Mutations In Splicing Factor Genes Research Articles

Alternative Splicing: A Potential Therapeutic Target in Hematological Malignancies

Leukemia represents the most prevalent malignancy in children, constituting 30% of childhood cancer cases, with acute lymphoblastic leukemia (ALL) being particularly heterogeneous. This paper explores the role of alternative splicing in leukemia, highlighting its significance in cancer development and progression. Aberrant splicing is often driven by mutations in splicing-factor genes, which can lead to the production of variant proteins that contribute to oncogenesis. The spliceosome, a complex of small nuclear RNAs and proteins, facilitates RNA splicing, a process critical for generating diverse mRNA and protein products from single genes. Mutations in splicing factors, such as U2AF1, SF3B1, SRSF2, ZRSR2, and HNRNPH1, are frequently observed across various hematological malignancies and are associated with poor prognosis and treatment resistance. This research underscores the necessity of understanding the mechanisms of RNA splicing dysregulation in order to develop targeted therapies to correct these aberrant processes, thereby improving outcomes for patients with leukemia and related disorders.

Mutations in the RNA Splicing Factors U2AF1 and SRSF2 are Context-Dependent in Myeloproliferative Neoplasms

RNA splicing factor gene mutations are recurrently found in BCR::ABL1 negative myeloproliferative neoplasms (MPN). To understand the interactions between spliceosome gene mutations and MPN phenotypic driver mutations ( JAK2, CALR and MPL), we investigated their patterns of co-occurrence or mutual exclusivity in a cohort of 990 MPN patients with comprehensive molecular profiling and clinical information from the Hematologic Malignancies Data Repository (HMDR). As expected, MPN driver mutations ( JAK2, CALR and MPL) were mutually exclusive (N=658, N=168, N=53 respectively, Log2 OR≤-3.5 and Padj. ≤0.005 using pairwise Fisher's exact tests with Benjamin Hochberg multiple testing correction). Additionally, cases with co-occurring mutations in two RNA splicing factors, SF3B1, U2AF1 and SRSF2 (N=44, N=49, N=44) respectively were uncommon (2/135 splicing factor mutated cases) . We further found that U2AF1 and SRSF2 mutations co-occurred with JAK2 (log2 OR=1.7, Padj.=0.009) and MPL (log2 OR=2.1, Padj.=0.006) respectively, but rarely with CALR mutations (N=2 CALR-U2AF1 log2 OR=-2.3 Padj.=0.025, N=2 CALR-SRSF2 log2 OR=-2.2 Padj.=0.048). In contrast, CALR-SF3B1 mutations occurred at the expected frequency (Padj.=0.11). To explore the molecular settings where these mutations co-occur, we investigated the variant allele frequencies (VAFs) of CALR, U2AF1, SRSF2 and concomitant mutations in the CALR-U2AF1 (N=2) and CALR-SRSF2 (N=2) patients. The VAFs for the mutations detected in the first patient with CALR-U2AF1 co-mutation were: CALR 0.26, U2AF1 0.45, and TET2 0.41. Since CALR and splicing factor mutations are typically heterozygous, this suggests the CALR mutation was sub-clonal to the U2AF1 mutation and that U2AF1 and TET2 mutations were likely present in the same cell. In the second CALR-U2AF1 co-mutant case, VAFs were: CALR 0.31, U2AF1 0.27, and TP53 0.16. It is possible that in this case, the CALR and U2AF1 mutations may have occurred in independent clones or may have occurred in the same cell in the absence of other pathogenic mutations. For the two CALR-SRSF2 patients, data from three samples revealed VAFs of 0.23-0.46 for CALR and 0.21-0.58 for SRSF2 mutations. Considering their typical heterozygous occurrence, we inferred those individual cells harbored both CALR and SRSF2 mutations. Notably, in samples with high VAFs (>0.37) for both CALR and SRSF2 in two separate patients, additional high VAF pathogenic mutations were observed: 0.35 for ASXL1 and 0.46 for RUNX1 respectively. As ASXL1 and RUNX1 mutations also typically occur in a heterozygous manner, we hypothesized that when CALR and SRSF2 mutations are present in the same cell, another pathogenic co-mutation may be required for survival of the clone. To test our hypothesis, we FACS-sorted single lineage negative CD34 positive bone marrow cells from the first CALR- SRSF2 co-mutant case into 96 wells plates containing methylcellulose and hematopoietic growth factors (CFU-GEMM). DNA was harvested from single-cell colonies and genotyped for the following mutations using polymerase chain reaction (PCR) followed by gel electrophoresis and Sanger sequencing: CALR c.1154_1155insTTGTC p.K385fs*, SRSF2 c.284G>T p.P95H, ASXL1 c.1926_1927insG p.G642fs*, EZH2 c.2188_2212delAAAAAACAGCTCTTCGCCAGTCTGG p.F729fs*. Bulk NGS VAFs were 0.46, 0.38, 0.35, and 0.17, respectively. Out of 73 colonies analyzed, 71 colonies had the CALR insertion 5 mutation detected (see figure). Among these 71 CALR-mutated colonies, SRSF2 was found to co-occur in 35 colonies. Interestingly, all 35 colonies were accompanied by an ASXL1 mutation, and 29 of them had an additional EZH2 mutation. These findings support our hypothesis that CALR and SRSF2 mutations may co-occur in the same cell in the presence of another pathogenic mutation. Our findings offer molecular insights into the context-dependent behavior of splicing factor mutations in MPN. While they can co-occur with JAK2 and MPL mutations, U2AF1 and SRSF2 mutations are largely mutually exclusive with CALR mutations. In addition, our findings generate two main biological hypotheses: (i) a synthetic lethal relationship may exist between CALR mutations and SRSF2 or U2AF1 mutations, and (ii) this synthetic lethality may be overcome by the presence of additional pathogenic mutation(s) in the cell. Validation studies are ongoing to address these hypotheses. AM and AEM contributed equally.

Splicing Factor Gene Mutations in Patients With AML

Splicing Factor Gene Mutations in Patients With AML

E7820, an Anti-Cancer Sulfonamide, in Combination with Venetoclax in Patients with Splicing Factor Mutant Myeloid Malignancies: A Phase II Clinical Trial

*JPB and NSC contributed equally. Background and Significance: Mutations in RNA splicing factor genes ( SF3B1, SRSF2 U2AF1 and ZRSR2)are common in patients with acute myeloid leukemia (AML) and myelodysplastic syndromes (MDS). We and others have previously shown that pharmacologic degradation of the RNA splicing factor RBM39 preferentially kills splicing factor mutant cells. These preclinical data provided the rationale for a recently completed phase II clinical trial (NCT05024994) of the oral RBM39 degrader E7820 in patients with relapsed or refractory splicing factor mutant MDS or AML. The safety and efficacy data of this trial have been presented previously (Bewersdorf et al ASH 2022). The generally favorable safety profile and correlative studies confirming target engagement and induction of mis-splicing events support the further exploration of E7820 in the context of combination therapies. Recent clinical data show that treatment with venetoclax can overcome the negative prognostic impact of splicing factor mutations in AML (Senapati et al, Blood 2023). Additionally, preclinical data from our laboratory show synergy between E7820 and venetoclax in SF3B1-mutant isogenic cell lines leading to enhanced RBM39 degradation and blunting of MCL-1 expression, a common cause of venetoclax resistance ( Figure 1). Dynamic BH3 profiling of E7820 in myeloid leukemia cell lines suggests an E7820 dose-dependent priming for BAD which implies forced reliance on BCL2. Furthermore, adding venetoclax to E7820 further increased mitochondrial priming. Preclinical animal modeling with patient-derived xenografts (PDX) is ongoing. Based on these preclinical data, we are amending the study to include a separate arm of E7820 in combination with venetoclax. Methods and Study Design: This is an investigator-initiated, phase II trial (NCT05024994) that is being conducted at Memorial Sloan Kettering Cancer Center and Sylvester Comprehensive Cancer Center at the University of Miami of adult (≥18 years) patients with relapsed or refractory AML, MDS, or chronic myelomonocytic leukemia (CMML). Patients must have a hotspot splicing factor mutation in SF3B1, SRSF2, U2AF1 or U2AF2 (with hotspot mutations as defined by OncoKB) or a nonsense or frameshift mutation in ZRSR2 detected within 6 months of study screening for enrollment. Patients are required to have adequate end-organ function and an Eastern Cooperative Oncology Group (ECOG) performance status of ≤3. Prior treatment with venetoclax is permitted. Patients enrolled in the new combination arm will receive E7820 100mg by mouth once daily + venetoclax orally once daily on days 1-28 of cycle 1 on days 1-21 of subsequent cycles. The study design is shown in Figure 2. As this combination has never been studied in human AML and MDS patients previously, the study will include a 6-patient safety run-in phase with an optional dose de-escalation of E7820 to 70mg orally once daily. The sample size is based on a Minimax Simon 2-stage design. Assuming a type I error rate of 0.05, power of 0.8, a response rate of 10% in the historical control group and 30% with E7820 + venetoclax, 15 patients will be enrolled in stage 1. If there are at least 2 responses among the first 15 patients, we will enroll another 10 patients. The null hypothesis will be rejected if there are at least 6 responses in the 25 patients. The primary endpoint of this trial is to evaluate the efficacy of E7820 + venetoclax in patients with relapsed/refractory myeloid malignancies with mutations in splicing factor genes as measured by the response rate within 6 cycles of therapy (AML: complete remission (CR) + complete remission with partial hematologic recovery (CRh); MDS: CR + CRh + CR with limited hematologic recovery (CR-L) + partial remission (PR); CMML: CR + PR). Secondary endpoints include overall and event-free survival. Correlative biomarker and pharmacodynamic parameters will be assessed as exploratory endpoints including effects on RBM39 protein levels, changes in global and key target splicing events, and evaluation of DCAF15 mRNA levels and response to therapy.

Modification of the ELN Classification 2022 Refines Risk Assessment in MDS/AML Patients

Background: The International Consensus Classification (ICC) introduced MDS/AML as a novel myeloid disease entity defined by 10-19% blasts in the absence of AML-defining recurrent genetic abnormalities. MDS/AML patients should be eligible for AML-like treatment approaches in clinical trials. It has recently been shown that the AML-based risk classification according to European Leukemia Net (ELN) 2022 criteria fails in MDS/AML while an MDS-based risk classification according to Molecular International Prognostic Scoring System (IPSS-M) was applicable (Huber S et al. EHA 2023). Our aim was to refine the ELN 2022 criteria based on genome sequencing data to better reflect the outcome in this overlap category of MDS and AML. Methods: Non-therapy-related cases of 403 MDS/AML and 686 AML patients classified according to ICC were included. Bone marrow samples were analyzed by cytomorphology, cytogenetics and targeted NGS panel sequencing (median coverage 1500x). Overall survival (OS) was assessed in all AML patients and in a subcohort of 137 MDS/AML patients (median follow-ups: 5.6 and 10.2 years, respectively) in whom also whole genome sequencing (median coverage 100x) was performed. Results: MDS/AML patients had a median age of 74 years (female/male: 153/250). They were subclassified according to ICC as MDS/AML with mutated TP53 (14%), with myelodysplasia-related (MR) gene mutations (67%) or MR cytogenetic abnormalities (5%), or not otherwise specified (14%). Cytogenetic aberrations were detected in 173/403 (43%) cases including del(5q) (18%), -7/del(7q) (13%), and complex karyotypes (16%). Molecular aberrations were detected in 376/403 (93%) cases with a median number of 3 mutations. Most frequent gene mutations were ASXL1 (40%), TET2 (32%), SRSF2 (32%), and RUNX1 (29%); TP53 was mutated in (14%) (details in Figure 1A). Grouping of the MDS/AML cohort according to the ELN 2022 guidelines showed: no MDS/AML patient fulfilled criteria for the favorable ELN risk group, only 14% were classified as intermediate risk, and the vast majority (86%) as adverse risk. The survival of MDS/AML patients substantially differed from a bona fide AML cohort, in particular for adverse risk (Figure 1B left). To more adequately risk stratify MDS/AML patients, we aimed to modify current ELN criteria. Notably, in multivariate Cox regression analysis in addition to -7/del(7q) (hazard ratio/HR: 5.5) and mutated RUNX1 (HR: 2.2), also mutations in EZH2 (HR: 2.2) and in SF3B1 (HR: 0.3) remained significant prognostic markers for OS (all p<0.05). Following this, we defined three hierarchically defined risk groups for MDS/AML patients i) adverse (criteria: complex karyotype, -7/del(7q), mutation in TP53, RUNX1, EZH2), ii) intermediate (criteria: del(5q), mutation in ASXL1, SRSF2, U2AF1, ZRSR2, BCOR or STAG2) and iii) favorable (criteria: sole SF3B1 mutation or none of the abnormalities defined above). Overall, 149 MDS/AML patients (37%) were re-grouped compared to ELN 2022 categories resulting in 49% adverse, 35% intermediate and 16% favorable cases. Survival analysis revealed strong prognostic separations of the three new MDS/AML risk categories with median OS of 1.3 years for adverse, 3.1 years for intermediate and 8.1 years for favorable (overall p<0.001; Figure 1B right). The general survival prediction within MDS/AML was improved in the modified version compared to the original ELN 2022 (corrected Akaike information criterion using Cox models: 876 for modified vs. 902 for ELN 2022). Of note, the outcome of adverse risk MDS/AML according to the modified ELN was comparable to the OS of adverse risk AML according to the original ELN (median OS: 1.3 vs 0.7 years; p=0.304). Conclusion: ForMDS/AML patients, AML-based risk classification according to ELN 2022 guidelines is not applicable as the vast majority of cases are categorized into the adverse risk group based on mutations in splicing factor genes and other secondary-type mutations. Modification of the ELN risk categories reflects the partly MDS-based biology of the disease and substantially improves the prognostic stratification. Most importantly, patients with adverse outcome potentially benefitting from inclusion into clinical trials for novel substances are identified. The validity of the modified risk classification for MDS/AML patients undergoing specific treatment regimens remains to be confirmed in forthcoming studies.

Venetoclax abrogates the prognostic impact of splicing factor gene mutations in newly diagnosed acute myeloid leukemia

AbstractMutations in splicing factor (SF) genes SRSF2, U2AF1, SF3B1, and ZRSR2 are now considered adverse risk in the European LeukemiaNet 2022 acute myeloid leukemia (AML) risk stratification. The prognostic impact of SF mutations in AML has been predominantly derived from younger patients treated with intensive (INT) therapy. We evaluated 994 patients with newly diagnosed AML, including 266 (27%) with a SFmut. Median age was 67 years overall, with patients with SFmut being older at 72 years. SRSF2 (n = 140, 53%) was the most common SFmut. In patients treated with INT, median relapse-free survival (RFS) (9.6 vs 21.4 months, P = .04) and overall survival (OS) (15.9 vs 26.7 months, P = .06) were shorter for patients with SFmut than without SFwt, however this significance abrogated when evaluating patients who received venetoclax with INT therapy (RFS 15.4 vs 20.3 months, P = .36; OS 19.6 vs 30.7 months, P = .98). In patients treated with LI, median RFS (9.3 vs 7.7 months, P = .35) and OS (12.3 vs 8.5 months, P = .14) were similar for patients with and without SFmut , and outcomes improved in all groups with venetoclax. On multivariate analysis, SFmut did not affect hazards of relapse and death for INT arm but reduced both these hazards in LI arm. In a large AML data set with >60% of patients receiving venetoclax with LI/INT therapy, SFmut had no independent negative prognostic impact. Newer prognostic models that consider LI therapy and use of venetoclax among other factors are warranted.

The Genetic Landscape of Myelodysplastic Neoplasm Progression to Acute Myeloid Leukemia.

Myelodysplastic neoplasm (MDS) represents a heterogeneous group of myeloid disorders that originate from the hematopoietic stem and progenitor cells that lead to the development of clonal hematopoiesis. MDS was characterized by an increased risk of transformation into acute myeloid leukemia (AML). In recent years, with the aid of next-generation sequencing (NGS), an increasing number of molecular aberrations were discovered, such as recurrent mutations in FLT3, NPM1, DNMT3A, TP53, NRAS, and RUNX1 genes. During MDS progression to leukemia, the order of gene mutation acquisition is not random and is important when considering the prognostic impact. Moreover, the co-occurrence of certain gene mutations is not random; some of the combinations of gene mutations seem to have a high frequency (ASXL1 and U2AF1), while the co-occurrence of mutations in splicing factor genes is rarely observed. Recent progress in the understanding of molecular events has led to MDS transformation into AML and unraveling the genetic signature has paved the way for developing novel targeted and personalized treatments. This article reviews the genetic abnormalities that increase the risk of MDS transformation to AML, and the impact of genetic changes on evolution. Selected therapies for MDS and MDS progression to AML are also discussed.

The mutation in splicing factor genes correlates with unfavorable prognosis, genomic instability, anti-tumor immunosuppression and increased immunotherapy response in pan-cancer.

Splicing abnormality resulting from somatic mutations in key splicing factor genes (SFG) has been detected in various cancers. Hence, an in-depth study of splicing factor genes mutations' impact on pan-cancer is meaningful. This study investigated associations of splicing factor genes mutations with clinical features, tumor progression phenotypes, genomic integrity, anti-tumor immune responses, and immunotherapy response in 12 common cancer types from the TCGA database. Compared to SFG-wildtype cancers, SFG-mutated cancers displayed worse survival prognosis, higher tumor mutation burden and aneuploidy levels, higher expression of immunosuppressive signatures, and higher levels of tumor stemness, proliferation potential, and intratumor heterogeneity (ITH). However, splicing factor genes-mutated cancers showed higher response rates to immune checkpoint inhibitors than splicing factor genes-wildtype cancers in six cancer cohorts. Single-cell data analysis confirmed that splicing factor genes mutations were associated with increased tumor stemness, proliferation capacity, PD-L1 expression, intratumor heterogeneity, and aneuploidy levels. Our data suggest that the mutation in key splicing factor genes correlates with unfavorable clinical outcomes and disease progression, genomic instability, anti-tumor immunosuppression, and increased immunotherapy response in pan-cancer. Thus, the splicing factor genes mutation is an adverse prognostic factor and a positive marker for immunotherapy response in cancer.

Splicing factor mutations in the myelodysplastic syndromes: Role of key aberrantly spliced genes in disease pathophysiology and treatment.

Mutations of splicing factor genes (including SF3B1, SRSF2, U2AF1 and ZRSR2) occur in more than half of all patients with myelodysplastic syndromes (MDS), a heterogeneous group of myeloid neoplasms. Splicing factor mutations lead to aberrant pre-mRNA splicing of many genes, some of which have been shown in functional studies to impact on hematopoiesis and to contribute to the MDS phenotype. This clearly demonstrates that impaired spliceosome function plays an important role in MDS pathophysiology. Recent studies that harnessed the power of induced pluripotent stem cell (iPSC) and CRISPR/Cas9 gene editing technologies to generate new iPSC-based models of splicing factor mutant MDS, have further illuminated the role of key downstream target genes. The aberrantly spliced genes and the dysregulated pathways associated with splicing factor mutations in MDS represent potential new therapeutic targets. Emerging data has shown that IRAK4 is aberrantly spliced in SF3B1 and U2AF1 mutant MDS, leading to hyperactivation of NF-κB signaling. Pharmacological inhibition of IRAK4 has shown efficacy in pre-clinical studies and in MDS clinical trials, with higher response rates in patients with splicing factor mutations. Our increasing knowledge of the effects of splicing factor mutations in MDS is leading to the development of new treatments that may benefit patients harboring these mutations.

Oncogenic KRAS alters splicing factor phosphorylation and alternative splicing in lung cancer

BackgroundAlternative RNA splicing is widely dysregulated in cancers including lung adenocarcinoma, where aberrant splicing events are frequently caused by somatic splice site mutations or somatic mutations of splicing factor genes. However, the majority of mis-splicing in cancers is unexplained by these known mechanisms. We hypothesize that the aberrant Ras signaling characteristic of lung cancers plays a role in promoting the alternative splicing observed in tumors.MethodsWe recently performed transcriptome and proteome profiling of human lung epithelial cells ectopically expressing oncogenic KRAS and another cancer-associated Ras GTPase, RIT1. Unbiased analysis of phosphoproteome data identified altered splicing factor phosphorylation in KRAS-mutant cells, so we performed differential alternative splicing analysis using rMATS to identify significantly altered isoforms in lung epithelial cells. To determine whether these isoforms were uniquely regulated by KRAS, we performed a large-scale splicing screen in which we generated over 300 unique RNA sequencing profiles of isogenic A549 lung adenocarcinoma cells ectopically expressing 75 different wild-type or variant alleles across 28 genes implicated in lung cancer.ResultsMass spectrometry data showed widespread downregulation of splicing factor phosphorylation in lung epithelial cells expressing mutant KRAS compared to cells expressing wild-type KRAS. We observed alternative splicing in the same cells, with 2196 and 2416 skipped exon events in KRASG12V and KRASQ61H cells, respectively, 997 of which were shared (p < 0.001 by hypergeometric test). In the high-throughput splicing screen, mutant KRAS induced the greatest number of differential alternative splicing events, second only to the RNA binding protein RBM45 and its variant RBM45M126I. We identified ten high confidence cassette exon events across multiple KRAS variants and cell lines. These included differential splicing of the Myc Associated Zinc Finger (MAZ). As MAZ regulates expression of KRAS, this splice variant may be a mechanism for the cell to modulate wild-type KRAS levels in the presence of oncogenic KRAS.ConclusionProteomic and transcriptomic profiling of lung epithelial cells uncovered splicing factor phosphorylation and mRNA splicing events regulated by oncogenic KRAS. These data suggest that in addition to widespread transcriptional changes, the Ras signaling pathway can promote post-transcriptional splicing changes that may contribute to oncogenic processes.

A Phase II Clinical Trial of E7820 for Patients with Relapsed/Refractory Myeloid Malignancies with Mutations in Splicing Factor Genes

A Phase II Clinical Trial of E7820 for Patients with Relapsed/Refractory Myeloid Malignancies with Mutations in Splicing Factor Genes

Mutational landscape of blast phase myeloproliferative neoplasms (MPN-BP) and antecedent MPN.

Myeloproliferative neoplasms (MPN) have an inherent tendency to evolve to the blast phase (BP), characterized by ≥20% myeloblasts in the blood or bone marrow. MPN-BP portends a dismal prognosis and currently, effective treatment modalities are scarce, except for allogeneic hematopoietic stem cell transplantation (allo-HSCT) in selected patients, particularly those who achieve complete/partial remission. The mutational landscape of MPN-BP differs from de novo acute myeloid leukemia (AML) in several key aspects, such as significantly lower frequencies of FLT3 and DNMT3A mutations, and higher incidence of IDH1/2 and TP53 in MPN-BP. Herein, we comprehensively review the impact of the three signaling driver mutations (JAK2 V617F, CALR exon 9 indels, MPL W515K/L) that constitutively activate the JAK/STAT pathway, and of the other somatic non-driver mutations (epigenetic, mRNA splicing, transcriptional regulators, and mutations in signal transduction genes) that cooperatively or independently promote MPN progression and leukemic transformation. The MPN subtype, harboring two or more high-molecular risk (HMR) mutations (epigenetic regulators and mRNA splicing factors) and "triple-negative" PMF are among the critical factors that increase risk of leukemic transformation and shorten survival. Primary myelofibrosis (PMF) is the most aggressive MPN; and polycythemia vera (PV) and essential thrombocythemia (ET) are relatively indolent subtypes. In PV and ET, mutations in splicing factor genes are associated with progression to myelofibrosis (MF), and in ET, TP53 mutations predict risk for leukemic transformation. The advent of targeted next-generation sequencing and improved prognostic scoring systems for PMF inform decisions regarding allo-HSCT. The emergence of treatments targeting mutant enzymes (e.g., IDH1/2 inhibitors) or epigenetic pathways (BET and LSD1 inhibitors) along with new insights into the mechanisms of leukemogenesis will hopefully lead the way to superior management strategies and outcomes of MPN-BP patients.

Circular RNAs in Myelodysplastic Syndromes and Impact of SF3B1 Mutations on Their Expression

Myelodysplastic syndromes (MDS) are a heterogeneous group of diseases with a high risk of transformation to acute myeloid leukemia (AML). One of the processes implicated in MDS pathogenesis is RNA splicing. Its alterations are caused by somatic mutations in splicing factor genes. Mutations in SF3B1 (Splicing Factor 3b Subunit 1) gene are the most frequently found mutations in MDS. Circular RNAs (circRNAs) are covalently closed RNAs that are produced by back-splicing process. CircRNAs can regulate multiple biological processes through various molecular mechanisms, such as microRNA sponging. Their deregulation is frequently found in cancer. It is likely that they also contribute to the development of MDS, however, their role in MDS has not been researched yet. Therefore, our aim was to explore circRNA levels in MDS and analyze their association with patient prognosis. We further hypothesized that mutations in splicing factor genes can affect production of circRNAs and thus, we examined circRNA levels with respect to the mutational status. We explored transcriptome of 78 MDS patients, 7 AML patients, and 13 healthy donors using Illumina RNA-seq of total RNA isolated from CD34+ bone marrow cells. To associate circRNA levels with mutational status, Illumina TruSight Myeloid Sequencing Panel Kit examining 54 genes was applied. Of 8,620 circRNAs identified by RNA-seq, 204 circRNAs were deregulated in MDS (e.g., MENTRNL, EBF1, and PPM1L-derived circRNAs) and 246 circRNAs were altered between lower- and higher-risk patients (e.g., CHST15, TMTC2, and PDE3B-derived circRNAs). Most of the progression-related circRNAs (n = 234) showed elevated levels in higher-risk patients, suggesting that the back-splicing process might be stimulated during the disease progression. In MDS patients with SF3B1 mutations, other 40 circRNAs were deregulated (e.g., ZNF91, ZEB1, and ZNF124-derived circRNAs). This circRNA profile was substantially different from the profiles associated with the rest of recurrently mutated splicing factor genes (SRSF2, U2AF1, and ZRSR2). To study alterations in forward- and back-splicing in SF3B1-mutated patients, we examined transcriptional differences on the levels of whole genes, transcript variants, and circRNAs and searched for specificities in transcription within individual gene loci. A set of circRNAs whose levels differed specifically without affecting expression of corresponding forward-spliced mRNAs included several oncology/hematopoiesis-relevant genes (e.g., ATM, CBL, ERCC5, ETV6, FLT3, and MAPK6). Gene loci with changed expression of both, alternative mRNA transcripts and circRNAs, but stable transcription on whole gene level included for example CDK14, KDM1A, and ZEB1. Because ZEB1 (Zinc Finger E-Box Binding Homeobox 1) serves as an essential hematopoietic transcription factor, we focused on ZEB1-derived circRNAs (hsa_circ_0000228 and hsa_circ_0003793) in more detail. We demonstrated that upregulation of these circRNAs is SF3B1-specific and not related to any other clinical or molecular characteristics. Finally, using RNA-seq data from CRISPR/Cas9 edited K562 cells (Liberante FG, et al., Sci Rep. 2019; 9:2678), we confirmed that SF3B1 K700E mutation leads to strong upregulation of ZEB1 circRNAs. To conclude, this is an early report showing for the first time that the levels of specific circRNAs are altered in MDS. We demonstrated that particular circRNAs may have potential to become markers that would contribute to more accurate prognosis of MDS patients. Further, we identified circRNAs with deregulated levels specifically in MDS patients with SF3B1 mutation, suggesting that this mutation affects circRNA production.Supported by GA CR (N20-19162S) and MH CZ-DRO (UHKT, 00023736). DisclosuresNo relevant conflicts of interest to declare.

U2AF1 Mutations Enhance Stress Granule Response in Myeloid Malignancies

Somatic mutations in splicing factor genes are drivers of myelodysplastic syndromes (MDS) and acute myeloid leukemia (AML). The splicing factors U2AF1 and U2AF2 form the U2AF heterodimer that is critical in the 3' splice site (3'SS) recognition and in the recruitment of U2 small nuclear ribonucleoproteins for the activation of the spliceosome complex. U2AF1 carries hotspot mutations in its two RNA binding motifs; yet the molecular mechanisms affecting the splicing process and promoting clonal advantage remain unclear, albeit necessary to develop effective targeted therapies.We applied a multi-omics approach comparing the activities of two U2AF1 mutants (S34F and Q157R) in MDS/AML cell lines and primary samples. Using a novel approach of fractionated enhanced crosslinking immunoprecipitation coupled with deep RNA-sequencing (freCLIP-seq), we mapped transcriptome-wide binding at nucleotide resolution and we identified conformational changes in mutant vs wild-type U2AF1 binding. Specifically, we observed an emergent peak in position -3 of the 3'SS for the S34F mutant and in position +1 for the Q157R mutant, matching the critical positions observed by differential splicing analysis on RNA-seq data. Altered U2AF1-RNA binding compromised U2AF2-RNA interactions, resulting predominantly in exon exclusion and intron retention. Combined binding-splicing analysis showed that while the Q157R mutant mainly exhibits loss of binding, the S34F mutant follows a gain-of-binding pattern, where splicing progression appears impaired by increased mutant binding.Functional analysis of genes affected by both binding and splicing alterations revealed that U2AF1 mutants alter RNA granule biology, affecting in particular stress granule-enriched transcripts and proteins. Stress granules are membrane-less cytoplasmic assemblies of RNAs and RNA binding proteins that improve cellular adaptation in response to stress conditions. Increased stress granule formation has been linked to tumorigenesis as a strategy exploited by cancer cells to regulate gene expression and signal transduction, enhancing their fitness under stress. To probe how aberrant binding and splicing of stress granule components affected stress granule biology, we assessed stress granule formation in U2AF1 mutant vs wild-type cells at steady state and after stress induction with sodium arsenite treatment. Immunofluorescent staining followed by confocal imaging demonstrated that U2AF1 mutations enhance stress granule formation upon arsenite stress in both cell lines and primary samples. RNA turnover analysis by TimeLapse-seq confirmed that U2AF1 S34F and Q157R mutations promote stability/synthesis of transcripts that are enriched in stress granules and determine degradation/shutdown of transcripts that are depleted in stress granules, providing a molecular explanation for the increase in stress granules observed by imaging. Finally, we were able to corroborate our observations by single-cell RNA-seq in patient-derived U2AF1-mutant MDS blasts, establishing the causal link between U2AF1 mutations and upregulation of stress granule components.Collectively, this multi-omics analysis identified biological processes directly influenced by mutant U2AF1 binding and splicing, laying the foundation for a new paradigm where splicing factor mutations enhance stress granule formation by acting on the availability of their RNA and protein components. The enhanced formation of stress granules potentially fosters the stress adaptation of U2AF1-mutant cells, contributing to their clonal advantage in MDS/AML. Stress granule perturbations may therefore represent a novel therapeutic vulnerability in U2AF1-mutant MDS/AML patients and possibly in patients carrying other splicing factor mutations. DisclosuresHunck: Boehringer Ingelheim: Other: Fellowship.

U2AF1 and Other Splicing Factor Gene Mutations in Telomere Biology Disorders Are Associated with Hematologic Neoplasia and Worse Overall Survival

Introduction: Telomere Biology Disorders (TBD) are due to germline variants in telomere maintenance and repair genes. Clinical manifestations include bone marrow failure (BMF), liver and lung fibrosis, and risk of cancer, especially myeloid neoplasia. We characterized clinical phenotype, pathology, and clonal landscape of patients with TBD and myelodysplastic syndrome (MDS) or acute leukemia (AL). We assessed if somatic variants in myeloid cancer genes are associated with MDS/AL or overall survival (OS).Methods: Patients (n=109) from the National Institutes of Health and University of São Paulo (NIH/USP) (n=91) or MD Anderson (MDA) (n=18) met TBD clinical criteria or had a pathogenic/likely pathogenic germline variant in a telomere maintenance/repair gene. All patients gave informed consent. Clinical characteristics and details of hematologic malignancy were collected. MDS was defined using WHO 2016 criteria. In the NIH/USP cohort, somatic variants in myeloid cancer genes were assessed in peripheral blood using error-corrected DNA sequencing (ECS; minimum variant allele frequency [VAF] of 0.5%) and in the MDA cohort patients were screened by targeted amplicon-based next-generation sequencing (minimum VAF of 2%). Serial samples were available in 31 (41%) patients.Results: Eighteen out of 109 (17%) patients from both the NIH/USP and MDA cohorts had a diagnosis of MDS/AL, developing in patients with TERC (n=8/31; 25%), TERT (n=8/48; 16%), RTEL1 (n=1/5; 20%), and DKC1 (n=1/2; 50%). Karyotypes were normal diploid (n=6), chromosome 1 abnormality (n=5), trisomy 8 (n=2), deletion 20q (n=1), complex (n=2), monosomy 7 (n=1) and deletion 7q (n=1). Six patients had >5% blasts. Four patients had concurrent liver fibrosis and 9 had pulmonary fibrosis. Somatic mutation data at time of MDS/AL was available for 16/18 patients; splicing factor genes (n=14) were most frequent, seen in 11 (69%) patients, with U2AF1 predominating (n=7; 44% of patients) (Figure 1A). More than 1 mutation was present in 12/16 (75%) of patients. One patient developed AML 6 years after MDS diagnosis . U2AF1 variants were also present in 8 patients without MDS/AL; 5 had no sequential samples and 3 had stable mutations over 2 (n=2) and 4 (n=1) years. Recurrent variants in U2AF1 were present at p.S34 (n=12) and p.Q157 (n=2). Median U2AF1 variant allele fraction (measured in NIH/USP cohort only) was 23% in patients with MDS/AL compared to 7% in those without.Variant association analysis was confined to NIH/USP cohort due to DNA sequencing assay differences; data were available in 75 patients. Patients were divided into groups defined by specific variants at any time of sampling; “Clonal-hematopoiesis of indeterminate potential / aplastic anemia (CHIP/AA) associated” (DNMT3A, TET2, ASXLI, or BCOR/L1), “MDS-associated” (containing splicing factor genes, RUNX1, SETBP1, ETV1, KRAS, STAG2, GATA2/1, TP53), “PPM1D” (containing PPM1D), and a subgroup, “Splicing factors” (U2AF1, ZRSR2, SF3B1, SRSF2). Patients with MDS-associated variants (Figure 1A; p=0.02), particularly splicing factors (Figure 1B; p=0.007) more likely had or later developed MDS/AL, compared to patients without somatic variants or in other variant groups. MDS/AL was not associated with PPM1D or CHIP/AA-associated variants. OS from time of first detected somatic variant was lower in the MDS-associated variant group (Figure 1C p=0.013) compared to those without variants at time of first assessment; this was not the case for CHIP/AA-associated variants or PPM1D. Patients with somatic variants (median ages 36, 41, and 42 for PPM1D, CHIP/AA-associated, and MDS-associated respectively) were significantly older than patients without variants (median age 24) though ages were similar within variant groups.Conclusion: Splicing factor gene variants predominate the clonal landscape of TBD-associated hematologic malignancy; U2AF1 p.S34 is recurrent and can occur in the absence of neoplasia. Splicing factor gene variants such as U2AF1 in the peripheral blood may be potential biomarkers for hematologic malignancy in TBD patients. PPM1D, previously associated with therapy-related MDS, is commonly mutated in TBD but does not associate with MDS/AL. OS was decreased in patients with MDS-associated variants but not with PPM1D or CHIP/AA-associated variants. Further study of U2AF1 variants in TBD patients may give insight to the underlying drivers of MDS/AL. [Display omitted] DisclosuresDiNardo: Agios/Servier: Consultancy, Honoraria, Research Funding; Notable Labs: Current holder of stock options in a privately-held company, Membership on an entity's Board of Directors or advisory committees; ImmuneOnc: Honoraria, Research Funding; Bristol Myers Squibb: Honoraria, Research Funding; AbbVie: Consultancy, Research Funding; Forma: Honoraria, Research Funding; GlaxoSmithKline: Membership on an entity's Board of Directors or advisory committees; Novartis: Honoraria; Takeda: Honoraria; Foghorn: Honoraria, Research Funding; Celgene, a Bristol Myers Squibb company: Honoraria, Research Funding. Calado: Novartis Brasil: Honoraria; Instituto Butantan: Consultancy; AA&MDS International Foundation: Research Funding; Alexion Brasil: Consultancy; Agios: Membership on an entity's Board of Directors or advisory committees; Team Telomere, Inc.: Membership on an entity's Board of Directors or advisory committees. Young: Novartis: Research Funding.

Altered DNA Methylation Profiles in SF3B1 Mutated CLL Patients.

Mutations in splicing factor genes have a severe impact on the survival of cancer patients. Splicing factor 3b subunit 1 (SF3B1) is one of the most frequently mutated genes in chronic lymphocytic leukemia (CLL); patients carrying these mutations have a poor prognosis. Since the splicing machinery and the epigenome are closely interconnected, we investigated whether these alterations may affect the epigenomes of CLL patients. While an overall hypomethylation during CLL carcinogenesis has been observed, the interplay between the epigenetic stage of the originating B cells and SF3B1 mutations, and the subsequent effect of the mutations on methylation alterations in CLL, have not been investigated. We profiled the genome-wide DNA methylation patterns of 27 CLL patients with and without SF3B1 mutations and identified local decreases in methylation levels in SF3B1mut CLL patients at 67 genomic regions, mostly in proximity to telomeric regions. These differentially methylated regions (DMRs) were enriched in gene bodies of cancer-related signaling genes, e.g., NOTCH1, HTRA3, and BCL9L. In our study, SF3B1 mutations exclusively emerged in two out of three epigenetic stages of the originating B cells. However, not all the DMRs could be associated with the methylation programming of B cells during development, suggesting that mutations in SF3B1 cause additional epigenetic aberrations during carcinogenesis.

Splicing factor gene mutations in acute myeloid leukemia offer additive value if incorporated in current risk classification

AbstractSplicing factor (SF) mutations are important contributors to the pathogenesis of hematological malignancies; however, their relevance in risk classification of acute myeloid leukemia (AML) warrants further investigation. To gain more insight into the characteristics of patients with AML carrying SF mutations, we studied their association with clinical features, cytogenetic and molecular abnormalities, and clinical outcome in a large cohort of 1447 patients with AML and high-risk myelodysplastic syndrome. SF mutations were identified in 22% of patients and were associated with multiple unfavorable clinical features, such as older age, antecedent myeloid disorders, and adverse risk factors (mutations in RUNX1 and ASXL1). Furthermore, they had significantly shorter event-free and overall survival. Notably, in European LeukemiaNet (ELN) 2017 favorable- and intermediate-risk groups, SF3B1 mutations were indicative of relatively poor prognosis. In addition, patients carrying concomitant SF mutations and RUNX1 mutations had a particularly adverse prognosis. In patients without any of the 4 most common SF mutations, RUNX1 mutations were associated with relatively good outcome, which was comparable to that of intermediate-risk patients. In this study, we propose that SF mutations be considered for incorporation into prognostic classification systems. First, SF3B1 mutations could be considered an intermediate prognostic factor when co-occurring with favorable risk features and as an adverse prognostic factor for patients currently categorized as having intermediate risk, according to the ELN 2017 classification. Second, the prognostic value of the current adverse factor RUNX1 mutations seems to be limited to its co-occurrence with SF mutations.

Prevalence and Dynamics of Clonal Hematopoiesis Caused By Leukemia Associated Mutations in Elderly Individuals without Hematologic Disorders

Clonal hematopoiesis is frequently observed in elderly people and may represent a premalignant condition. Evidence suggests that genetic alterations found in patients with myeloid malignancies may also be causative for induction of clonal hematopoiesis in healthy elderly. Discrimination between age-associated and leukemia-associated mutations is of crucial clinical importance. We sought to investigate the prevalence and dynamics of genetic alterations among elderly individuals without hematologic/oncologic disorders by genotyping a cohort of 50 elderly individuals (29 women; median age 84 years; range 80-90 years) for a panel of 30 commonly mutated leukemia-associated genes by targeted deep next-generation sequencing (NGS). Buccal cells were analyzed to confirm the somatic origin of mutations. A total of 16 somatic mutations in leukemia-associated genes were identified in 13 of 50 (26%) elderly individuals. One subject presented with two, another subject with three different mutations. Ten of 16 mutations (63%) affected epigenetic modifier genes (DNMT3A, n=8; TET2, n=1; IDH2, n=1). Four somatic mutations affected genes involved in the RNA splicing machinery (SRSF2, n=2; SF3B1, n=1; U2AF1, n=1). Mutations in TP53 and NRAS were identified in two individuals. All but one mutation were missense mutations with cytosine to thymine transitions being the most common base pair change (n=7). Mutations occurred at low variant allele frequencies (VAF) with a median of 11.7% (range, 1.0 to 30.7%) indicating that mutations were presented in only a subset of nucleated blood cells. Mutation kinetics remained virtually stable over a follow-up observation of three years as measured by targeted NGS (median VAF 13.1%; range, 1.0 to 35.3%). Two subjects with mutations in splicing factor genes died, one with an SF3B1 mutation developed pancreatic cancer, the other harbored a U2AF1 mutation and died from a stroke. All other individuals with mutations are alive without any evidence for cancer or cardiovascular disorders. To study the prevalence of DNMT3A mutations in more detail, a DNMT3A specific high-sensitive (sensitivity 1-3%) NGS assay was established for investigation of an additional cohort of 163 healthy individuals including younger people (84 women; median age 39 years; range 1-79 years). No DNMT3A mutation was detected in 40 children and adolescents (1-19 years). Somatic DNMT3A mutations were found in 2/43 (4.6%) individuals with an age of 20-39 years, 1/40 subjects (2.5%) between 40-59 years and in 3/40 subjects (7.5%) between 60-79 years. Again, mutations occurred at low VAF with a median of 8.2% (range, 1.5 to 37.3%). Two DNMT3A variants were detected both in blood and buccal cells indicating germline variants or rare polymorphisms (a 34-year old female and a 74-year old male, respectively). These findings indicate that the appearance of low-level clones characterized by mutations in epigenetic regulator genes and the RNA splicing machinery is a common age-associated phenomenon which may represent a premalignant condition in the development of cancers and may also predispose to other aging associated disorders. DNMT3A mutations were the most common mutations identified in elderly individuals but were also apparent in younger healthy people. The question why subclones are initially selected but apparently enter a stage of clonal size stability without further selection in healthy individuals in contrast to patients with myeloid disorders is of particular interest and needs further investigation. DisclosuresHochhaus:Incyte: Research Funding; ARIAD: Research Funding; BMS: Research Funding; MSD: Research Funding; Pfizer: Research Funding; Novartis: Research Funding.

Co-mutation pattern, clonal hierarchy, and clone size concur to determine disease phenotype of SRSF2P95-mutated neoplasms.

Somatic mutations in splicing factor genes frequently occur in myeloid neoplasms. While SF3B1 mutations are associated with myelodysplastic syndromes (MDS) with ring sideroblasts, SRSF2P95 mutations are found in different disease categories, including MDS, myeloproliferative neoplasms (MPN), myelodysplastic/myeloproliferative neoplasms (MDS/MPN), and acute myeloid leukemia (AML). To identify molecular determinants of this phenotypic heterogeneity, we explored molecular and clinical features of a prospective cohort of 279 SRSF2P95-mutated cases selected from a population of 2663 patients with myeloid neoplasms. Median number of somatic mutations per subject was 3. Multivariate regression analysis showed associations between co-mutated genes and clinical phenotype, including JAK2 or MPL with myelofibrosis (OR = 26.9); TET2 with monocytosis (OR = 5.2); RAS-pathway genes with leukocytosis (OR = 5.1); and STAG2, RUNX1, or IDH1/2 with blast phenotype (MDS or AML) (OR = 3.4, 1.9, and 2.1, respectively). Within patients with SRSF2-JAK2 co-mutation, JAK2 dominance was invariably associated with clinical feature of MPN, whereas SRSF2 mutation was dominant in MDS/MPN. Within patients with SRSF2-TET2 co-mutation, clinical expressivity of monocytosis was positively associated with co-mutated clone size. This study provides evidence that co-mutation pattern, clone size, and hierarchy concur to determine clinical phenotype, tracing relevant genotype-phenotype associations across disease entities and giving insight on unaccountable clinical heterogeneity within current WHO classification categories.

Selective Targeting of Alternative Splicing Deregulation in Pediatric Acute Myeloid Stem and Progenitor Cells

INTRODUCTION Because acute myeloid leukemia (AML) is the leading cause of pediatric leukemia relapse-related mortality, there is a desperate need for developing new therapeutics and providing mechanistic insights into the cell type and molecular context specific causes of relapse. Myeloid malignancies, including AML, have a propensity to disrupt the spliceosome either through acquisition of splicing factor gene mutations or epigenetic spliceosome disruption in leukemia stem cells (reviewed in Chua, Van Der Werf, Jamieson, Signer. Cancer Cell 2020;26:138-159). While leukemia stem cells (LSCs) promote relapse in adult AML as a result of their inherent capacity to become dormant and resist therapies that target dividing cells, the role of alternative splicing (AS) deregulation in relapse and therapeutic vulnerability of LSCs has not been thoroughly studied in pediatric AML. METHODS Recently, we completed pre-IND enabling studies with a selective splicing modulator, 17S-FD-895. Previously, we showed that 17S-FD-895 selectively eliminated adult AML LSC (Crews...Burkart, Jamieson. Cell Stem Cell 2016;19:599-612). As a stable pladienolide-derived small molecule splicing modulator, 17S-FD-895 targets a key component of the spliceosome, SF3B1, thereby modulating mRNA splicing. To investigate the role of splicing deregulation in pediatric AML LSC maintenance, we developed a sensitive in vitro and in vivo lentiviral splicing reporter assay, whole transcriptome RNA sequencing (RNA-seq) stem and progenitor cell splicing analysis pipelines, qRT-PCR splice isoform specific biomarkers of response, as well as stromal co-culture, hematopoietic progenitor colony survival and replating assays to assay LSC eradication. RESULTS Because splicing regulation is cell type and context dependent, we generated a comprehensive transcriptome expression map of FACS-purified hematopoietic stem cells (HSCs; CD34+CD38-Lin-) and hematopoietic progenitor cells (HPCs;CD34+CD38+Lin). By utilizing a splice variant-specific alignment algorithm, we evaluated genome wide alternative splicing events and uncovered widespread exon skipping in pediatric AML compared to non-leukemic donors. More than 2000 exon skipping events were identified in pediatric AML HSCs and HPCs. In addition, both pediatric AML HSC and HPC demonstrated a downregulation of the splicing regulator RNA-Binding fox 2 (RBFOX2), which has been linked to embryonic stem cell splice variant signatures that are vital for leukemia cell survival (Holm...Jamieson. PNAS 2015;112:15444-15449; Denichenko et al Nat Commun 2019;10:1590). Treatment with 17S-FD-895 induced a dose-dependent reduction in clonogenicity (p=0.001; Student's t-test) and self-renewal of CD34+ cells (p=0.001; Student's t-test) isolated from pediatric AML samples. Pediatric AML samples were significantly more sensitive to splicing modulation than adult de novo or adult secondary AML. Moreover, normal cord blood HSC and HPC samples were unaffected by splicing modulator treatment. Our lentiviral splicing reporter assays demonstrated a dose dependent increase in MAPT intron retention in in pediatric leukemia cell lines as measured by a switch from GFP to RFP. Finally, splice isoform specific RT-PCR demonstrated a dose-dependent increase in SF3B1 intron retention following treatment as well as MCL1 exon 2 skipping, producing pro-apoptotic MCL1-S transcripts. CONCLUSIONS Cumulatively, our data indicate that spliceosome modulation via 17S-FD-895-mediated targeting of SF3B1 constitutes a novel potential therapeutic strategy for pediatric patients with AML. Disclosures Kaspers: Boehringer Ingelheim: Membership on an entity's Board of Directors or advisory committees; AbbVie: Ended employment in the past 24 months; Janssen R&amp;D: Ended employment in the past 24 months; Helsinn Healthcare: Ended employment in the past 24 months. Crews:Ionis Pharmaceuticals: Research Funding. Jamieson:Forty Seven Inc: Patents &amp; Royalties; Bristol-Myers Squibb: Other.