mtDNA Concentration Research Articles

Utilization of qPCR to Determine Duration and Environmental Drivers Contributing to the Persistence of Human DNA in Soil.

Little is known about the underlying mechanisms that contribute to the persistence and degradation of DNA within soil. The goals of this study are to determine the duration of mitochondrial DNA (mtDNA) and nuclear DNA (nuDNA) persistence in soils enriched by surface-level human decomposition and to better understand the contribution of environmental factors. The surface-level decomposition of three human cadavers was documented over 11 weeks. Based on quantitative PCR results, we found nuDNA to persist in soils six weeks post-placement, while mtDNA was recoverable for the entire 11-week decomposition period. Principle components analyses and Spearman's rank correlations revealed that (1) time, (2) total body score, and (3) weekly average air temperature were significantly correlated with concentrations of nuDNA and mtDNA in soil, suggesting these factors play a role in the degradation of DNA in soils.

Plasma Mitochondrial DNA Clearance by Continuous Venovenous Haemofiltration in Critically Ill Patients

ObjectiveMitochondrial DNA (mtDNA) reportedly has diagnostic and predictive value in critically ill patients. This study evaluated the diagnostic and predictive value of mtDNA in patients undergoing continuous venovenous haemofiltration (CVVH).MethodsWe consecutively enrolled 41 patients who were treated with CVVH from September 2018 to December 2019. Prefilter, postfilter, and ultrafiltrate samples were collected before the initiation of CVVH (T0) and 6 and 12 h after CVVH. The total mass removal rate (Mtr), total mass adsorption rate (Mad), plasma clearance (PC), and sieving coefficient (SC) were calculated based on the mass conservation principle.ResultsThe plasma mtDNA concentration in patients at T0 prefilter was higher than that in healthy volunteers [13.77 (12.45–15.86) vs. 1.24 (1.15–1.34) ng/mL, P < 0.001]. Prefilter, but not postfilter or ultrafiltrate, mtDNA decreased during CVVH (P = 0.02), with a total CVVH clearance of 25.9%. The postfilter and ultrafiltrate mtDNA levels were lower than the prefilter level at each time point (P < 0.05 for all). The Mtr, Mad, PC, and SC did not change over time (P > 0.05 for all).ConclusionsPlasma mtDNA in critically ill patients was significantly affected by CVVH.Trial registration: Retrospectively registered on 20 August 2019 at ClinicalTrials.gov (NCT04083482).

Cerebrospinal fluid mtDNA concentrations are increased in multiple sclerosis and were normalized after intervention with autologous hematopoietic stem cell transplantation

BackgroundMitochondrial DNA (mtDNA) is a pro-inflammatory damage-associated molecular pattern molecule and could be an early indicator for inflammation and disease activity in MS. Autologous hematopoietic stem cell transplantation (aHSCT) is a potent treatment for MS, but its impact on mtDNA levels in cerebrospinal fluid (CSF) remains unexplored. ObjectivesTo verify elevated CSF mtDNA concentrations in MS patients and assess the impact of aHSCT on mtDNA concentrations. MethodsMultiplex droplet digital PCR (ddPCR) was used to quantify mtDNA and nuclear DNA in 182 CSF samples. These samples were collected from 48 MS patients, both pre- and post-aHSCT, over annual follow-ups, and from 32 healthy controls. ResultsCSF ccf-mtDNA levels were higher in patients with MS, correlated to multiple clinical and analytical factors and were normalized after intervention with aHSCT. Differences before aHSCT were observed with regard to MRI-lesions, prior treatment and number of relapses in the last year prior to aHSCT. ConclusionOur findings demonstrate elevated CSF mtDNA levels in MS patients, which correlate with disease activity and normalize following aHSCT. These results position mtDNA as a potential biomarker for monitoring inflammatory activity and response to treatment in MS.

Circulating Mitochondrial DNA Is Associated With High Levels of Fatigue in Two Independent Sarcoidosis Cohorts

Patients with sarcoidosis who develop severe clinical phenotypes of pulmonary fibrosis or multiorgan disease experience debilitating symptoms, with fatigue being a common chief complaint. Studies that have investigated this patient-related outcome measure (PROM) have used the Fatigue Assessment Scale (FAS), a self-reported questionnaire that reflects mental and physical domains. Despite extensive work, its cause is unknown and treatment options remain limited. Previously, we showed that the plasma of patients with sarcoidosis with extrapulmonary disease endorsing fatigue was enriched for mitochondrial DNA (mtDNA), a ligand for the innate immune receptor toll-like receptor 9 (TLR9). Through our cross-disciplinary platform, we investigated a relationship between sarcoidosis-induced fatigue and circulating mtDNA. Is there a psychobiologic mechanism that connects sarcoidosis-induced fatigue and mtDNA-mediated TLR9 activation? Using a local cohort of patients at Yale (discovery cohort) and the National Institutes of Health-sponsored Genomic Research in Alpha-1 Antitrypsin Deficiency and Sarcoidosis study (validation cohort), we scored the FAS and quantified in the plasma, mtDNA concentrations, TLR9 activation, and cytokine levels. Although FAS scores were independent of corticosteroid use and Scadding stage, we observed a robust association between FAS scores, which included mental and physical domains, and multiorgan sarcoidosis. Subsequently, we identified a significant correlation between plasma mtDNA concentrations and all domains of fatigue. Additionally, we found that TLR9 activation is associated with all aspects of the FAS and partially mediates this PROM through mtDNA. Last, we found that TLR9-associated soluble mediators in the plasma are independent of all facets of fatigue. Through our cross-disciplinary translational platform, we identified a previously unrecognized psychobiologic connection between sarcoidosis-induced fatigue and circulating mtDNA concentrations. Mechanistic work that investigates the contribution of mtDNA-mediated innate immune activation in this PROM and clinical studies with prospective cohorts has the potential to catalyze novel therapeutic strategies for this patient population and those with similar conditions.

227 Investigating the Use of Flavin Mononucleotide &amp; Cell Free Mitochondrial DNA as a Biomarkers of Ischaemic Damage to Livers &amp; Kidneys Before Transplant Surgery

Abstract Aim Before accepting an organ for transplantation, it is important to ensure it is safe to use. Flavin mononucleotide (FMN) has been demonstrated to be an accurate predictor of 90-day graft loss in liver transplant surgery. Previous studies revealed that cell free mitochondrial DNA (cf mtDNA) is predictive of ischemic acute kidney injury in kidney transplantation. There is no validated scoring system or biomarker in clinical use to aid the decision-making process before transplantation. Consequently, transplant surgeons accept or decline organs based on their clinical judgement. There is a need for an objective method to assess organ quality before transplantation. Method Patient consent and demographics were noted prior to transplant surgery. Perfusion solution was flushed through donor livers or kidneys. FMN concentration was measured by fluorescence spectroscopy and cf mtDNA concentration was measured by digital droplet polymerase chain reaction. The concentrations of FMN and cf mtDNA were correlated with donor age &amp; BMI and total length of recipient intensive treatment unit (ITU) stay. Results Amongst 8 transplanted livers, the study showed a negative trend between donor BMI and both FMN &amp; cf mtDNA. There was a strong correlation between FMN concentration and ITU duration (r = 0.7353, p = 0.0376). Amongst 14 transplanted kidneys, MT-ND6 subunit concentration strongly correlated with donor BMI (r = 0.8473, p = 0.0003). Conclusions Despite more research being required to consolidate the role of these biomarkers, the study reinforces the idea that FMN and cf mtDNA can play a role as point of care tests in assessing organ quality prior to transplantation.

Synovial fluid mitochondrial DNA concentration reflects the degree of cartilage damage after naturally occurring articular injury

To evaluate mitochondrial DNA (mtDNA) release from injured chondrocytes and investigate the utility of synovial fluid mtDNA concentration in early detection of posttraumatic osteoarthritis. We measured mtDNA release using four models of osteoarthritis: in vitro interleukin-1β stimulation of cultured equine chondrocytes, ex vivo mechanical impact of bovine cartilage explants, in vivo mechanical impact of equine articular cartilage, and naturally occurring equine intraarticular fracture. In our in vivo model, one group was treated with an intraarticular injection of the mitoprotective peptide SS-31 following cartilage injury. mtDNA content was quantified using qPCR. For naturally occurring cases of joint injury, clinical data (radiographs, arthroscopic video footage) were scored for criteria associated with degenerative joint disease. Chondrocytes released mtDNA in the acute time frame following inflammatory and mechanical cellular stress in vitro. mtDNA was increased in equine synovial fluid following experimental and naturally occurring injury to the joint surface. In naturally occurring posttraumatic osteoarthritis, we found a strong positive correlation between the degree of cartilage damage and mtDNA concentration (r=0.80, P=0.0001). Finally, impact-induced mtDNA release was mitigated by mitoprotective treatment. Changes in synovial fluid mtDNA occur following joint injury and correlate with the severity of cartilage damage. Mitoprotection mitigates increases in synovial fluid mtDNA suggesting that mtDNA release may reflect mitochondrial dysfunction. Further investigation of mtDNA as a potentially sensitive marker of early articular injury and response to mitoprotective therapy is warranted.

Succinate and mitochondrial DNA trigger atopic march from atopic dermatitis to intestinal inflammation

Atopic march has long been recognized as the progression from atopic dermatitis (AD) to food allergy and asthma during infancy and childhood. However, effective blocking is hampered by the lack of specific biomarkers. We aimed to investigate the pathologic progression of atopic march trajectories from skin to gut. We built an atopic march mouse model by mechanical skin injury and percutaneous sensitization to peanut allergen. Anaphylaxis from the skin to the small intestine was then investigated by ELISA, RNA sequencing, quantitative real-time PCR, histopathologic analysis, and flow cytometry. The findings from the mice results were also verified by the serum samples of allergic pediatric patients. After modeling, inflammation in the skin and small intestine manifested as a mixed type of TH2 and TH17. Further analysis identified elevated succinate in the circulation and expanded tuft cells with upregulated IL-25 in the small intestine, resulting in increased intestinal type 2 innate lymphoid cells and an enhanced type 2 inflammatory response. In addition, free mitochondrial DNA (mtDNA) released after tissue damage was also involved in inflammation march from injured skin to small intestine through the STING pathway. Analysis of clinical samples verified that serum concentrations of succinate and mtDNA were higher in AD allergic children than non-AD allergic children. Succinate and mtDNA play key roles in skin-to-gut cross talk during the atopic march from AD to food allergy, and can be considered as biomarkers for risk assessment or targets for atopic march prevention strategies.

Circulating cell-free mitochondrial DNA as a diagnostic and prognostic biomarker in chronic and late acute graft-versus-host disease in children

In an earlier study, we found that mitochondrialDNA(mtDNA) concentration is elevated in adults with chronic graft-versus-host disease (cGvHD), acting as an endogenous source of TLR9 agonists to augment B-cell responses. To validate this in children, we evaluated mtDNA plasma expression in a large pediatric cohort (ABLE/PBMTC 1202 study). Plasma cell-free mtDNA (cf-mtDNA) copy numbers were measured in 202 pediatric patients using quantitative Droplet Digital polymerase chain reaction (ddPCR). Two evaluations were performed: 1) before the onset of cGvHD or late acute graft-versus-host disease (aGvHD) at day 100 ± 14 days and 2) at the time of cGvHD onset compared with time-matched non-cGvHD controls. We found that cf-mtDNA copy numbers were not affected by immune reconstitution post-hematopoietic stem cell transplantation but were higher on day 100 before the onset of late aGvHD and at the onset of cGvHD. We found that cf-mtDNA was not impacted by previous aGvHD, but correlated with the early onset, NIH moderate/severe cGvHD, and did not correlate with other immune cell populations, cytokines, or chemokines but did with the metabolites spermine and taurine. Similar to adults, children have elevated plasma cf-mtDNA concentrations at the early onset of cGvHD, especially in NIH moderate/severe cGvHD, elevation with late aGvHD, and associated with metabolites involved in mitochondrial function.

α1 Adrenoreceptor antagonism mitigates extracellular mitochondrial DNA accumulation in lung fibrosis models and in patients with idiopathic pulmonary fibrosis.

Idiopathic pulmonary fibrosis is increasingly associated with nerve-driven processes and endogenous innate immune ligands such as mitochondrial DNA (mtDNA). Interestingly, a connection between these entities has not been explored. Here, we report that noradrenaline (NA) derived from the lung's adrenergic nerve supply drives α-smooth muscle actin (αSMA)-expressing fibroblast accumulation via mechanisms involving α1 adrenoreceptors and mtDNA. Using the bleomycin model, we compared ablation of the lung's adrenergic nerve supply with surgical adrenal resection and found that NA derived from local but not adrenal sources contributes to experimentally induced lung fibrosis and the emergence of an αSMA+ve fibroblast population expressing adrenoreceptor α-1D (ADRA1D). Therapeutic delivery of the α1 adrenoreceptor antagonist terazosin reversed these changes and suppressed extracellular mtDNA accumulation. Cultured normal human lung fibroblasts displayed α1 adrenoreceptors and in response to costimulation with TGFβ1 and NA adopted ACTA2 expression and extracellular mtDNA release. These findings were opposed by terazosin. Evaluation of a previously studied IPF cohort revealed that patients prescribed α1 adrenoreceptor antagonists for nonpulmonary indications demonstrated improved survival and reduced concentrations of plasma mtDNA. Our observations link nerve-derived NA, α1 adrenoreceptors, extracellular mtDNA, and lung fibrogenesis in mouse models, cultured cells, and humans with IPF. Further study of this neuroinnate connection may yield new avenues for investigation in the clinical and basic science realms.

Spatiotemporal changes in environmental DNA concentrations caused by fish spawning activity

Determining the timing and location of spawning is critical for the conservation and management of aquatic species. Environmental DNA (eDNA) analysis can be used to monitor fish spawning activity by detecting peaks in eDNA concentrations and nuclear DNA (nuDNA)/mitochondrial DNA (mtDNA) ratios; however, the duration and diffusion distance of high concentrations of eDNA produced by spawning activities in water bodies are still unknown, preventing us from making accurate and effective survey plans to monitor spawning activities. Using common carp as a target species, we conducted artificial spawning experiments to investigate the spatiotemporal changes in eDNA concentrations during spawning. The results showed that the nuDNA concentration, mtDNA concentration, and nuDNA/mtDNA ratio that were increased by spawning activity decreased at rates of 7.78 %, 5.22 %, and 2.56 %, respectively, per 0.1 h after reaching the peak. Data simulations were performed to estimate the probability of successful monitoring of carp spawning activity during repeated sampling at different times and distance intervals. The results showed that carp spawning activity over the past 24 h could be monitored by eDNA analysis. Additionally, when carp spawning activity occurs once, spawning activity can be successfully monitored by measuring the nuDNA concentration or the nuDNA/mtDNA ratio with a probability of approximately 50–75 % based on a sampling plan of sample collection every 100 m and every 24 h. Thus, the spawning activity of aquatic species can be estimated with high spatial and temporal accuracy using eDNA analysis.

Mitochondrial DNA Profiling in A Cohort of Antiretroviral Treated HIV Patients in Lagos, Nigeria: Assessment of Long-Term Effects of cART on Life Quality of PLWH

The use of combined antiretroviral therapy (cART) has turned HIV infection to a manageable condition, significantly reducing HIV-related morbidity and mortality globally. Risk of transmission has been substantially reduced in Africa where 67% of global infection is domiciled. However, long-term impact of cART on life quality of HIV patients elicits concern due to possible oxidative stress stimulus and accumulated toxicity. Mitochondrion, responsible for molecular metabolism in eukaryotes has been proposed as a marker for cellular dysfunction and ageing. Metabolic dysfunction due to accumulated oxidative stress may lead to mitochondrial DNA (mtDNA) mutation, protein alteration, and premature apoptosis leading to ageing. A cohort study comprising of 302 HIV infected persons receiving cART (Tenofovir, Lamivudine, Dolutegravir; TLD) at NIMR HIV reference clinic, and 113 healthy controls. Venous blood was collected in vacutainer tubes and plasma isolated. DNA extraction was done using NIMR-Biotech DNA Extraction kit, and mtDNA levels measured using SYBRGreen dye-based quantitative real-time PCR assay on Quant Studio 5. Primer sequences from human 12S ribosomal RNA with CCACGGGAAACAGCAGTGAT and CTATTGACTTGGGTTAATCGTGTGA as forward and reverse sequences respectively were used to amplify mtDNA locus. Melting curve was performed for every run to confirm successful amplification of targeted region. Total DNA from an immortalized Hela cell line, diluted in 10-fold serial dilutions, was used as standard curve. Plasma mtDNA levels were evaluated and data analyzed using IBM SPSS software (version 24). Among HIV infected individuals, 185 (88.1%) were female and mean age was 32±0.43 years while 36 (32%) and 27±0.57 years were female and mean age among controls, respectively. Mean CD4 count among HIV subjects was 427±29 cells/µl while 62.4% had less than 50 viral copies/ml. Majority of subjects (74.9%) were on first line cART while mean exposure to ART regimens was 4±0.3 years. No significant difference was observed between mtDNA concentration of HIV subjects (mean = 256±38 copies/µl) and healthy controls (mean: 247±72 copies/µl), neither among only HIV subjects, when stratified based on viral load or CD4 count. No association was observed between cell free (cf)-mtDNA and cART exposure among HIV patients. Lack of baseline information on initial cf-mtDNA among Africans was challenging in establishing that new ART regimens had enhanced recovery from mitochondrial-DAMP. There is need to continuously assess prolonged effect of cART to ensure good quality of life and healthy ageing for people living with HIV (PLWH).

Mitochondrial DNA as a Biomarker for Acute Central Serous Chorioretinopathy: A Case-Control Study.

BackgroundThe literature suggests that stress may play a pivotal role in the precipitation of acute central serous chorioretinopathy (CSC) because chorioretinal integrity can be affected by the psychosocial state of the patient, indicating the need for a biomarker. Not only physical stress but also psychological stress causes many types of physical disorders. However, little is known about the pathophysiology of stress-induced disease. The objective of this study was to investigate whether serum factors might be involved in the development of stress-induced ocular diseases.MethodsThis observational case series included 33 eyes of 33 consecutive patients with treatment-naïve acute CSC. Fifty eyes of 50 age-matched healthy volunteers were included in this study as non-CSC controls. Serum samples were collected from all participants, and the levels of mitochondrial DNA (mtDNA) were measured by quantitative real-time (RT)-PCR. Serum levels of high-mobility group box (HMGB) 1 and 8-hydroxy-2′-deoxyguanosine (8-OHdG), biological markers of acute/chronic inflammation and oxidative stress, were also measured. The relationships between serum mtDNA, 8-OHdG, and HMGB1 concentrations were investigated by multivariate regression analysis, alongside an assessment of clinical data.ResultsIn the treatment-naïve acute CSC group, the serum mtDNA levels (36.5 ± 32.4 ng/mL) were significantly higher than the levels in the control group (7.4 ± 5.9 ng/mL; p < 0.001). Serum levels of 8-OHdG and HMGB1 in treatment-naïve acute CSC patients measured 0.12 ± 0.08 ng/mL and 18.1 ± 35.0 ng/mL, respectively, indicating that HMGB1 levels were elevated in CSC compared with the control group. Multivariable regression analysis demonstrated that increased serum mtDNA levels were significantly associated with the height of serous retinal detachment.ConclusionWe showed serum mtDNA and HMGB1 level elevation and its relation to the clinical activities of CSC, indicating that serum mtDNA and HMGB1 could serve as biomarkers for the acute phase of the disease. The use of these biomarkers makes it possible to predict disease onset and determine disease severity.

Development and validation of a SYBR green-based mitochondrial DNA quantification method by following the MIQE and other guidelines

In forensic mitochondrial DNA (mtDNA) analysis, quantitative PCR (qPCR) is usually performed to obtain high-quality sequence data for subsequent Sanger or massively parallel sequencing. Unlike methods for nuclear DNA quantification using qPCR, a calibrator is necessary to obtain mtDNA concentrations (i.e., copies/µL). Herein, we developed and validated a mtDNA quantification method based on a SYBR Green assay by following MIQE [Bustin et al., Clin. Chem. 55 (2009) 611-22] and other guidelines. Primers were designed to amplify nucleotide positions 16,190–16,420 in hypervariable region 1 for qPCR using PowerUp SYBR Green and QuantStudio 5. The optimized conditions were 0.3 µM each primer and an annealing temperature of 60 °C under a 2-step cycling protocol. K562 DNA at 100 pg/µL was converted into a mtDNA concentration of 16,400 copies/µL using linearized plasmid DNA. This mtDNA calibrator was obtained by cloning the synthesized DNA fragments of mtDNA (positions 16,140–16,470) containing a 100-bp inversion. The linear dynamic range of the K562 standard curve was 10,000–0.1 pg/µL (r2 ≥ 0.999). The accuracy was examined using NIST SRM 2372a, and its components A, B, and C were quantified with differences of −29.4%, −35.0%, and −22.0%, respectively, against the mtDNA concentrations calculated from published NIST data. We also examined the specificity of the primers, stability of the reaction mix, precision, tolerance against PCR inhibitors, and cross-reactivity against DNA from various animal taxa. Our newly developed mtDNA quantification method is expected to be useful for forensic mtDNA analysis.

MtDNA-Specific Ultrasensitive Near-Infrared Fluorescent Probe Enables the Differentiation of Healthy and Apoptotic Cells.

Mitochondrial DNA (mtDNA) as a class of important genetic material is easily damaged, which can result in a series of metabolic diseases, hereditary disease, and so on. mtDNA is an ultrasensitive indicator for the health of living cells due to the extremely short physiological response time of mtDNA toward damage (ca. 5.0 min). Therefore, the development of specific ultrasensitive fluorescent probes that can in real-time monitor mtDNA in vivo are of great value. With this research, we developed a near-infrared twisted intramolecular charge transfer (TICT) fluorescent probe YON. YON is a thread-like molecule with an A-π-D-π-A structure, based on the dicyanoisophorone fluorophore. The molecular design of YON enabled the specific binding with dsDNA (binding constant (K) = 8.5 × 105 M-1) within 1.3 min. And the appropriate water-oil amphiphilicity makes YON significantly accumulate in the mitochondria, enabling the specific binding to mtDNA. The fluorescence intensity at 640 nm of YON enhanced linearly with increasing concentrations of mtDNA. Dicyanoisophorone as the strong electron-withdrawing group that was introduced into both ends of the molecule resulted in YON being a classic quadrupole, so it could ultrasensitively detect trace mtDNA. The minimum detection limit was 71 ng/mL. Moreover, the large Stokes shift (λex = 435 nm, λem = 640 nm) makes YON suitable for "interference-free" imaging of mtDNA. Therefore, YON was used to monitor trace changes of mtDNA in living cells; more importantly, it could be used to evaluate the health of cells by monitoring microchanges of mtDNA, enabling the ultrasensitive evaluation of apoptosis.

Elevated Fecal Mitochondrial DNA from Symptomatic Norovirus Infections Suggests Potential Health Relevance of Human Mitochondrial DNA in Fecal Source Tracking.

An end goal of fecal source tracking (FST) is to provide information on risk of transmission of waterborne illnesses associated with fecal contamination. Ideally, concentrations of FST markers in ambient waters would reflect exposure risk. Human mtDNA is an FST marker that is exclusively human in origin and may be elevated in feces of individuals experiencing gastrointestinal inflammation. In this study, we examined whether human mtDNA is elevated in fecal samples from individuals with symptomatic norovirus infections using samples from the United States (US), Mozambique, and Bangladesh. We quantified hCYTB484 (human mtDNA) and HF183/BacR287 (human-associated Bacteroides) FST markers using droplet digital polymerase chain reaction. We observed the greatest difference in concentrations of hCYTB484 when comparing samples from individuals with symptomatic norovirus infections versus individuals without norovirus infections or diarrhea symptoms: log10 increase of 1.42 in US samples (3,820% increase, p-value = 0.062), 0.49 in Mozambique (308% increase, p-value = 0.061), and 0.86 in Bangladesh (648% increase, p-value = 0.035). We did not observe any trends in concentrations of HF183/BacR287 in the same samples. These results suggest concentrations of fecal mtDNA may increase during symptomatic norovirus infection and that mtDNA in environmental samples may represent an unambiguously human source-tracking marker that correlates with enteric pathogen exposure risk.

Antioxidant properties and transcriptome of cauda epididymis with different levels of fertility in Hu lambs

Oxidative stress damages the structure of sperm and affects its fertility. Further maturation and storage of spermatozoa occur in the epididymis. Thus, a balanced environment between free-radical production and the antioxidant–enzyme system is important. This study aimed to investigate differences in antioxidative activity in epididymis between high and low fertility levels of Hu sheep. A total of 179 Hu ram lambs aged 56 days were fed up to 6 months in the same environment. After feeding trial, all rams were slaughtered. According to the epididymis weight, cauda sperm concentration, and histo-morphological observation, 18 individuals were selected and divided into low fertility (n = 9) and high fertility (n = 9) groups. The RNA sequencing results showed 1404 differentially expressed genes (DEGs), with 735 genes upregulated and 669 genes downregulated in the high fertility group compared with the low fertility group. Sixteen DEGs related to lipid metabolism and oxidative stress, including GPX3, GPX5, LRP1, PLCB1, CRISP2, BSPH1, and ACSBG1, were screened by qPCR, and results were correlated well with the sequencing data. Antioxidative indices such as total antioxidant capacity (21.29 ± 5.97 vs. 30.23 ± 4.56 μM/gprot) and glutathione peroxidase (39.75 ± 7.61 vs. 68.84 ± 12.51 U/mgprot) increased in the high fertility group. However, the relative expression of mtDNA and malondialdehyde concentration (0.75 ± 0.15 vs. 0.54 ± 0.10 nmol/mgprot) and the reactive oxygen species (ROS) content significantly decreased (P < 0.05). Therefore, epididymis from high-fertility group had strong antioxidative activity and protected spermatozoa from ROS.

Peripheral Blood Mitochondrial DNA Levels Were Modulated by SARS-CoV-2 Infection Severity and Its Lessening Was Associated With Mortality Among Hospitalized Patients With COVID-19.

IntroductionDuring severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection, the virus hijacks the mitochondria causing damage of its membrane and release of mt-DNA into the circulation which can trigger innate immunity and generate an inflammatory state. In this study, we explored the importance of peripheral blood mt-DNA as an early predictor of evolution in patients with COVID-19 and to evaluate the association between the concentration of mt-DNA and the severity of the disease and the patient’s outcome.MethodsA total 102 patients (51 COVID-19 cases and 51 controls) were included in the study. mt-DNA obtained from peripheral blood was quantified by qRT-PCR using the NADH mitochondrial gene.ResultsThere were differences in peripheral blood mt-DNA between patients with COVID-19 (4.25 ng/μl ± 0.30) and controls (3.3 ng/μl ± 0.16) (p = 0.007). Lower mt-DNA concentrations were observed in patients with severe COVID-19 when compared with mild (p= 0.005) and moderate (p= 0.011) cases of COVID-19. In comparison with patients with severe COVID-19 who survived (3.74 ± 0.26 ng/μl) decreased levels of mt-DNA in patients with severe COVID-19 who died (2.4 ± 0.65 ng/μl) were also observed (p = 0.037).ConclusionHigh levels of mt-DNA were associated with COVID-19 and its decrease could be used as a potential biomarker to establish a prognosis of severity and mortality of patients with COVID-19.

Mitochondrial DNA as a Biomarker for Acute Central Serous Chorioretinopathy: A Case-Control Study

Background: The literature suggests that stress may play a pivotal role in the precipitation of acute central serous chorioretinopathy (CSC) because chorioretinal integrity can be affected by the psychosocial state of the patient, indicating the need for a biomarker. Methods: This observational case series included 45 eyes of 45 consecutive patients with treatment-naive acute CSC. Fifty eyes of 50 age-matched healthy volunteers were included in this study as non-CSC controls. Serum samples were collected from all participants, and the levels of mitochondrial DNA (mtDNA) were measured by quantitative real-time (RT)-PCR. Serum levels of high-mobility group box (HMGB) 1 and 8-hydroxy-2’-deoxyguanosine (8-OHdG), biological markers of acute/chronic inflammation and oxidative stress, were also measured. The relationships between serum mtDNA, 8-OHdG, and HMGB1 concentrations were investigated by multivariate regression analysis, alongside an assessment of clinical data. Findings: In the acute CSC group, serum mtDNA concentrations, at 36.5 ± 32.4 ng/mL, were significantly higher than the levels in the control group (7.4 ± 5.9 ng/mL; p < 0.001). Serum levels of 8-OHdG and HMGB1 in acute CSC patients measured 0.12 ± 0.08 ng/mL and 18.1 ± 35.0 ng/mL, respectively, indicating that HMGB1 levels were elevated in CSC compared with the values in the published literature. Multivariate regression analysis demonstrated that increased serum mtDNA levels were significantly associated with the height of serous retinal detachment. Interpretation: We showed serum mtDNA and HMGB1 level elevation and relation to the clinical activities of CSC, providing possible biomarkers for the acute phase of the disease. Trial Registration: This study was registered with the Osaka University Clinical Research Review Committee Registry (registration number, CRB5180007-13448). Funding: Center of Innovation Program from the Japan Science and Technology Agency, JST. Declaration of Interest: All authors declare no competing interests. Ethical Approval: All patients provided written informed consent for the investigation, and the study adhered to the tenets of the Declaration of Helsinki. The local ethics committee of the Osaka University Medical Hospital approved the study.

Synovial fluid mitochondrial DNA as a biomarker after naturally occurring intra-articular fracture

Synovial fluid mitochondrial DNA as a biomarker after naturally occurring intra-articular fracture

Bioactive Plasma Mitochondrial DNA Is Associated With Disease Progression in Scleroderma-Associated Interstitial Lung Disease.

Systemic sclerosis-associated interstitial lung disease (SSc-ILD) is characterized by variable clinical outcomes, activation of innate immune pattern-recognition receptors (PRRs), and accumulation of α-smooth muscle actin (α-SMA)-expressing myofibroblasts. The aim of this study was to identify an association between these entities and mitochondrial DNA (mtDNA), an endogenous ligand for the intracellular DNA-sensing PRRs Toll-like receptor 9 (TLR-9) and cyclic GMP-AMP synthase/stimulator of interferon genes (cGAS/STING), which has yet to be determined. Human lung fibroblasts (HLFs) from normal donors and SSc-ILD explants were treated with synthetic CpG DNA and assayed for α-SMA expression and extracellular mtDNA using quantitative polymerase chain reaction for the human MT-ATP6 gene. Plasma MT-ATP6 concentrations were evaluated in 2 independent SSc-ILD cohorts and demographically matched controls. The ability of SSc-ILD and control plasma to induce TLR-9 and cGAS/STING activation was evaluated with commercially available HEK 293 reporter cells. Plasma concentrations of type I interferons (IFNs), interleukin-6 (IL-6), and oxidized DNA were measured using electrochemiluminescence and enzyme-linked immunosorbent assay-based methods. Extracellular vesicles (EVs) precipitated from plasma were evaluated for MT-ATP6 concentrations and proteomics via liquid chromatography mass spectrometry. Normal HLFs and SSc-ILD fibroblasts developed increased α-SMA expression and MT-ATP6 release following CpG stimulation. Plasma mtDNA concentrations were increased in the 2 SSc-ILD cohorts, reflective of ventilatory decline, and were positively associated with both TLR-9 and cGAS/STING activation as well as type I IFN and IL-6 expression. Plasma mtDNA was not oxidized and was conveyed by EVs displaying a proteomics profile consistent with a multicellular origin. These findings demonstrate a previously unrecognized connection between EV-encapsulated mtDNA, clinical outcomes, and intracellular DNA-sensing PRR activation in SSc-ILD. Further study of these interactions could catalyze novel mechanistic and therapeutic insights into SSc-ILD and related disorders.