Murine Interleukin Research Articles

EXTH-75. IMMUNOVIROTHERAPY WITH PP2A AND PD-1 INHIBITION IN PEDIATRIC HIGH-GRADE GLIOMA

Abstract Pediatric high-grade gliomas (HGGs) represent a significant clinical challenge with poor survival rates. Engineered oncolytic herpes simplex virus (oHSV) has shown potential in several clinical trials at targeting HGGs through their direct lytic effect and induction of an immune response. We have learned from our clinical trial experience (NCT02457845) that a critical barrier to more durable response is augmenting and sustaining the anti-tumor immune response generated by oHSV. LB-100, a protein phosphatase 2A (PP2A) inhibitor, is known to enhance T-cell activity. We hypothesized that LB-100 with anti-PD-1 therapy would overcome the immunosuppressive barriers, enhancing the immunotherapeutic effects of oHSV and improve survival in an immunocompetent murine model. We investigated the therapeutic impact of clinically available, next-generation oHSV, M002, which expresses murine interleukin-12, combined with LB-100 and PD-1 inhibition compared to M002 with LB-100 or anti-PD-1 antibody, each therapy alone, or control by measuring median survival and changes in the tumor immune microenvironment. The triple combination of M002, LB-100, and anti-PD-1 antibody significantly extended median survival compared to control (45 days vs 22.5 days, P=0.001) or each treatment alone, and compared to M002 and LB-100 (44 days vs 28 days, P=0.017) or M002 and anti-PD-1 (45.5 days vs 41 days, P=0.023). This increase in survival was correlated with a robust increase in CD45+ immune cell infiltration and a reduction in T-regulatory cells. We will further investigate the changes in the tumor microenvironment to better understand the specific contributions of different immune cell populations. These data support the hypothesis that LB-100 enhances the efficacy of oHSV by amplifying T-cell-mediated immune responses against tumor cells. This combination therapy demonstrates a promising strategy that warrants further exploration and potential clinical application, emphasizing the critical role of targeting multiple aspects of immune regulation to enhance the efficacy of oncolytic virotherapy in pediatric tumors.

Alum-anchored IL-12 combined with cytotoxic chemotherapy and immune checkpoint blockade enhanced antitumor immune responses in head and neck cancer models

BackgroundFirst-line treatment with pembrolizumab plus chemotherapy in recurrent and metastatic head and neck squamous cell carcinomas (HNSCC) has improved survival. However, the overall response rate with this standard of care...

Non-pathogenic E. coli displaying decoy-resistant IL18 mutein boosts anti-tumor and CAR NK cell responses.

The tumor microenvironment can inhibit the efficacy of cancer therapies through mechanisms such as poor trafficking and exhaustion of immune cells. Here, to address this challenge, we exploited the safety, tumor tropism and ease of genetic manipulation of non-pathogenic Escherichia coli (E. coli) to deliver key immune-activating cytokines to tumors via surface display on the outer membrane of E. coli K-12 DH5α. Non-pathogenic E. coli expressing murine decoy-resistant IL18 mutein (DR18) induced robust CD8+ T and natural killer (NK) cell-dependent immune responses and suppressed tumor progression in immune-competent colorectal carcinoma and melanoma mouse models. E. coli K-12 DH5α engineered to display human DR18 potently activated mesothelin-targeting chimeric antigen receptor (CAR) NK cells and enhance their trafficking into tumors, which extended survival in an NK cell treatment-resistant mesothelioma xenograft model by enhancing TNF signaling and upregulating NK activation markers. Our live bacteria-based immunotherapeutic system safely and effectively induces potent anti-tumor responses in treatment-resistant solid tumors, motivating further evaluation of this approach in the clinic.

The Generation of an ocular anti-inflammatory biotherapeutic to enhance wound healing.

Microbes exist at and colonize mucosal surfaces striking a balance with the host immune system, so that these microbes can thrive on host tissues without causing pathology. Because of this, mucosal barrier-colonizing bacteria can be leveraged to act as long-term delivery vehicles for naturally derived therapeutics. Here, we use a mouse model of corneal wound healing to show that the eye-colonizing bacterium, Corynebacterium mastitidis (C. mast) can be engineered to produce and secrete bioactive murine anti-inflammatory interleukin (mIL)-10. Specifically, we used transposon mutagenesis to identify a native C. mast-specific secretion signal that was used to direct C. mast to secrete mIL-10. Mini-transposons were generated to deliver secretion capable mIL-10 to the bacterial genome. After screening, two isolates were identified that can: 1) colonize the eye, 2) produce and secrete mIL-10, and 3) enhance wound healing in an IL-10-dependent manner. This proof of concept illustrates that eye-colonizing bacteria can be engineered to deliver therapeutics to the ocular surface for the alleviation of ocular surface disease(s).

Abstract PO-020: ZBTB24 is a novel tumor suppressor and cooperates with CDKN2A to suppress B-cell lymphomagenesis

Abstract B-cell lymphoma is the most common hematological malignancy that accounts for the sixth highest mortality among all cancers. Despite recent improvements on combined chemotherapy and immunotherapy, treatments remain challenging due to complex genetic heterogeneity and molecular pathogenesis. To explore novel mechanisms in B-cell lymphomagenesis, we performed a genome-wide CRISPR knockout screen in the murine interleukin-3 (IL-3)-dependent Ba/F3 pro-B cell line and identified Zbtb24 as a putative target whose silencing leads to elevated proliferative signaling and reduced apoptosis, conferring IL-3-independent growth in Ba/F3 cells. Silencing of ZBTB24 also accelerated growth in multiple human B-cell lymphoma cell lines. ZBTB24 is a member of the zinc-finger and BTB domain containing transcription factor that is highly expressed in spleen and bone marrow. While it has been shown that ZBTB24 may play an important role in B-cell development and activation, its involvement in B-cell lymphoma has not been described. Analysis of publicly available datasets found that ZBTB24 copy number deletion occurs in various B-cell lymphomas, which frequently co-occurs with deletion of the tumor suppressor CDKN2A. Hence, we generated B-cell specific Zbtb24 single knockout and Zbtb24/Cdkn2a double knockout mice to explore the role of Zbtb24 in vivo. While Zbtb24 and Cdkn2a single knockout mice remained tumor-free or showed low penetrance of tumorigenesis, the double knockout mice developed lymphadenopathy and splenomegaly accompanied with accelerated mortality. Flow cytometry analysis of bone marrow, spleen, and lymph nodes revealed malignant B-cells. Subsequent transplantation of the splenic cells induced identical malignant B-cell lymphomagenesis and immunophenotype in athymic nude mice, further confirming its malignant identity. These results indicate that ZBTB24 is a novel tumor suppressor in B-cell malignancy. Ongoing studies are being conducted to understand the mechanistic basis for ZBTB24 tumor suppressive function that may involve transcriptional regulation of its target gene expression. This project is supported by the NIH R01CA232246, R01CA129536, and the John Colaizzi Endowment Fund. Citation Format: Rongrong Li, Namratha Sheshadri, Jianliang Shen, Junrong Yan, Jaeyong Jung, Muhammad Usama Tariq, Y Lynn Wang, Ping Xie, Wei-Xing Zong. ZBTB24 is a novel tumor suppressor and cooperates with CDKN2A to suppress B-cell lymphomagenesis [abstract]. In: Proceedings of the Fourth AACR International Meeting on Advances in Malignant Lymphoma: Maximizing the Basic-Translational Interface for Clinical Application; 2024 Jun 19-22; Philadelphia, PA. Philadelphia (PA): AACR; Blood Cancer Discov 2024;5(3_Suppl):Abstract nr PO-020.

RNA-encoded Interleukin 2 with Extended Bioavailability Amplifies RNA Vaccine-Induced Antitumor T-cell Immunity.

Interleukin 2 (IL-2) is a crucial cytokine in T-cell immunity, with a promising potential in cancer vaccines. However, therapeutic application of IL-2 is hampered by its short half-life and substantial toxicity. This study reports preclinical characterization of a mouse serum albumin-IL-2 fusion protein (Alb-IL2) encoded on nucleoside-modified RNA that is delivered via a nanoparticle formulation (Alb-IL2 RNA-NP) mediating prolonged cytokine availability. Alb-IL2 RNA-NP was combined with RNA-lipoplex (RNA-LPX) vaccines to evaluate its effect on the expansion of vaccine-induced antigen specific T-cell immunity. In mice dosed with Alb-IL2 RNA-NP, translated protein was shown to be systemically available up to 2 days, with an albumin-dependent preferred presence in the tumor and tumor-draining lymph node. Alb-IL2 RNA-NP administration prolonged serum availability of the cytokine compared with murine recombinant IL-2. In combination with RNA-LPX vaccines, Alb-IL2 RNA-NP administration highly increased the expansion of RNA-LPX vaccine-induced CD8+ T cells in the spleen and blood. The combination enhanced and sustained the fraction of IL-2 receptor (IL-2R) α-positive antigen-specific CD8+ T cells and ameliorated the functional capacity of the CD8+ T-cell population. Alb-IL2 RNA-NP strongly improved the antitumor activity and survival of concomitant RNA-LPX vaccination and PD-L1 blockade in a subcutaneous mouse tumor model. The favorable pharmacokinetic properties of Alb-IL2 RNA-NP render it an attractive modality for rationally designed combination immunotherapy. RNA vaccines that induce tumor-specific T-cell immunity for Alb-IL2 RNA-NP to further amplify are particularly attractive combination partners.

Abstract 4082: Anchored IL-12 synergizes with an epigenetic modulator to promote immune remodeling and overcome anti-PD1-refractory murine tumors

Abstract Background Most patients with solid malignancies harbor innate or acquired resistance to immune checkpoint blockade (ICB), prompting the need for novel therapeutic strategies. Interleukin-12 (IL-12) is a promising cytokine for cancer therapy due to its ability to bridge innate and adaptive immunity. However, a narrow therapeutic index limits the use of systemic IL-12 therapy. Here, we investigated the tumor-suppressive effects and mode of action of intra-tumorally delivered murine Interleukin-12 anchored to aluminum hydroxide (referred as mANK-101) in combination with the class I HDAC inhibitor entinostat, in various ICB-refractory murine tumor models, including CT26 (colorectal) and MOC-1 (HPV16neg). We hypothesized that combining Entinostat with an anchored form of IL-12 could overcome systemic toxicity while maintaining anti-tumor activity. Methods Entinostat and intra-tumoral mANK-101 were administered to mice bearing well-established αPD-1-refractory CT26 (colorectal) and MOC-1 (HPV16neg) tumors. Antitumor activity, survival, and protective memory upon tumor rechallenge were evaluated. Comprehensive proteomic and immune cell analysis was performed in MOC-1 tumors, tumor-draining lymph node (tdLN), and periphery. Tumor-specific T cell responses were examined. Results We demonstrate that intra-tumoral mANK-101 synergizes with entinostat to suppress multiple αPD1-refractory tumors, resulting in significant tumor eradication (62-88%), survival benefit (P < 0.0001), and protective memory, including CT26 (colon, Kras G12Dmut) and MOC-1 (oral, HPV16neg). Analysis of MOC-1 tumor-bearing mice demonstrated these effects to be associated with peripheric activation of CD8+ and NK lymphocytes, augmented polyfunctional IFNγ+/TNFα+-producing CD8+ T cells, CD8+ T cell effector memory, and tumor-specific T cell responses. Significant decrease in CD4+ Tregs and increased CD8/Treg ratio were also observed. Ongoing functional studies, proteomic and immune cell analysis at the tumor site, tdLN, and periphery, including single cell transcriptomics and epigenetic studies, will allow for a deeper understanding of the synergistic effect of mANK-101 with the epigenetic modulator Entinostat. Conclusions Collectively, these findings form a rationale for the clinical combination of intralesional delivery of ANK-101 with entinostat for patients with ICB-refractory malignancies, including colorectal and HPV16neg head and neck cancers. Citation Format: Asma S. Khelifa, Katherine L. Lothstein, Masaya Miyamoto, Rob Tighe, Sailaja Battula, Howard L. Kaufman, Jeffrey Schlom, Sofia R. Gameiro. Anchored IL-12 synergizes with an epigenetic modulator to promote immune remodeling and overcome anti-PD1-refractory murine tumors [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 4082.

Abstract 7260: An HSV-1-based vector for local delivery of IL-12 and IL-2 reshapes the immune landscape leading to tumor clearance and systemic immune surveillance

Abstract Clinical use of recombinant interleukin (IL)-12 and -2 therapy has been hindered due to unfavorable kinetics and toxicity associated with systemic exposure. Durable targeted delivery to the tumor microenvironment (TME) is a promising therapeutic strategy to overcome these clinical limitations, prompting the development of KB707, a replication-defective herpes simplex virus type 1 (HSV-1)-based vector encoding human IL-12 and -2, for the treatment of solid tumors. Prior studies in mice demonstrated that local vector-encoded cytokine administration enhanced murine IL-12/IL-2 expression while limiting systemic exposure compared to conventional protein therapy. In a syngeneic, B16-F10 melanoma mouse model, intratumoral murine KB707-equivalent treatment led to improved survival in a unilateral tumor model and an abscopal effect in a bilateral tumor model. Additionally, the majority of previously treated animals survived rechallenge with B16-F10 in the absence of further therapy, indicative of systemic anti-tumor immune memory. Together, these results suggested that vector-mediated delivery of IL-12 and -2 could elicit both local and systemic anti-tumor immune responses. To elucidate the underlying changes to the immune landscape, B16-F10 tumor-bearing animals were treated intratumorally with vector or vehicle control on day 0 and were sacrificed on day 7; a second cohort of tumor-bearing animals received two vector doses (days 0 and 7) and were sacrificed on days 8, 10, 12, or 14. Immune cell profiling of samples taken from the tumor, tumor draining lymph node (dLN), spleen, and whole blood were analyzed by flow cytometry, and serum cytokine analysis was conducted by multiplex ELISA. Flow cytometric analysis of tumors revealed that vector treatment resulted in increased frequencies of proliferating and activated effector CD8+ and CD4+ T cells, peaking 24 hours post-second dose. These results correlated with high levels of the proinflammatory cytokines IFNγ and TNFα in the serum of vector recipient animals. The blood, spleens, and dLNs also showed increased frequencies of activated effector CD8+ and CD4+ T cells, peaking 24-72 hours post-second dose. Interestingly, although IL-2 alone has been shown to promote immune suppression and tumor outgrowth by mediating regulatory T cell (Treg) expansion and infiltration in certain contexts, the frequency of Tregs in treated vs. control tumors was substantially reduced after first and repeat dosing. Together, these results support a mechanism by which vector-driven local expression of IL-12 and IL-2 can expand and activate effector T cells both in the TME and systemically while simultaneously repressing Tregs, consistent with the previously described inhibition of primary tumor outgrowth, abscopal effects on secondary tumors, and prevention of recurrence observed with this therapeutic approach. Citation Format: Dana M. Previte, Trevor J. Parry, Suma M. Krishnan. An HSV-1-based vector for local delivery of IL-12 and IL-2 reshapes the immune landscape leading to tumor clearance and systemic immune surveillance [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 7260.

Abstract 5339: Establishment of a humanized IL5/IL5RA mouse model to evaluate modulators of eosinophilic inflammation in vivo

Abstract IL-5/IL-5R signaling plays a key role in the maturation, activation, survival, and recruitment of eosinophils to sites of inflammation. Targeting this pathway is an attractive therapeutic strategy for certain inflammatory diseases, such as asthma. Here, we generated a novel humanized IL5/IL5RA model (B-hIL5/hIL5RA) to examine the utility of human IL-5/IL5R-targeting therapeutic candidates. Specifically, the entire murine Il5 coding region was replaced by the corresponding human IL5 sequence, and the human IL5RA sequence coding the extracellular domain was inserted to replace the corresponding murine sequence. Successful generation of the model was confirmed by expression of human IL-5 by ELISA and IL5RA by flow cytometry. Furthermore, the proportion of eosinophils in the blood of B-hIL5/hIL5RA mice increased after stimulation with human IL5 recombinant protein, indicating that the humanized IL5RA protein is functional. Next, the ability of the humanized mice to establish asthma-like disease was tested using ovalbumin: following a 14 day sensitization period, mice were challenged with nebulized OVA daily from day 21 until the endpoint; treatment with mepolizumab or benralizumab analog was performed. Flow cytometric analysis of the bronchioalveolar fluid indicates that treatment with mepolizumab or benralizumab analog significantly lowered the number of eosinophils when compared to the isotype control in homozygous B-hIL5/hIL5RA mice. Blood counts and quantification of lung H&E sections also confirm that the treatments lowered the number of eosinophils in circulation and lung tissue, respectively. Taken together, these data indicate that B-hIL5/hIL5RA mice are a suitable preclinical model to test novel modulators of human IL-5/IL-5RA signaling. Citation Format: Suman Zhao, Shujin Zhang, Zhen Chen, Liya Yang, Mari Kuraguchi, Jiangfeng Yuan, Heiling Shen. Establishment of a humanized IL5/IL5RA mouse model to evaluate modulators of eosinophilic inflammation in vivo [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 5339.

Abstract 6653: Oncolytic virotherapy induces a long-term immune antitumoral response leading to glioma eradication

Abstract Oncolytic herpes simplex viruses (oHSVs) have shown promise as effective treatments against various cancers. Our study evaluated the efficacy of R-115, an oHSV retargeted to human Her2 (hHer2), fully virulent in its target cells and expressing murine interleukin 12 (mIL12), in a high-grade, immunocompetent murine glioma model. This model is based on orthotopically transplant of cells derived from PDGFB-induced primary gliomas in syngeneic mice, engineered to express hHer2. Our experimental design compared the impact of R-115 on gliomas where all cells expressed hHer2 against a setup where only about 50% of cells expressed hHer2. The latter aimed to replicate the heterogeneity of patient’s high-grade gliomas, where not all cells express the target molecule. Strikingly, results in terms of overall survival and tumor eradication were similar in both setups, with about a quarter of animals showing complete glioma eradication. This suggests that mIL12-armed oHSV's impact is less about direct viral-induced cell death and more about the immune response elicited by the mIL12-expressing virus. This response effectively targets cells lacking the viral-targeted protein but likely sharing other neoantigens with hHer2-positive cells. Mice cured in both experimental setups were rechallenged with purely hHer2-negative cells. Almost all did not develop gliomas, indicating a strong immune response capable of rejecting the tumor. Plasma analysis revealed that R-115-treated mice from both setups were more immunoreactive against both hHer2-positive and negative cells compared to untreated mice. Further, co-culturing long-surviving mice's splenocytes with glioma cells showed increased cell division in CD8, CD4 and CD19 populations, and elevated IFN-γ, granzyme B, and TNF-α production. These findings underscore R-115's profound anti-cancer potential, especially its capacity to elicit an immune response effective against glioma cells, irrespective of their expression of the target molecule. This outcome, coupled with the results of the rechallenge experiments, is pivotal. It suggests that in a clinical context, an interleukin-12-expressing oHSV could effectively target not only residual cells post-surgical resection but also infiltrating cells that are distant from the site of virus administration. Encouraged by these promising findings, we are currently advancing our research with a novel oHSV that expresses mIL12 and targets EGFRvIII, a mutation found exclusively in tumor cells. This is aimed at enhancing the safety and translatability of this therapeutic approach. Citation Format: Francesca Piaggio, Francesco Alessandrini, Chiara Riviera, Irene Appolloni, Davide Ceresa, Daniela Marubbi, Tatiana Gianni, Gabriella Campadelli-Fiume, Paolo Malatesta. Oncolytic virotherapy induces a long-term immune antitumoral response leading to glioma eradication [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 6653.

Abstract 4057: Beyond IL-2: The promise of anti PD-1-attenuated IL-2 fusion protein in cancer immunotherapy

Abstract PD1+ CD8+ tumor-infiltrating T-cells have been at the forefront of cancer immunotherapies due to their antigen-specificity, cytotoxicity, proliferative capacity, and stem-like/memory properties. IL-2 is essential for T cell growth and proliferation, however, its systemic administration at a high dose was associated with intolerable toxicities, while low-dose treatment contradicted the intended therapeutic effect by activating regulatory T cells.To overcome the limitations of IL-2, we fused modified IL-2 sequences with reduced affinity for the murine IL-2 receptor to a PD1 antibody designed to target the PD1+ T cells found in tumors. The resulting murine PD1 antibody-attenuated-IL-2 (mAnti-PD1-IL2Att) demonstrated similar IL-2 potency on PD1+ cells as native IL-2, but diminished potency by orders of magnitude on PD1- cells. The agent was furthermore designed to bind PD1 non-competitively with known PD1-blocking antibodies, so that it could be used in combination with them to achieve effective anti-tumor response. We demonstrated that mAnti-PD1-IL2Att exhibits potent anti-tumor activity, resulting in complete tumor regression in a syngeneic MC38 colorectal cancer model, and significant anti-tumor activity in other models of different tumor types. The mechanism was evaluated by immunophenotyping and single-cell RNAseq. Shortly after the first administration of mAnti-PD1-IL2Att, CD8+ T cells, rather than Tregs, emerged as the primary responding cells; these CD8+ T cells exhibited increased proliferation and activation with reduced expression of exhaustion markers (PD1+Tim3+). Following subsequent doses, there was a notable increase in the number of effector cells, followed by a prolonged generation of effector and memory cells at a later stage. Myeloid cells exhibited increased transcriptional programs related to chemotaxis, co-stimulation, and co-inhibition, including the upregulation of the PD1-PDL1 pathway. By contrast, blockade of PD1 with a naked PD1 antibody led to distinct cellular responses and less pronounced anti-tumor activity, and a combination of the blocking antibody with PD1-attIL-2 was superior to either agent alone. Together, our findings suggest that mAnti-PD1-IL2Att potent anti-tumor activity was driven by its direct targeting of PD1+ on tumor-infiltrating CD8+ T-cells, shedding light on the specific changes in their dynamic differentiation trajectory and their impact on the tumor microenvironment. Citation Format: Sarah Amar, Yulia Liubomirski, Eilam Yeini, Michael Monsonego, Tomer Weiss, Galia Tiram, Anshika Katyal, Opal Avramoff, Anne Krinsky, Keren Reshef, Shai Dulberg, Ayelet Kaminitz, Dana Bar On, Inbal Ben Eliezer, Ortal Iancu, Tetsuya Taura, David Wilson, Paul Ayton, Ronit Satchi-Fainaro, Asaf Madi. Beyond IL-2: The promise of anti PD-1-attenuated IL-2 fusion protein in cancer immunotherapy [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 4057.

Abstract 3740: Tusamitamab ravtansine induces immunogenic cell death and synergizes with anti-PD-1 or anti-PD-L1 antibody combination in solid tumor

Abstract Tusamitamab ravtansine (SAR408701) is an antibody-drug conjugate (ADC) targeted to carcino-embryonic antigen-related cell adhesion molecule 5 (CEACAM5) and delivering DM4, a maytansinoid cytotoxic. CEACAM5 is highly expressed in several tumor types, including non-squamous non-small cell lung cancer (NSQ NSCLC). It is currently being evaluated in patients with advanced CEACAM5-positive NSQ NSCLC, in a phase II study in combination with pembrolizumab, and a phase III trial as single agent in comparison with docetaxel. Preclinical investigations were performed to determine whether SAR408701 could be beneficially combined with immune checkpoint inhibitors. We, first, demonstrated that the tusamitamab ravtansine payload, DM4, is able to induce robust immunogenic cell death (ICD) using an in vivo vaccination assay. In this assay, immunocompetent mice were “vaccinated” by DM4-treated CT26 cells and then later rechallenged with CT26 tumor cells. Tumor rejection was observed in more than 50% of “vaccinated” mice. The ICD was characterized by the expression or release of danger-associated molecular patterns (DAMPs), and we observed DAMP modulation such as calreticulin (CRT) exposure at the cell surface of dying tumor cells, and the release of the High-Mobility Group Box 1 (HMGB1) in the extracellular space by CT26 cells in response to DM4 treatment. We also showed that DM4-treated CT26 tumor cells implanted into mice or SAR408701 treatment of MC38 tumor-bearing mice induced an elevation of plasmatic level of murine IL-6 and INFγ, revealing potential antitumor immunity modulation by the ADC and its payload. Immunohistochemistry analysis of MC38 tumors also revealed that tusamitamab ravtansine treatment induced a dose-dependent increase of CD8 T-cell infiltration in tumors correlating to dose-dependent efficacy. Finally, tusamitamab ravtansine was combined with immune checkpoint inhibitors (ICIs) in immunocompetent mice bearing MC38 tumor model. In this model, the combination of tusamitamab ravtansine with anti-PD-1 or anti-PD-L1 antibody led to complete response and, even, tumor-free survivors at 120 days post tumor implantation while single agents were inactive or transiently active. In summary, these preclinical data show that tusamitamab ravtansine could be beneficially combined with immune checkpoint and strongly support their evaluation in clinical development. Citation Format: Celine Nicolazzi, Anne-Marie Lefebvre, Nicolas Moindrot, Christelle Larois, Marion Classe, Sukhvinder Sidhu. Tusamitamab ravtansine induces immunogenic cell death and synergizes with anti-PD-1 or anti-PD-L1 antibody combination in solid tumor [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 3740.

Abstract 7478: Unveiling the role of two-pore channel 2 (TPC2) in cancer immunity from monocyte differentiation to cytokine production

Abstract Background: The study of TPC2 is of great interest in the field of cancer and immune diseases, as it plays a crucial role in various cellular processes, and there is substantial evidence that TPC2 sustains several cancer hallmarks (angiogenesis, autophagy, and metastasis). The expression and role of TPC2 and its relevance to cancer in the innate immune system remain unknown. Methods: U937 TPCN2 knockdown (KD) cells were developed by nucleofection-based transfection of CRISPR-Cas9 gene editing tools. sgRNA (single guide RNA): CGUGCUGGUGAGUGAGGAUG was designed to target the fourth exon of the TPCN2 gene (Transcript ID: ENST00000294309). The model was used in tandem with pharmacological modulators of TPC2 channel activity to underpin its function in monocyte differentiation, macrophage development, and IL-8 production. Molecular biology techniques, including Sanger sequencing, qPCR, ELISA, and WB, were utilized. Proteins of murine TPC2 WT and TPC2 KO cells were extracted and sent to the Discovery Proteomics Facility of the Target Discovery Institute for label-free quantification and proteomics analysis using mass spectrometry. Results: We developed TPC2-deficient human monocytes (U937 cells) with a 75% reduction in TPCN2 expression levels, and we demonstrated that TPCN2 genetically modified U937 monocytes were resistant to monocyte differentiation after treatment with increasing concentrations of PMA ranging from 100 ng/mL to 400 ng/mL. TPC2-deficient U937 monocytes were not differentiated into Mϕ. TPC2 acts as a major regulator of monocyte differentiation by modulating PKC-alpha via calpain. In addition, the levels of IL-8 were significantly reduced after treating U937 cells with Ned 19 (an NAADP antagonist) or TPC2 KD. Keratinocyte-derived chemokine (KC) and Macrophage inflammatory protein-2 (MIP-2) are the murine IL-8 homologues. Notably, the levels of MIP-2, but not KC, were significantly reduced in the TPC2 KO murine cells compared to the WT controls. Thus, TPC2 appears to be involved in IL-8 secretion in both humans and mice. In contrast to KC at the protein level, the KC expression level was significantly reduced in TPC2-deficient murine cells. TPC2 in EE/RE is involved in lipopolysaccharide (LPS)-mediated IL-8 production in U937 cells. TPC2 modulates immune targets involving CD38, PKC-alpha, and AKT.We found that 28 different proteins that play roles in cancer immunity showed significant changes in expression in TPC2-deficient murine cells (three overexpressed proteins and 25 down-expressed proteins), compared to WT. Conclusion: Our data provide the first preclinical proof of concept for TPC2 as a potential target for blocking macrophage development and modulating CD38/IL8 levels as therapeutic strategies for cancer patients, raising questions regarding the clinical utility of TPC2 as a biomarker or immunotherapy target to modulate immune responses. Citation Format: Abeer Alharbi, John Parrington. Unveiling the role of two-pore channel 2 (TPC2) in cancer immunity from monocyte differentiation to cytokine production [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 7478.

Riboswitch-controlled IL-12 gene therapy reduces hepatocellular cancer in mice.

Hepatocellular carcinoma (HCC) and solid cancers with liver metastases are indications with high unmet medical need. Interleukin-12 (IL-12) is a proinflammatory cytokine with substantial anti-tumor properties, but its therapeutic potential has not been realized due to severe toxicity. Here, we show that orthotopic liver tumors in mice can be treated by targeting hepatocytes via systemic delivery of adeno-associated virus (AAV) vectors carrying the murine IL-12 gene. Controlled cytokine production was achieved in vivo by using the tetracycline-inducible K19 riboswitch. AAV-mediated expression of IL-12 led to STAT4 phosphorylation, interferon-γ (IFNγ) production, infiltration of T cells and, ultimately, tumor regression. By detailed analyses of efficacy and tolerability in healthy and tumor-bearing animals, we could define a safe and efficacious vector dose. As a potential clinical candidate, we characterized vectors carrying the human IL-12 (huIL-12) gene. In mice, bioactive human IL-12 was expressed in a vector dose-dependent manner and could be induced by tetracycline, suggesting tissue-specific AAV vectors with riboswitch-controlled expression of highly potent proinflammatory cytokines as an attractive approach for vector-based cancer immunotherapy.

A194 EARLY LIFE WESTERN-TYPE DIET ACCELERATES THE ONSET OF MURINE IL-10 KO COLITIS

Abstract Background Early life is a critical time for gut microbiome and immune development, including the establishment of proper host-microbe interactions. While exposures to western world environmental factors are associated with inflammatory bowel disease (IBD) susceptibility, the link between environment in early life and later disease onset is unclear. One of the most important western world environmental factors is diet, which can distinctly alter the gut microbiome. We believe an early life western-type diet (WD) can affect disease progression in a murine IL-10 KO colitis model through dysregulated T-cell responses against the microbiome. Aims We aimed to characterize how an early life WD given to IL-10 KO mice would affect colitis development and the gut microbiome. Methods IL-10 KO mice were housed in specific pathogen free conditions and fed normal chow (NC) or WD ad libitum, either between days 10 to 35 (early WD, eWD) or days 35 to 60 (adolescent WD, aWD). Stool was collected from mice at days 35, 56, and 84 for lipocalin-2 (LCN-2) and 16S rDNA sequencing. Mice were sacrificed at day 84, assessing mesenteric lymph node weight, gene expression, colon damage by histopathology, and colon lamina propria leukocyte (LPL) phenotype and cytokine expression by flow cytometry. Results Compared to NC and aWD, the eWD fed IL-10 KO mice displayed increased fecal LCN-2 at days 56 and 84, indicating greater inflammation. At sacrifice, eWD fed mice had larger mesenteric lymph nodes and more significant colon damage by histopathological scoring. Colon LPL preparations showed that eWD fed IL-10 KO mice had higher proportions and absolute numbers of effector and regulatory T-cells. Additionally, higher proportions and absolute numbers of those T-cells were IFNγ+, IL-17A+, and IL-22+. qPCR of distal colon tissue revealed increased gene expression of innate and type 3 proinflammatory cytokines such as Il1b, Tnfα, and Il23, while showing no change in Il6 and Il4. Taxa positively associated with WD were able to establish a persistent niche in eWD fed mice but not in aWD fed mice. An increase in only one specific taxon was associated with eWD at all timepoints while also most strongly correlating with inflammatory markers. Conclusions This data suggests that eWD feeding during gut microbiome and immune development is uniquely capable of increasing long-term susceptibility to intestinal inflammation in IL-10 KO mice. This appears to be associated with persistent colonization of potentially more inflammatory taxa. This work provides insight into the potential role of early life environmental risk factors, i.e. WD, in the later development of IBD. Funding Agencies CAG, CIHRUniversity of Toronto, Taconic Biosciences

PRMT2 silencing regulates macrophage polarization through activation of STAT1 or inhibition of STAT6

BackgroundMacrophages play significant roles in innate immune responses and are heterogeneous cells that can be polarized into M1 or M2 phenotypes. PRMT2 is one of the type I protein arginine methyltransferases involved in inflammation. However, the role of PRMT2 in M1/M2 macrophage polarization remains unclear. Our study revealed the effect and mechanism of PRMT2 in macrophage polarization.MethodsBone marrow-derived macrophages (BMDMs) were polarized to M1 or M2 state by LPS plus murine recombinant interferon-γ (IFN-γ) or interleukin-4 (IL-4). Quantitative polymerase chain reaction (qPCR), western blot and flow cytometry (FCM) assay were performed and analyzed markers and signaling pathways of macrophage polarization.ResultsWe found that PRMT2 was obviously upregulated in LPS/IFN-γ-induced M1 macrophages, but it was little changed in IL-4-induced M2 macrophages. Furthermore, PRMT2 konckdown increased the expression of M1 macrophages markers through activation of STAT1 and decreased the expression of M2 macrophages markers through inhibition of STAT6.ConclusionsPRMT2 silencing modulates macrophage polarization by activating STAT1 to promote M1 and inhibiting STAT6 to attenuate the M2 state.

Abstract A141: Preclinical pharmacokinetic (PK) and tumor growth inhibition (TGI) modeling for mANK-101, an anchored murine interleukin-12 (IL-12) complex for intratumoral administration for solid cancer

Abstract Introduction – Murine ANK-101 (mANK-101) is a stable complex composed of a modified murine IL-12 cytokine with aluminum hydroxide at a 1:10 ratio designed for intratumoral delivery to established solid cancers. The objective of this work was to build a preclinical PK/PD/TGI model to gain a better mechanistic understanding of the pharmacology of mANK-101 and potential impact on therapeutic efficacy. Methods - Data were collected from in vivo studies measuring PK, intratumoral immune cells and tumor growth inhibition (TGI) in a CT26 syngeneic mouse model treated with mANK-101. A PK model was derived from Momin et al. [1], the surrogacy potential of immune cells was assessed via a statistical model and subsequently a mathematical model linking immune cell activation to TGI was developed. Results – A two-compartment PK model was established to take into account both the intratumoral depot effect of mANK-101 and the release into the peripheral circulation for mIL12 from the mANK-101 complex. CD8+ T-cell infiltration was found to be a surrogate biomarker for anti-tumor activity and was subsequently used to link PD-TGI. The model was able to capture various doses and schedules of mANK-101 at different starting tumor volumes on therapeutic responses. Conclusions – A PK-PD-TGI model was developed that links the release of mIL12 from mANK-101 to immune cell-activation through to tumor growth inhibition thus providing a causal understanding of the mechanism of action. The model could potentially form the basis of a translational model to assist in designing first-in-man dose and schedule.

Bioconjugation of a Fibroblast Activation Protein Targeted Interleukin-4.

Interleukin-4 (IL-4) is an immune-modulating therapeutic with growing potential for the treatment of inflammatory diseases. Current challenges of IL-4 therapy include a low serum half-life and pleiotropic activity, suggesting effective targeting of IL-4. To develop an interleukin-4 bioconjugate with rapid targeting to inflammatory disease sites, we report the chemical synthesis, bioconjugation, and in vitro characterization of a murine interleukin-4 (mIL-4) conjugate decorated with a fibroblast activation protein inhibitor (FAPI). The FAPI targeting moiety features 2,2',2″,2‴-(1,4,7,10-tetraazacyclododecane-1,4,7,10-tetrayl)tetraacetic acid (DOTA) to allow future biodistribution and imaging studies of the FAPI-mIL-4 bioconjugate. We demonstrated site-specific coupling of mIL-4 and FAPI-DOTA deploying chemo-enzyme and enzyme chemistries with a high purity exceeding 95%. The FAPI-DOTA modified mIL-4 was bioactive with polarization of murine macrophages into the M2 state while maintaining specific binding to FAP on fibroblast cells. Together, these results point to future in vivo use of the FAPI-mIL-4 bioconjugate to assess biodistribution and biological effects in animal models of inflammatory joint disease.

Study on the Mechanism of Eerdun Wurile's Effects on Post-operative Cognitive Dysfunction by the TLR4/NF-κB Pathway.

The object of our work was to observe whether the Mongolian medicine Eerdun Wurile (EW) improve postoperative cognitive dysfunction (POCD) by affecting the TLR4/NF-κB. Mice (6-8-week-old male C57BL/6J) were selected to establish an animal model of POCD by combining intracerebroventricular injection of lipopolysaccharide and nephrectomy; EW formulation and EW basic formulation were administered intra-gastrically for 7 consecutive days. The cognitive performance was assessed by Morris water maze test. H&E staining was examined to detect alterations in hippocampal tissue. Immunohistochemical staining was performed to evaluate MyD88, NF-κB, TLR4, iNOS, and IBA-1 expressions; Western blotting and RT-qPCR were performed to evaluate MyD88, NF-κB, and TLR4. The expressions of IL-6, IL-1β, and TNF-α were evaluated by ELISA. Intracerebroventricular injection of lipopolysaccharide combined with nephrectomy induced cognitive dysfunction in mice, stimulated TLR4/NF-κB and microglia, and promoted the secretion of murine TNF-α, IL-1β, and IL-6. EW formulation and EW basic formulation treatment are able to suppress the TLR4/NF-κB pathway activation and microglia, and the serum cytokine secretions related to proinflammation, and restore the cognitive performance. EW formulation and EW basic formulation can improve POCD in mice, and TLR4/NF-κB pathway seems to be one of the important mechanisms in EW's improvement of POCD.

Intratumoral injection of IL-12-encoding mRNA targeted to CSF1R and PD-L1 exerts potent anti-tumor effects without substantial systemic exposure

IL-12 is a potent cytokine for cancer immunotherapy. However, its systemic delivery as a recombinant protein has shown unacceptable toxicity in the clinic. Currently, the intratumoral injection of IL-12-encoding mRNA or DNA to avoid such side effects is being evaluated in clinical trials. In this study, we aimed to improve this strategy by further favoring IL-12 tethering to the tumor. We generated invitro transcribed mRNAs encoding murine single-chain IL-12 fused to diabodies binding to CSF1R and/or PD-L1. These targeted molecules are expressed in the tumor microenvironment, especially on myeloid cells. The binding capacity of chimeric constructs and the bioactivity of IL-12 were demonstrated invitro and invivo. Doses as low as 0.5μg IL-12-encoding mRNA achieved potent antitumor effects in subcutaneously injected B16-OVA and MC38 tumors. Treatment delivery was associated with increases in IL-12p70 and IFN-γ levels in circulation. Fusion of IL-12 to the diabodies exerted comparable efficacy against bilateral tumor models. However, it achieved tethering to myeloid cells infiltrating the tumor, resulting in nearly undetectable systemic levels of IL-12 and IFN-γ. Overall, tethering IL-12 to intratumoral myeloid cells in the mRNA-transferred tumors achieves similar efficacy while reducing the dangerous systemic bioavailability of IL-12.