NOE Cross-peak Intensities Research Articles

Peptide Targeted by Human Antibodies Associated with HIV Vaccine-Associated Protection Assumes a Dynamic α-Helical Structure.

The only evidence of vaccine-induced protection from HIV acquisition in humans was obtained in the RV144 HIV vaccine clinical trial. One immune correlate of risk in RV144 was observed to be higher titers of vaccine-induced antibodies (Abs) reacting with a 23-mer non-glycosylated peptide with the same amino acid sequence as a segment in the second variable (V2) loop of the MN strain of HIV. We used NMR to analyze the dynamic 3D structure of this peptide. Distance restraints between spatially proximate inter-residue protons were calculated from NOE cross peak intensities and used to constrain a thorough search of all possible conformations of the peptide. α–helical folding was strongly preferred by part of the peptide. A high-throughput structure prediction of this segment in all circulating HIV strains demonstrated that α–helical conformations are preferred by this segment almost universally across all subtypes. Notably, α–helical conformations of this segment of the V2 loop cluster cross-subtype-conserved amino acids on one face of the helix and the variable amino acid positions on the other in a semblance of an amphipathic α–helix. Accordingly, some Abs that protected against HIV in RV144 may have targeted a specific, conserved α–helical peptide epitope in the V2 loop of HIV’s surface envelope glycoprotein.

The Membrane-binding Motif of the Chloroplast Signal Recognition Particle Receptor (cpFtsY) Regulates GTPase Activity

The chloroplast signal recognition particle (cpSRP) and its receptor (cpFtsY) function in thylakoid biogenesis to target integral membrane proteins to thylakoids. Unlike cytosolic SRP receptors in eukaryotes, cpFtsY partitions between thylakoid membranes and the soluble stroma. Based on sequence alignments, a membrane-binding motif identified in Escherichia coli FtsY appears to be conserved in cpFtsY, yet whether the proposed motif is responsible for the membrane-binding function of cpFtsY has yet to be shown experimentally. Our studies show that a small N-terminal region in cpFtsY stabilizes a membrane interaction critical to cpFtsY function in cpSRP-dependent protein targeting. This membrane-binding motif is both necessary and sufficient to direct cpFtsY and fused passenger proteins to thylakoids. Our results demonstrate that the cpFtsY membrane-binding motif may be functionally replaced by the corresponding region from E. coli, confirming that the membrane-binding motif is conserved among organellar and prokaryotic homologs. Furthermore, the capacity of cpFtsY for lipid binding correlates with liposome-induced GTP hydrolysis stimulation. Mutations that debilitate the membrane-binding motif in cpFtsY result in higher rates of GTP hydrolysis, suggesting that negative regulation is provided by the intact membrane-binding region in the absence of a bilayer. Furthermore, NMR and CD structural studies of the N-terminal region and the analogous region in the E. coli SRP receptor revealed a conformational change in secondary structure that takes place upon lipid binding. These studies suggest that the cpFtsY membrane-binding motif plays a critical role in the intramolecular communication that regulates cpSRP receptor functions at the membrane.

The Structure of a Two-Disulfide Intermediate Assists in Elucidating the Oxidative Folding Pathway of a Cyclic Cystine Knot Protein

We have determined the three-dimensional structure of a two-disulfide intermediate (Cys(8)-Cys(20), Cys(14)-Cys(26)) on the oxidative folding pathway of the cyclotide MCoTI-II. Cyclotides have a range of bioactivities and, because of their exceptional stability, have been proposed as potential molecular scaffolds for drug design applications. The three-dimensional structure of the stable two-disulfide intermediate shows for the most part identical secondary and tertiary structure to the native state. The only exception is a flexible loop, which is collapsed onto the protein core in the native state, whereas in the intermediate it is more loosely associated with the remainder of the protein. The results suggest that the native fold of the peptide does not represent the free energy minimum in the absence of the Cys(1)-Cys(18) disulfide bridge and that although there is not a large energy barrier, the peptide must transiently adopt an energetically unfavorable state before the final disulfide can form.

NMR structure of the viral peptide linked to the genome (VPg) of poliovirus

VPgs are essential for replication of picornaviruses, which cause diseases such as poliomyelitis, foot and mouth disease, and the common cold. VPg in infected cells is covalently linked to the 5′ end of the viral RNA, or, in a uridylylated form, free in the cytoplasm. We show here the first solution structure for a picornaviral VPg, that of the 22-residue peptide from poliovirus serotype 1. VPg in buffer is inherently flexible, but a single conformer was obtained by adding trimethylamine N-oxide (TMAO). TMAO had only minor effects on the TOCSY spectrum. However, it increased the amount of structured peptide, as indicated by more peaks in the NOESY spectrum and an up to 300% increase in the ratio of normalized NOE cross peak intensities to that in buffer. The data for VPg in TMAO yielded a well defined structure bundle with 0.6 Å RMSD (versus 6.6 Å in buffer alone), with 10–30 unambiguous constraints per residue. The structure consists of a large loop region from residues 1 to 14, from which the reactive tyrosinate projects outward, and a C-terminal helix from residues 18 to 21 that aligns the sidechains of conserved residues on one face. The structure has a stable docking position at an area on the poliovirus polymerase crystal structure identified as a VPg binding site by mutagenesis studies. Further, UTP and ATP dock in a base-specific manner to the reactive face of VPg, held in place by residues conserved in all picornavirus VPgs.

Structure and stability of the consecutive stereoregulated chiral phosphorothioate DNA duplex.

The duplex structures of the stereoregulated phosphorothioate DNAs, [R(p),R(p)]- and [S(p),S(p)]-[d(GC(ps)T(ps)ACG)] (ps, phosphorothioate; PS-DNA), with their complementary RNA have been investigated by combined use of (1)H NMR and restrained molecular dynamics calculation. Compared to those obtained for the unmodified duplex structures (PO-DNA.RNA), the NOE cross-peak intensities are virtually identical for the PS-DNA.RNA hybrid duplexes. The structural analysis on the basis of the NOE restraints reveals that all of the three DNA.RNA duplexes take a A-form conformation and that there is no significant difference in the base stacking for the DNA.RNA hybrid duplexes. On the other hand, the NOE cross-peak intensities of the protons around the central T(ps)A step of the PS-DNA.DNA duplexes are apparently different from those of PO-DNA. DNA. The chemical shifts of H8/6 and H1' at the T(ps)A step are also largely different among PS-DNA.DNAs and PO-DNA.DNA, suggesting that the DNA.DNA structure is readily changed by the introduction of the phosphorothioate groups to the central T(p)A step. The structure calculations indicate that all of these DNA.DNA duplexes are B-form although there exist some small differences in helical parameters between the [R(p),R(p)]- and [S(p),S(p)]PS-DNA.DNA duplexes. The melting temperatures (T(m)) were determined for all of the duplexes by plotting the chemical shift change of isolated peaks as a function of temperature. For the PS-DNA.RNA hybrid duplexes, the [S(p),S(p)] isomer is less stable than the [R(p),R(p)] isomer while this trend is reversed for the PS-DNA.DNA duplexes. Consequently, although the PS-DNA.RNA duplexes take the similar A-form structure, the duplex stability is different between PS-DNA.RNA duplexes. The stability of the DNA.RNA duplexes may not be governed by the A-form structure itself but by some other factors such as the hydration around the phosphorothioate backbone, although the T(m) difference of the DNA.DNA duplexes could be explained by the structural factor.

Structural effect of complete [Rp]-phosphorothioate and phosphorodithioate substitutions in the DNA strand of a model antisense inhibitor-target RNA complex

Chemically modified DNA oligonucleotides have been crucial to the success of antisense therapeutics. Although such modifications are ubiquitous in the clinic, high-resolution structural studies of pharmaceutically relevant derivatives have been limited to only a few molecules. We have completed a high-resolution NMR structural study of three DNA·RNA hybrids with the sequence d(CCTATAATCC)·r(GGAUUAUAGG). All hybrids contain an unmodified RNA strand, whereas the DNA strand of each hybrid contains one of three different sugar-phosphate backbone linkages at each nucleotide: (1) phosphate, (2) [Rp]-phosphorothioate, or (3) phosphorodithioate. The UV and NMR melting profiles revealed that the normal hybrid is more stable than the [Rp]-phosphorothioate, which in turn is more stable than the phosphorodithioate. Homonuclear two-dimensional nuclear Overhauser effect spectroscopy and double quantum-filtered correlation spectroscopy afforded nearly complete non-labile proton assignments. The three molecules show nearly equivalent chemical shifts, with the exception of H3′ protons, which are shifted downfield in a manner that appears correlated with the degree of sulfur substitution at phosphate. All three hybrids exhibit unusually broad linewidths for deoxyribose protons H2′ and H2″.Distance restraints were calculated from NOE cross-peak intensities via a complete relaxation matrix approach using the program RANDMARDI. Detailed comparison of interproton distances from each hybrid indicates that the three molecules share a common structure, with neither strand in canonical A or B form. Correlation of R factors, calculated using the program CORMA with DNA H2′-base and H3′-base distances, revealed a relative increase in the population of B-type sugar conformations for deoxyriboses in the A+T-rich center of the hybrid sequence. It is widely known that the activity of enzymes which act upon DNA·RNA hybrid substrates (e.g. ribonuclease H) is impacted when the hybrids contain phosphorothioate or phosphorodithioate substitutions. The structural similarity of the three hybrids examined here suggests that factors other than global structure may mediate the activity of these enzymes.

Overlapping Ensemble Dynamics: A Method for Structure Calculations of Multiple Configurational Isomers

A computational approach to utilize the overlapping NOE cross-peak intensities of multiple configurational isomers (e.g., cis/trans isomerization about substituted amide bonds in peptides or proteins) is illustrated. The method, overlap ensemble dynamics, utilizes an ensemble containing the appropriate ratio of the configurational isomers. The NOE intensities, containing contributions from different isomers, are then used as a constraining function to the entire ensemble. In this manner, NOE cross-peaks which before had to be ignored can now be readily used in the computation-based structural refinement. This method should find widespread use given the large number of small molecules of pharmaceutical and medicinal interest with substituted amides and multiple configurational isomers in their NMR spectra.

Conformational Studies by1H NMR of the HIV Enhancer: the Transcription Factors NF-κB and Sp1 Binding Domains

The solution structures of two DNA non-palindromic duplexes of 24 base pairs and corresponding to the 3′ NF-κB-binding site and the adjacent 5′ Sp1-binding site of the HIV-1 long terminal repeat (5′LTR) were analyzed by proton two-dimensional nuclear magnetic resonance spectroscopy. The first sequence d(GGGGACTTTCCAGGGAGGCGTGGC):d(GCCACGCCTCCCTGGAAAGTCCCC) corresponds to the wild-type LTR duplex (24mer-N), and the second sequence d(GCTCACTTTCCAGGGAGGCGTGGC): d(GCCACGCCTCCCTGGAAAGTGAGC) (24mer-M) contains a specific mutation (lightface letters) abolishing NF-κB binding. Assignment of protons essential for structure determination were obtained and structural features of both duplexes were analyzed. The overall structure of the duplex is of the B form but several significant local structural deviations were found. First, from analysis of NOE cross-peak intensities between adenine H2 base protons and sugar H1′ protons, it was found that the CTC mutation results in widening of the minor groove with presumably narrowing of the major groove, thus impairing the binding of NF-κB to its responsive element in the HIV LTR. Second from chemical shift analysis of H1′ sugar protons, some unusual structural features were found at the junction between the homopurine:homopyrimidine stretches, that is, at the junction of the NF-κB and Sp1 sites, consistent with the known synergism between NF-κB and Sp1 functions in the HIV LTR. The scopes and limitations of DNA fragment studies of such a size are discussed.

Nuclear magnetic resonance assignments and global fold of a CheY-binding domain in CheA, the chemotaxis-specific kinase of Escherichia coli.

CheA is the histidine autokinase in the Escherichia coli chemotaxis signal transduction pathway responsible for coupling of signals received by transmembrane receptors to the response regulators CheY and CheB. Here NMR spectroscopy is used to study a 14 kDa fragment of CheA, residues 124-257, that binds the response regulator CheY. Backbone atom resonance assignments were obtained by analysis of 3D HNCACB, 3D CBCA(CO)NH, and HNCO spectra, whereas side-chain assignments were obtained primarily by analysis of 3D H(CCO)NH, 3D C(CO)NH, 3D HCCH-TOCSY, and 3D 1H, 15N TOCSY-HSMQC spectra. NOE cross peak patterns and intensities as well as torsion angle restraints were used to determine the secondary structure, and a low-resolution structure was calculated by hybrid distance-geometry simulated annealing methods. The CheA124-257 fragment consists of four antiparallel beta strands and two helices, arranged in an "open-faced beta-sandwich" motif, as well as two unstructured ends that correspond to domain linkers in the full-length protein. The 15N-1H correlation spectrum of 15N-labeled CheA124-257 bound to unlabeled CheY shows specific localized changes that may correspond to a CheY-binding face on CheA.

Localized solution structure refinement of an F45W variant of ubiquitin using stochastic boundary molecular dynamics and NMR distance restraints.

The local structure within an 8-A radius around residue 45 of a recombinant F45W variant of human ubiquitin has been determined using 67 interproton distance restraints measured by two-dimensional proton NMR. Proton chemical shift evidence indicates that structural perturbations due to the F45W mutation are minimal and limited to the immediate vicinity of the site of mutation. Simulated annealing implemented with stochastic boundary molecular dynamics was applied to refine the structure of Trp 45 and 10 neighboring residues. The stochastic boundary method allowed the entire protein to be reassembled from the refined coordinates and the outlying unrefined coordinates with little distortion at the boundary. Refinement began with four low-energy indole ring orientations of F45W-substituted wild-type (WT) ubiquitin crystal coordinates. Distance restraints were derived from mostly long-range NOE cross peaks with 51 restraints involving the Trp 45 indole ring. Tandem refinements of 64 structures were done using either (1) upper and lower bounds derived from qualitative inspection of NOE crosspeak intensities or (2) quantitative analysis of cross-peak heights using the program MARDIGRAS. Though similar to those based on qualitative restraint, structures obtained using quantitative NOE analysis were superior in terms of precision and accuracy as measured by back-calculated sixth-root R factors. The six-membered portion of the indole ring is nearly coincident with the phenyl ring of the WT and the indole NH is exposed to solvent. Accommodation of the larger ring is accompanied by small perturbations in the backbone and a 120 degrees rotation of the chi 2 dihedral angle of Leu 50.

Three‐Dimensional Structure in Solution of a Wheat Lipid‐Transfer Protein from Multidimensional 1H‐NMR Data

Two-dimensional and three-dimensional 1H-NMR experimental data [Simorre, J. P., Caille, A., Marion, D., Marion, D. & Ptak, M. (1991) Biochemistry 30, 11600-11608] were used to build models of the three-dimensional structure of a non-specific wheat lipid-transfer protein (LTP) by using distance geometry, simulated annealing, energy minimization and molecular dynamics techniques. A first set of 881 distance constraints derived from NOE cross-peak intensities was used to generate 74 initial structures. One family of topological mirror images of the protein structure was eliminated by considering helical secondary-structure organization and steric requirements. Back calculations of NOE intensities led us to introduce 535 additional distance constraints. Finally, 21 structures were selected as representative of the structure of the protein. The polypeptide backbone folds into a simple and original right-handed winding. It is composed of a bundle of four helices linked by flexible loops, which is packed against a C-terminal fragment forming a non-standard saxophone-like shape. The folded protein is stabilized by hydrophobic interactions and the four disulfide bridges combined by pairs on each side of the protein. An hydrophobic cleft, formed by residues located in the second half of the protein could be a potential site for the binding of lipids.

Formation of multiple complexes between actinomycin D and a DNA hairpin: structural characterization by multinuclear NMR.

The solution conformations of a DNA oligomer and its complexes with the anticancer drug actinomycin D (ActD) were characterized using homo- and heteronuclear NMR techniques. Previous high-resolution NMR investigations of ActD-DNA complexes employed symmetric double-stranded DNA oligomers, yielding two identical symmetry-related complexes. In order to understand the important effects that neighboring base pairs and/or unusual nucleic acid structures may have on ActD binding specificity and orientation, we chose to study the oligonucleotide d(TCGCGTTTTCGCGA), which adopts a hairpin structure in solution. NOE cross-peak intensities were used to generate distance constraints for molecular dynamics simulations and structure determinations of the free oligonucleotide and for both complexes. A total of 86 intermolecular NOEs were identified for each complex, 27 of which involve exchangeable protons. These intermolecular NOEs along with changes in the phosphorus chemical shifts were used to determine the drug binding site on the DNA. As expected, ActD intercalated exclusively at the single d(GC) step in the DNA hairpin. Interestingly, although the two complexes, which differ by the orientation with which the asymmetric drug chromophore intercalates the DNA, were not formed in equal concentrations, their conformations are very similar. The RMS difference of the DNA hairpin in the two complexes is only 1.10 A. The structures of the minor groove binding pentapeptide rings are not affected by any of the changes in the normal double-helical structure imposed by the hairpin loop. The total pairwise RMS difference over all atoms for the four peptides (two per complex) in the calculated structures is 0.72 A. Conversely, the structure of the hairpin loop is not appreciably changed upon binding--the RMS difference between the free DNA loop region and the loop region in the two complexes is 1.68 A and only 0.43 A between the two complexes. Our data also support a possible conformation of the d(T)4 loop that does not possess a thymine-thymine "wobble" base pair.

Solution structure of the parallel-stranded hairpin d(T8C4A8) as determined by two-dimensional NMR.

The structure of the oligodeoxynucleotide (3')T8(5')-(5')C4A8(3') hairpin in aqueous solution was studied by two-dimensional (2D) proton and phosphorus nuclear magnetic resonance (NMR) spectroscopy. At 2.5 mM and 10 degrees C, the molecule exists predominantly as a monomolecular hairpin with a C4 loop. At higher concentrations and lower temperatures, NMR signals from multimers are obvious. They account for approximately 25% of the total population at 4 mM and 10 degrees C. Nearly all of the proton NMR signals for the hairpin could be assigned using 2D COSY, HOHAHA, and NOESY experiments. 2D 1H-31P correlation experiments were used to assign all the phosphorus resonances and to provide an additional check for the sequential assignments. A parallel-stranded T8.A8 stem can be formed in the hairpin due to the presence of the unusual 5'-5' linkage in the loop. 2D NOESY experiments indicate that the A H2 and its 5'-end neighbor base pair T methyl protons are within 5 A of each other. This is in accord with reverse Watson-Crick base pairing between T and A, which locates the A H2 and the T methyl protons in the same groove of the duplex. The chemical shifts of A H1', H2', and H2" sugar and the H2 base protons are quite different compared to normal B-DNA. Analysis of the 2D COSY and NOESY cross peak patterns indicates that the deoxyribose rings are mainly in the C2'-endo conformation and that the stem forms a right-handed helix, with the two strands held together by eight reverse Watson-Crick A.T base pairs to form a parallel-stranded duplex. The backbone torsion angles, as determined from the 31P chemical shifts, are slightly different for the A and the T residues. A molecular model was constructed, using a total of 336 proton NOE cross peak intensities as proton-proton distance constraints. In the refined structure, the conformations of the sugar-phosphate linkage, the deoxyribose rings, and the glycosyl bonds for the two parallel strands of the hairpin are close to a regular B-DNA structure. The base-stacking and the hydrogen-bonding interactions are well optimized; however, the two grooves are of approximately equal width. Thus, compared to B-DNA, the parallel-stranded duplex has a very different surface shape, and because of the reverse Watson-Crick base pairing, it has different groups exposed in each groove.

A potential gene target in HIV-1: rationale, selection of a conserved sequence, and determination of NMR distance and torsion angle constraints.

Recently, the capability for determining the high-resolution, sequence-dependent structure of oligonucleotides in solution via careful analysis of multidimensional NMR spectra and structure refinement procedures has been developed. Consequently, the rationale for selection of a genome sequence as a target for drug design based on the detailed three-dimensional structure of the target is presented. The concept is illustrated by the successful search for a highly conserved region of the HIV-1 genome's long terminal repeat which could serve as a molecular target. A compound which could selectively bind the target sequence could inhibit both RNA transcription from the integrated provirus and the reverse transcription process. Of 148 unique HIV-1 sequences examined, 147 exhibit a 21-base conserved sequence (nucleotides 70-90 in HIVHXB2R) in the R region of the long terminal repeat. The only exception, a minor constituent for one individual, has a change in the penultimate base. A 13 base pair duplex sequence, [d(AGCTTGCCTTGAG).d(CTCAAGGCAAGCT)], from this conserved region was selected and synthesized for NMR structure studies. Phase-sensitive proton two-dimensional nuclear Overhauser enhancement (2D NOE) and double-quantum-filtered correlation (2QF-COSY) spectra were obtained at 500 MHz for the DNA duplex. Exchangeable and nonexchangeable proton resonances were assigned. Quantitative assessments of the 2D NOE cross-peak intensities for different mixing times were carried out using conventional Fourier transform NMR and the maximum likelihood method (MLM). Distance constraints, along with upper and lower bounds, were obtained from the 2D NOE intensities using the iterative complete relaxation matrix algorithm MARDIGRAS. Distances entailing both exchangeable and nonexchangeable protons were determined: 7-11 experimental distance constraints per residue including interresidue and interstrand distances. Simulations of the scalar coupling effects manifest in 2QF-COSY cross-peaks by means of the program SPHINX/LINSHA were compared with experimental data to yield torsion angle constraints for the sugar rings. A single conformer was inadequate to describe any of the sugar puckers, but a rapid two-state equilibrium with one conformer strongly dominant (75-95%) provided a good fit of the 2QF-COSY cross-peaks. The sugar pucker of the major conformer exhibited significant variability for the various nucleotides but was roughly 2'-endo. Though derived independently and subject to different time-averaging effects, the 2QF-COSY and 2D NOE results are in accord.

Determination of the three-dimensional solution structure of ragweed allergen Amb t V by nuclear magnetic resonance spectroscopy.

Analysis of two-dimensional NMR experiments has afforded essentially complete assignment of all proton resonances in the allergenic protein Amb t V. Conformational constraints were obtained from the NMR data in three forms: interproton distances derived from NOE cross-peak intensities of NOESY spectra, torsion angle constraints derived from J-coupling constants of COSY and PE-COSY spectra, and hydrogen bond constraints derived from hydrogen-exchange experiments. Conformations of Amb t V with low constraint violations were generated using dynamic simulated annealing in the program XPLOR. The refined structures are comprised of a C-terminal alpha-helix, a short stretch of triple-stranded antiparallel beta-sheet, and several loops. In addition, the cystine partners of the four disulfide linkages (for which there are no biochemical data) have been assigned. The refined structures of Amb t V will allow us to suggest surface substructures for the Amb V allergens that are likely to participate in B cell epitopes and will assist us in defining the Ia/T cell epitopes that interact with the MHC class II (or Ia) molecule and the T cell receptor leading to the induction of the immune response to Amb t V.

Structure determination of [d(ATATATAUAT)]2 via two‐dimensional NOE spectroscopy and molecular dynamics calculations

Proton homonuclear two-dimensional (2D) NOE spectra were obtained for the decamer [d(ATATATAUAT)]2 as a function of mixing time, and proton resonance assignments were made. Quantitative assessment of the 2D NOE cross-peak intensities was used in conjunction with the program MARDIGRAS, which entails a complete relaxation matrix analysis of the 2D NOE peak intensities, to obtain a set of upper and lower bound interproton distance constraints. The analysis with MARDIGRAS was carried out using three initial models: A-DNA, B-DNA and Z-DNA. The distance constraints determined were essentially the same regardless of initial structure. These experimental structural constraints were used with restrained molecular dynamics calculations to determine the solution structure of the decamer. The molecular dynamics program AMBER was run using A-DNA or B-DNA as starting model. The root-mean-square (rms) difference between these two starting models is 0.504 nm. The two starting models were subjected to 22.5 ps of restrained molecular dynamics calculations. The coordinates of the last 10.5 ps of the molecular dynamics runs were averaged to give two final structures. MDA and MDB. The rms difference between these two structures is 0.09 nm, implying convergence of the two molecular dynamics runs. The 2D NOE spectral intensities calculated for the derived structures are in good agreement with experimental spectra, based on sixth-root residual index analysis of intensities. A detailed examination of the structural features suggests that while the decamer is in the B-family of DNA structures, many torsion angle and helical parameters alternate from purine to pyrimidine, with kinks occurring at the U-A steps.

Multinuclear NMR investigation of zinc(2+) binding to a dodecamer oligodeoxyribonucleotide: insights from carbon-13 NMR spectroscopy

The IH and I3C NMR spectra of the self-complementary dodecamer d(AIT2G,G~G5T6A,CsC9CIOAIIT12)2 were assigned. The dodecamer chemical shifts and NOE effects suggest a normal B-form duplex at 12 OC. However, weak NOE cross peaks from the AH2 signal to the HI' signal of the 3' nucleotide were observed. These weak cross peaks are consistent with some minor sliding in of the propeller-twisted base pairs, particularly at the center of the duplex. At lower concentrations or at higher temperature, a second form of the oligonucelotide was evident. This concentration dependence, the downfield chemical shifts of some 'H resonances, and the observation of an imino signal at 11 ppm strongly imply that this minor form is a hairpin. Addition of Zn2+ greatly disfavored this hairpin form. At lower oligonucleotide concentration, Zn2+ was twice as effective as Mg2+ in favoring the duplex form. The imino 'H spectra established that GC base pairing is not disrupted in the duplex form, even at high levels of added Zn2+. At higher oligonucleotide concentration, when the duplex was converted to the random coil form by temperature elevation, no hairpin form was detected in the presence of Zn2+, whereas such a form was clearly present, particularly at 42 OC, in the absence of Zn2+. At low temperature, when Zn2+ was added, the H8 signals at G4 and, to a lesser extent, G, shifted downfield with little effect on the G5H8 or any AH8 signals. This result suggests a preferential binding to N7 of G4. This conclusion was strongly supported by downfield shifts of the G, and G , C8 signals and the absence of appreciable changes in the C8 signals of other purines. In addition, the C5 signals of G4 and G , shifted upfield and the C4 signals broadened. These characteristic changes strongly support coordination to N7 for these two G residues. However, no significant changes in NOE cross-peak intensities, the C3' I3C signals, or the ,lP NMR signals were observed. Therefore, it is clear that GN7-MCrN7 cross-linked or GMG sandwich species are not formed, since the strain in the sugar-phosphate backbone that would be produced by such species would have led to appreciable changes in chemical shift and NOE cross-peak intensity. The selectivity pattern (G, > G 3 > G5, A) is consistent with the expected molecular electrostatic potential on the basis of literature calculations. Thus, although the study of spectroscopically silent labile metal ions such as ZnZ+ is difficult, a multinuclear NMR investigation of the target biomolecule can be quite revealing.

Significant conformational changes in an antigenic carbohydrate epitope upon binding to a monoclonal antibody

Transferred nuclear Overhauser enhancement spectroscopy (TRNOE) was used to observe changes in a ligand's conformation upon binding to its specific antibody. The ligands studied were methyl O-beta-D-galactopyranosyl(1----6)-4-deoxy-4-fluoro-beta-D-galactopyra nos ide (me4FGal2) and its selectively deuteriated analogue, methyl O-beta-D-galactopyranosyl(1----6)-4-deoxy-2-deuterio-4-fluoro-beta -D- galactopyranoside (me4F2dGal2). The monoclonal antibody was mouse IgA X24. The solution conformation of the free ligand me4F2dGal2 was inferred from measurements of vicinal 1H-1H coupling constants, long-range 1H-13C coupling constants, and NOE cross-peak intensities. For free ligand, both galactosyl residues adopt a regular chair conformation, but the NMR spectra are incompatible with a single unique conformation of the glycosidic linkage. Analysis of 1H-1H and 1H-13C constants indicates that the major conformer has an extended conformation: phi = -120 degrees; psi = 180 degrees; and omega = 75 degrees. TRNOE measurements on me4FGal2 and me4F2dGal2 in the presence of the specific antibody indicate that the pyranose ring pucker of each galactose ring remains unchanged, but rotations about the glycosidic linkage occur upon binding to X24. Computer calculations indicate that there are two sets of torsion angles that satisfy the observed NMR constraints, namely, phi = -152 +/- 9 degrees; psi = -128 +/- 7 degrees; and omega = -158 +/- 6 degrees; and a conformer with phi = -53 +/- 6 degrees; psi = 154 +/- 10 degrees; and omega = -173 +/- 6 degrees. Neither conformation is similar to any of the observed conformations of the free disaccharide.(ABSTRACT TRUNCATED AT 250 WORDS)

A theoretical study of distance determinations from NMR. Two-dimensional nuclear overhauser effect spectra

In principle, two-dimensional nuclear Overhauser effect NMR experiments can be used to establish internuclear distances and thus to determine molecular structure in solution. Theoretical calculations have been carried out for the 2D NOE experiment addressing the questions of (l) how sensitive 2D NOE cross-peak intensities are to spatial location of nuclear spins, and (2) how well the motional characteristics (and, therefore, spectral densities) of the molecule must be known in order to determine accurate distances. Theoretical values for cross-peak intensities obtained in 2D NOE spectra were calculated for a set of three-proton spins and a set of four-proton spins. The relaxation rate matrix whose elements establish the cross-peak intensities was diagonalized using a numerical procedure which enables accurate calculations of cross-peak intensities in large spin systems at any mixing time. Several calculations were performed; each calculation entailed a different set of circumstances. Specifically, the transformation of cross-peak intensities into proton-proton distances was examined for 21 configurations of the three-proton system and 7 configurations of the four-proton spin system. Additionally the influence of specific types of overall and internal motion on the calculated cross-peak intensities and the distances determined from them was tested. The conclusions from these calculations are as follows. With the experimental signal-to-noise ratio usually attained for biomolecular concentrations < 10 m M, interproton distances up to 5 Å should lead to detectable cross-peaks in the 2D NOE spectrum with mixing times within a few hundred milliseconds. Recording cross-peak intensities at several mixing times is important for obtaining accurate distances from them. Simple motional models assuming only a single isotropic motion with an effective correlation time may be used to obtain the spectral densities needed to calculate cross-peak intensities even though the actual motional dynamics of the molecule may be more complicated. Using the simplified models introduces approximately 10% error in the distance determination. Finally, it is shown how the cross-peak between a proton and each of its neighbors may increase the accuracy of the determination and help in locating the position of the proton. Our calculations indicate that distances with an accuracy of ±0.5 Å should be attainable with knowledge of the overall molecular reorientation rate or individual proton relaxation times.