilex paraguariensis St. Hil) in greenhouse

Yerba mate is an economically and culturally important South American plant. The objective of the present research was to assess the growth promotion capacity of endophytic spore-forming bacteria on Ilex paraguariensis St. Hil in greenhouse. Seedlings were inoculated with Bacillus altitudinis (strains 19RS3 and T5S-T4), Kosakonia radicincitans YD4, and their combinations. Azospirillum brasiliense sp.245 and non-inoculated seedlings were used as controls. Inoculated seedlings were 43.28% higher and had a root collar diameter 12.42% thicker, 28.14% more leaves, and 67.84% more leaf area. Total dry weights were up to 27.66% higher, leaves dry weight 89.80% higher, and shoot dry weight 48.28% higher. They presented 90.77% higher gs, 51.73% higher total chlorophyll content, 39.97% higher chlorophyll a, and 80.87% higher chlorophyll b. Bacillus strains alone or in combinations showed the best results, making them excellent candidates for developing an organic eco-friendly biofertilizing product for yerba mate seedlings in the greenhouse.

Ectomycorrhizal Fungi Modulate Biochemical Response against Powdery Mildew Disease in Quercus robur L.

In light of climate change, pedunculate oak (Q. robur L.) was marked as the most threatened European tree species. Pedunculate oak is particularly jeopardized by powdery mildew disease caused by Erysiphe alphitoides. We hypothesized that priming of this tree species with ectomycorrhizal fungi could mitigate biotic stress and produce bioprotective properties against the disease. In this study, we have compared oaks’ foliar physiological and biochemical responses upon infection with E. alphitoides in the presence and absence of ectomycorrhizal fungi (ECM). The main aim of this study was to inspect how ECM modulate an oak’s biochemical response to infection with E. alphitoides, particularly at the level of the accumulation of the main polyamines (putrescine, spermidine, and spermine), soluble osmolytes (proline and glycine betaine), and phenolics (total phenolic content, flavonoids, and condensed tannins). A polyamine quantification was performed after derivatization by using high-performance liquid chromatography (HLPC) coupled with fluorescent detection. Oak seedlings inoculated with ECM fungi exhibited significantly higher levels of putrescine, spermine, and proline compared to non-inoculated seedlings, indicating the priming properties of the ECM. E. alphitoides caused an increase in individual and total polyamine content and lipid peroxidation in oak leaves regardless of the effect of ECM, while causing a decrease in physiological and antioxidative parameters and water use efficiency (WUE). Common biochemical parameters may contribute to understanding the underpinning plant defense mechanisms in three-way interactions among plants and pathogenic and ectomycorrhizal fungi and can be used as reliable adaptability descriptors in the context of climate change.