Moroccan Watermelon Mosaic Virus Research Articles

First report of Moroccan watermelon mosaic virus in pumpkin plants in Brazil.

Cucurbita moschata is widely cultivated in Brazil, and zucchini lethal chlorosis virus, squash mosaic virus, papaya ringspot virus, watermelon mosaic virus have been reported as viral pathogens in this crop in Brazil. The leaf samples of C. moschata showing mosaic, blistering, and yellowing symptoms were collected from a commercial field in Petrolina, Pernambuco state and a commercial field in Juazeiro, Bahia state, in February 2023. To identify viruses that infect cucurbit plants in Brazil, three pooled samples showing virus-like symptoms (plants from the Cucurbita genus, the Cucumis genus, and other cucurbit plans including watermelon and chayote) were analyzed by high-throughput sequencing (HTS). The total RNA was extracted from the semi-purified virus using the protocol described by Blawid et al. 2017. The cDNA library was constructed from one RNA sample, which was composed of three pooled RNA samples (Cucurbita genus, the Cucumis genus, and other cucurbit plans), using TruSeq Stranded Total RNA with Ribo-Zero Plant kit (Illumina, San Diego, CA, US) and sequenced by HTS using Novaseq 10G scale (150 bp paired-ends). De novo assembly of total reads was performed using Megahit (Li et al. 2015), and the resulting contigs were analyzed using Blastx with RefSeq viral proteins 2023 (NCBI) in Geneious Prime (Biomatters, Auckland, New Zealand). Total of 88,028,898 reads were obtained and 407,500 contigs (mean length 514 nt) were assembled. Two contigs showed higher amino acid sequence identities (95.4% of 3124 aa in polyprotein and 87.2% of 203 aa in P1 protein) with Moroccan watermelon mosaic virus (MWMV) in the genus Potyvirus of the family Potyviridae (McKern et al. 1993), a virus that had not been previously reported in Brazil. The complete genome was assembled by the read mapping to the contigs as references. The assembled complete genome of MWMV (LC775353) was 9,713 nt, not counting the poly(A) tail, and 217,278 reads were aligned to the genome with a mean coverage of 3369.6 and a pairwise identity of 99.0%. The assembled genome encoded a polyprotein with a higher amino acid sequence identity of 97.82% with the Moroccan isolate (OQ847413). To confirm the presence of this virus in individual samples, RT-PCR was performed with specific primers (MWMV-F: ATTGTCTGATGAAAGAGCACA and MWMV-R: CAGCTTCAGTCGCAACAAG), targeting the cylindrical inclusion gene (the expected size of 598 bp). Eleven field samples of pumpkin plants (six from a field in Juazeiro region and five from Petrolina region) were analyzed using RT-PCR, and one sample from Juazeiro and five samples from Petrolina were positive for MWMV. One replicon of each region was sequenced (Juazeiro, OR338305; Petrolina, OR338306) and showed higher nucleotide identities of 97.0% with each other, and 96.4% and of 97.7%, respectively, with the isolate from Morocco (OQ847413). Samples positive for MWMV were tested for the presence of other viruses previously reported in Brazil. All five samples from Petrolina were positive by RT-PCR as a mixed infection with zucchini yellow mosaic virus (ZYMV) and cucurbit whitefly-borne yellows virus, also, four out of five samples were positive for papaya ringspot virus (PRSV). On the other hand, in one sample positive for MWMV from Bahia state, no mixed infection with ZYMV and PRSV was observed. This is the first report of the occurrence of MWMV in Brazil and South America, associated with mosaic, blistering and yellowing disease symptoms in pumpkin plants.

First record of Moroccan watermelon mosaic virus on Solanum nigrum L.

First record of Moroccan watermelon mosaic virus on Solanum nigrum L.

Long-term monitoring of aphid-transmitted viruses in melon and zucchini crops: genetic diversity and population structure of cucurbit aphid-borne yellows virus and watermelon mosaic virus.

Understanding the emergence and prevalence of viral diseases in crops requires the systematic epidemiological monitoring of viruses, as well as the analysis of how ecological and evolutionary processes combine to shape viral population dynamics. Here, we extensively monitored the occurrence of six aphid-transmitted viruses in melon and zucchini crops in Spain for 10 consecutive cropping seasons between 2011 and 2020. The most prevalent viruses were cucurbit aphid-borne yellows virus (CABYV) and watermelon mosaic virus (WMV), found in 31 and 26% of samples with yellowing and mosaic symptoms. Other viruses, such as zucchini yellow mosaic virus (ZYMV), cucumber mosaic virus (CMV), Moroccan watermelon mosaic virus (MWMV), and papaya ring spot virus (PRSV) were detected less frequently (< 3%) and mostly in mixed infections. Notably, our statistical analysis showed a significant association between CABYV and WMV in melon and zucchini hosts, suggesting that mixed infections might be influencing the evolutionary epidemiology of these viral diseases. We then carried out a comprehensive genetic characterization of the full-length genome sequences of CABYV and WMV isolates by using the PacBio single-molecule real-time high-throughput technology, in order to assess the genetic variation and structure of their populations. Our results showed that most isolates clustered in the Mediterranean clade, with a fine-scale temporal structure, which was in part explained by the level of the variance between isolates from single and mixed infections. In contrast, the WMV population genetic analysis showed that most of the isolates grouped into the Emergent clade, with no genetic differentiation.

Editing melon eIF4E associates with virus resistance and male sterility

SummaryThe cap‐binding protein eIF4E, through its interaction with eIF4G, constitutes the core of the eIF4F complex, which plays a key role in the circularization of mRNAs and their subsequent cap‐dependent translation. In addition to its fundamental role in mRNA translation initiation, other functions have been described or suggested for eIF4E, including acting as a proviral factor and participating in sexual development. We used CRISPR/Cas9 genome editing to generate melon eif4e knockout mutant lines. Editing worked efficiently in melon, as we obtained transformed plants with a single‐nucleotide deletion in homozygosis in the first eIF4E exon already in a T0 generation. Edited and non‐transgenic plants of a segregating F2 generation were inoculated with Moroccan watermelon mosaic virus (MWMV); homozygous mutant plants showed virus resistance, while heterozygous and non‐mutant plants were infected, in agreement with our previous results with plants silenced in eIF4E. Interestingly, all homozygous edited plants of the T0 and F2 generations showed a male sterility phenotype, while crossing with wild‐type plants restored fertility, displaying a perfect correlation between the segregation of the male sterility phenotype and the segregation of the eif4e mutation. Morphological comparative analysis of melon male flowers along consecutive developmental stages showed postmeiotic abnormal development for both microsporocytes and tapetum, with clear differences in the timing of tapetum degradation in the mutant versus wild‐type. An RNA‐Seq analysis identified critical genes in pollen development that were down‐regulated in flowers of eif4e/eif4e plants, and suggested that eIF4E‐specific mRNA translation initiation is a limiting factor for male gametes formation in melon.

Moroccan Watermelon Mosaic Virus in Squash Production Areas of Antalya Province

Bu çalışma Antalya ili kabak üretim alanlarından toplanan kabak örneklerinde Fas karpuz mozayik virüsü (Moroccan watermelon mosaic virus; MWMV)’nün tespit edilmesi amacıyla 2019-2020 yıllarında yürütülmüştür. MWMV’nün varlığı serolojik ve moleküler yöntemlerle belirlenmiştir. Survey çalışmalarında virüs simptomu sergileyen 120 yaprak örneği alınmış, örneklere DAS-ELISA (Double Antibody Sandwich Enzyme Linked Immunosorbent Assay) yöntemi uygulanmıştır. DAS-ELISA testi sonucunda Aksu, Manavgat ve Kumluca ilçelerinden toplanan 9 yaprak örneğinde MWMV belirlenmiştir. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction) çalışmalarında enfekteli bu 9 yaprak örneği kullanılmıştır. RT-PCR uygulamasında MWMV kılıf protein geni için spesifik primerler kullanılarak yaklaşık 627 bç’lik bir kısım amplifiye edilmiş ve beklenen seviyede bant elde edilmiştir. Bu çalışma, Antalya ili kabak alanlarında MWMV’nin serolojik ve moleküler yöntemlerle tanılanması bakımından ilk çalışma niteliğindedir.

Occurrence of a Novel Strain of Moroccan Watermelon Mosaic Virus Infecting Pumpkins in Kenya.

The Potyvirus Moroccan watermelon mosaic virus (MWMV) naturally infects and severely threatens production of cucurbits and papaya. In this study, we identified and characterized MWMV isolated from pumpkin (Cucurbita moschata) intercropped with MWMV-infected papaya plants through next-generation sequencing (NGS) and Sanger sequencing approaches. Complete MWMV genome sequences were obtained from two pumpkin samples through NGS and validated using Sanger sequencing. The isolates shared 83.4 to 83.7% nucleotide (nt) and 92.3 to 95.1% amino acid (aa) sequence identities in the coat protein and 79.5 to 79.9% nt and 89.2 to 89.7% aa identities in the polyprotein with papaya isolates of MWMV. Phylogenetic analysis using complete polyprotein nt sequences revealed the clustering of both pumpkin isolates of MWMV with corresponding sequences of cucurbit isolates of the virus from other parts of Africa and the Mediterranean regions, distinct from a clade formed by papaya isolates. Through sap inoculation, a pumpkin isolate of MWMV was pathogenic on zucchini (Cucurbita pepo), watermelon (Citrullus lanatus), and cucumber (Cucumis sativus) but not on papaya. Conversely, the papaya isolate of MWMV was nonpathogenic on pumpkin, watermelon, and cucumber, but it infected zucchini. The results suggest the occurrence of two strains of MWMV in Kenya having different biological characteristics associated with the host specificity.[Formula: see text] Copyright © 2022 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license.

First report of Moroccan watermelon mosaic virus on edible seed squash in Turkey

First report of Moroccan watermelon mosaic virus on edible seed squash in Turkey

Assessment of the Current Status of Potyviruses in Watermelon and Pumpkin Crops in Spain: Epidemiological Impact of Cultivated Plants and Mixed Infections.

Viral infections on cucurbit plants cause substantial quality and yield losses on their crops. The diseased plants can often be infected by multiple viruses, and their epidemiology may depend, in addition to the agro-ecological management practices, on the combination of these viral infections. Watermelon mosaic virus (WMV) is one of the most prevalent viruses in cucurbit crops, and Moroccan watermelon mosaic virus (MWMV) emerged as a related species that threatens these crops. The occurrence of WMV and MWMV was monitored in a total of 196 apical-leaf samples of watermelon and pumpkin plants that displayed mosaic symptoms. The samples were collected from 49 fields in three major cucurbit-producing areas in Spain (Castilla La-Mancha, Alicante, and Murcia) for three consecutive (2018–2020) seasons. A molecular hybridization dot-blot method revealed that WMV was mainly (53%) found in both cultivated plants, with an unadvertised occurrence of MWMV. To determine the extent of cultivated plant species and mixed infections on viral dynamics, two infectious cDNA clones were constructed from a WMV isolate (MeWM7), and an MWMV isolate (ZuM10). Based on the full-length genomes, both isolates were grouped phylogenetically with the Emergent and European clades, respectively. Five-cucurbit plant species were infected steadily with either WMV or MWMV cDNA clones, showing variations on symptom expressions. Furthermore, the viral load varied depending on the plant species and infection type. In single infections, the WMV isolate showed a higher viral load than the MWMV isolate in melon and pumpkin, and MWMV only showed higher viral load than the WMV isolate in zucchini plants. However, in mixed infections, the viral load of the WMV isolate was greater than MWMV isolate in melon, watermelon and zucchini, whereas MWMV isolate was markedly reduced in zucchini. These results suggest that the impaired distribution of MWMV in cucurbit crops may be due to the cultivated plant species, in addition to the high prevalence of WMV.

Metaviromic analysis reveals coinfection of papaya in western Kenya with a unique strain of Moroccan watermelon mosaic virus and a novel member of the family Alphaflexiviridae.

Severe mottling symptoms were observed on Carica papaya L. in Koyonzo, Kakamega County, Kenya. Total RNA was sequenced via an RNAtag-seq workflow. Assembled contigs indicated the presence of a divergent strain of Moroccan watermelon mosaic virus (genus Potyvirus) with a complete genome length of 9,733 nt (GenBank accession no. MN418119). Additionally, the complete genome sequence of a novel member of the viral genus Allexivirus was determined (GenBank accession no. MN418120). The genome contains six open reading frames (ORFs) that show varying degrees of sequence similarity to members of the genus Allexivirus; however, it appears to lack an ORF encoding a nucleic-acid-binding homolog. The tentative name "papaya virus A" (PaVA) has been proposed for this virus.

Metagenomic Analysis of Plant Viruses Associated With Papaya Ringspot Disease in Carica papaya L. in Kenya.

Carica papaya L. is an important fruit crop grown by small- and large-scale farmers in Kenya for local and export markets. However, its production is constrained by papaya ringspot disease (PRSD). The disease is believed to be caused by papaya ringspot virus (PRSV). Previous attempts to detect PRSV in papaya plants showing PRSD symptoms, using enzyme-linked immunosorbent assay (ELISA) and reverse transcriptase-polymerase chain reaction (RT-PCR) procedures with primers specific to PRSV, have not yielded conclusive results. Therefore, the nature of viruses responsible for PRSD was elucidated in papaya leaves collected from 22 counties through Illumina MiSeq next-generation sequencing (NGS) and validated by RT-PCR and Sanger sequencing. Viruses were detected in 38 out of the 48 leaf samples sequenced. Sequence analysis revealed the presence of four viruses: a Potyvirus named Moroccan watermelon mosaic virus (MWMV) and three viruses belonging to the genus Carlavirus. The Carlaviruses include cowpea mild mottle virus (CpMMV) and two putative Carlaviruses—closely related but distinct from cucumber vein-clearing virus (CuVCV) with amino acid and nucleotide sequence identities of 75.7–78.1 and 63.6–67.6%, respectively, in the coat protein genes. In reference to typical symptoms observed in the infected plants, the two putative Carlaviruses were named papaya mottle-associated virus (PaMV) and papaya mild mottle-associated virus (PaMMV). Surprisingly, and in contrast to previous studies conducted in other parts of world, PRSV was not detected. The majority of the viruses were detected as single viral infections, while a few were found to be infecting alongside another virus (for example, MWMV and PaMV). Furthermore, the NGS and RT-PCR analysis identified MWMV as being strongly associated with ringspot symptoms in infected papaya fruits. This study has provided the first complete genome sequences of these viruses isolated from papaya in Kenya, together with primers for their detection—thus proving to be an important step towards the design of long-term, sustainable disease management strategies.

Biological, Serological and Molecular Characterisation of a New Virus Species Infecting Telfairia occidentalis in Calabar, Cross River State, Nigeria

Telfairia occidentalis (Hook) belongs to the family Cucurbitaceae and is an economically important cash crop worldwide. It is widely cultivated in Nigeria including the South Eastern part of the country. This research was aimed at isolating, characterising and identifying a new virus species infecting Telfairia occidentalis in Calabar, Cross River State. Diagnostic tools employed included host range/symptomatology, insect transmission test, Antigen Coated Plate (ACP) Enzyme Linked-Immunosorbent Assay (ELISA) and gene sequencing. Results revealed that the virus isolate infected only members of the cucurbit family producing rugosity, mosaic, mottle and leaf malformation/deformation. The virus isolate was transmitted by Aphis spiraecola in a fore-gut manner and not by A. citricida. It reacted positively against universal potyvirus antiserum. Sequence analysis showed that the Telfairia occidentalis virus isolate had 75% sequence identity with Moroccan watermelon mosaic virus (MWM) which was found to be the closest. The virus was consequently considered a new species of potyvirus for which the name Telfairia severe mosaic virus (TeSMV) was suggested.

First Report of Tomato Leaf Curl New Delhi Virus Infecting Cucurbit Plants in Algeria

HomePlant DiseaseVol. 103, No. 12First Report of Tomato Leaf Curl New Delhi Virus Infecting Cucurbit Plants in Algeria PreviousNext DISEASE NOTES OPENOpen Access licenseFirst Report of Tomato Leaf Curl New Delhi Virus Infecting Cucurbit Plants in AlgeriaA. Kheireddine, A. Sifres, C. Sáez, B. Picó, and C. LópezA. KheireddineInstitute for the Conservation and Breeding of Agricultural Biodiversity, Universitat Politècnica de València, 46022 Valencia, SpainUniversity Mohamed Khider Biskra, 07000 Biskra, AlgeriaSearch for more papers by this author, A. SifresInstitute for the Conservation and Breeding of Agricultural Biodiversity, Universitat Politècnica de València, 46022 Valencia, SpainSearch for more papers by this author, C. SáezInstitute for the Conservation and Breeding of Agricultural Biodiversity, Universitat Politècnica de València, 46022 Valencia, SpainSearch for more papers by this author, B. PicóInstitute for the Conservation and Breeding of Agricultural Biodiversity, Universitat Politècnica de València, 46022 Valencia, SpainSearch for more papers by this author, and C. López†Corresponding author: C. López; E-mail Address: clopez@upvnet.upv.eshttp://orcid.org/0000-0001-7459-1315Institute for the Conservation and Breeding of Agricultural Biodiversity, Universitat Politècnica de València, 46022 Valencia, SpainSearch for more papers by this author AffiliationsAuthors and Affiliations A. Kheireddine1 2 A. Sifres1 C. Sáez1 B. Picó1 C. López1 † 1Institute for the Conservation and Breeding of Agricultural Biodiversity, Universitat Politècnica de València, 46022 Valencia, Spain 2University Mohamed Khider Biskra, 07000 Biskra, Algeria Published Online:16 Oct 2019https://doi.org/10.1094/PDIS-05-19-1118-PDNAboutSections ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat In June 2018, zucchini (Cucurbita pepo), melon (Cucumis melo), and cucumber (Cucumis sativus) plants showing virus-like symptoms such as foliar yellowing and vein clearing were observed in the agricultural region of Biskra, in northeast Algeria. A total of 51 symptomatic leaf samples were collected: 31 of zucchini, 12 of cucumber, and eight of melon. To investigate the etiology of the observed disease, leaf extracts were subjected to total RNA extraction with TRIzol reagent. Virus identification was carried out by nucleic acid spot hybridization using specific riboprobes for tomato leaf curl New Delhi virus (ToLCNDV, genus Begomovirus, family Geminiviridae), cucurbit yellows stunting disorder virus, cucumber vein yellowing virus, cucumber mosaic virus, watermelon mosaic virus, Moroccan watermelon mosaic virus, Algerian watermelon mosaic virus, zucchini yellow mosaic virus, and cucumber green mottle mosaic virus. A hybridization signal was observed for all symptomatic leaf samples with the ToLCNDV riboprobe, whereas no signal was observed for samples from zucchini plants grown in a virus-free facility. Moreover, the presence of any of the other abovementioned viruses was not observed in any of the analyzed samples. To confirm the identity of the virus, DNA was isolated from 24 symptomatic samples (12 of zucchini, six of melon, and six of cucumber) with the CTAB method and was subsequently analyzed by PCR with two ToLCNDV-specific primer pairs (To-A1F and To-A1R from the DNA-A; To-B1F and To-B1R from the DNA-B) (Sáez et al. 2016) to amplify 505- and 677-bp fragments of viral DNAs A and B, respectively. PCR products of the expected size were observed on 1% agarose gel for all of the symptomatic samples. Two randomly selected PCR fragments of each host were bidirectionally sequenced and confirmed as ToLCNDV. The nucleotide sequences of these amplicons were essentially identical irrespective of the host. The complete DNA-A and DNA-B genomic sequences of a ToLCNDV isolate from cucumber (ToLCNDV-Biskra) were obtained as described by Sifres et al. (2018) and deposited in GenBank under accessions numbers MK981891 and MK981892. Alignments of the obtained sequences of DNA-A and DNA-B using the Muscle method in SDT version 1.2 (Muhire et al. 2014) revealed identities of 98.7 and 97.6%, respectively, with the corresponding segments of the isolates from the Mediterranean basin, whereas the identity with isolates from Asia was around 90 and 81% for DNA-A and DNA-B, respectively. Tests conducted by PCR with conserved primers for betasatellites and alphasatellites (Briddon et al. 2002; Bull et al. 2003) were negative, and an additional test by PCR with conserved primers for begomoviruses (Alfaro-Fernández et al. 2016) did not detect any other begomovirus. Moreover, because the Mediterranean basin isolates are mechanically transmitted (López et al. 2015), experiments were conducted using dehydrated tissue of some of the cucumber plants naturally infected with ToLCNDV as a source of inoculum to inoculate seedlings of zucchini accession MU-CU-16, highly susceptible to this virus. Ten days postinoculation, ToLCNDV infection was confirmed by PCR amplification and additionally confirmed by DNA sequencing. In the Mediterranean basin, ToLCNDV has been reported in Spain, Italy, Greece, Tunisia, and Morocco infecting different cucurbit crops, but to our knowledge, this is the first report of the presence of ToLCNDV in Algeria. Further disease monitoring and the establishment of effective control measures will be necessary for disease management to minimize yield losses.The author(s) declare no conflict of interest.

Resistance to the Emerging Moroccan Watermelon Mosaic Virus in Squash.

Moroccan watermelon mosaic virus (MWMV) represents an emerging threat to cucurbit production in the Mediterranean Basin. We sequenced the near complete genome of MWMV-SQ10_1.1, a cloned Spanish isolate. MWMV-SQ10_1.1 has the typical potyvirus genomic structure, and phylogenetic analysis showed that it shared a common ancestor with other Mediterranean MWMV isolates. We used MWMV SQ10_1.1 to inoculate plants in a collection of commercial squash cultivars, including some described as potyvirus resistant. All inoculated plants from all cultivars showed severe infection symptoms. Twenty-four Cucurbita spp. accessions were then tested for their susceptibility to MWMV-SQ10_1.1. Plants of the C. ecuadorensis PI 432441 accession showed no symptoms and their enzyme-linked immunosorbent assay readings were similar to uninfected controls. Progeny analysis of F1 and F2 populations suggested that two recessive genes control PI 432441 resistance to MWMV. We hypothesized that this resistance could be associated with alleles of genes encoding the eukaryotic translation initiation factor 4E (eIF4E), particularly after determination of its recessive nature. A multiple sequence alignment including the two eIF4E ortholog sequences from PI 432441 (CeeIF4E1 and CeeIF4E2) identified three amino acid substitutions in CeeIF4E1 and two amino acid substitutions in CeeIF4E2 potentially involved in potyvirus resistance. Polymerase chain reaction markers for CeeIF4E1 and CeeIF4E2 were developed and used to genotype 156 F2 individuals already phenotyped; this analysis did not support an association of either CeeIF4E2 or CeeIF4E1 with MWMV resistance.

First Report of Moroccan Watermelon Mosaic Virus in Zucchini in Iran.

Cucurbits are among the most important vegetable crops in Iran, growing both in open fields and in greenhouses. They are ranked first in economic value, second in yield, and third in acreage and are susceptible to a number of viruses (Bananej and Vahdat 2008). Whitefly-transmitted viruses, namely, cucurbit chlorotic yellows virus (CCYV) and cucumber yellows stunting disorder virus (CYSDV), and the aphid-borne watermelon mosaic virus (WMV), zucchini yellow mosaic virus (ZYMV), papaya ringspot virus (PRSV), and cucurbit aphid-borne yellows virus (CABYV), have all previously been reported from Iran (Bananej and Vahdat 2008; Bananej et al. 2013). During November 2017, 12 samples were collected from cucumber (Cucumis sativus) and 14 from zucchini (Cucurbita pepo) plants grown in open fields that showed virus-like symptoms such as leaf mosaic, mottling, deformation, and yellowing symptoms in Kerman province in the south of Iran. The majority of both plant species were heavily infested by Bemisia tabaci, whereas no aphid colonies were observed. Leaf samples collected from symptomatic plants were subjected to total RNA extraction (Chatzinasiou et al. 2010). Reverse transcription PCR assays used for the detection of CCYV, CYSDV, and CABYV (Orfanidou et al. 2014) showed that all samples were infected with CABYV (26/26), whereas three cucumber samples were infected with CCYV and four with CYSDV. Moreover, double antibody sandwich ELISA was used for detection of WMV, ZYMV, PRSV, and Moroccan watermelon mosaic virus (MWMV) using polyclonal antisera kindly provided by H. Lecoq (INRA, France). None of the samples (0/26) was found to be infected with WMV, ZYMV, or PRSV; however, 9 out of 14 zucchini samples were positive for MWMV infection, whereas none of the 12 cucumber plants were positive for MWMV infection. For further confirmation, the specific primers MoDetF/MoDetR (5′-AARGAYGTTGATGTTGGRAC-3′, 5′-CCATARTCAYTCTTGACYCCATC-3′) were used to amplify a 211-bp product of the capsid protein gene of MWMV. These results confirmed the presence of the virus in the nine zucchini plants. Two isolates were further characterized by sequencing the amplicon, and the BLASTn analysis of the obtained sequences (accession nos. LT985986 and LT985987) showed 100% nucleotide identity with MWMV isolates from Tunisia and Greece (accession nos. EF579955 and LN810061). To our knowledge, this is the first report of MWMV infecting zucchini in Iran. After the detection of the virus in several countries of the Mediterranean region, this report further extends the information on its geographical distribution in the Middle East. The high sequence similarity of the Iranian MWMV isolate with those from the other Mediterranean countries, but not sub-Saharan Africa, indicates their recent rapid spread in the Mediterranean region (Yakoubi et al. 2008). Further surveys should concentrate on the spread, incidence, and epidemiology of this virus in Iran.

New species in the papaya ringspot virus cluster: Insights into the evolution of the PRSV lineage

The “Papaya ringspot virus (PRSV) cluster” of cucurbit-infecting potyviruses contains five acknowledged species that have similar biological, serological and molecular properties. Additional data suggest there are other uncharacterized species from various locations in the world that likely belong to the PRSV cluster including a new PRSV-like virus reported from Sudan in 2003. Molecular and biological data indicated that the virus from Sudan belongs to a new species, tentatively named wild melon vein banding virus (WMVBV). The complete nucleotide sequence of a second virus from Sudan revealed it was a divergent relative of Moroccan watermelon mosaic virus (MWMV). Based on sequence similarity this virus was determined to be a distinct species and tentatively named Sudan watermelon mosaic virus (SuWMV). Molecular analyses indicate that SuWMV is a recombinant between WMVBV- and MWMV-related viruses. Based on surveys performed in Sudan between 1992 and 2012, SuWMV appeared 10 times more frequent than WMVBV in that country (14.6% vs. 1.5% of the samples tested). The geographic structure and molecular diversity patterns of the putative and acknowledged species suggest that the PRSV-like cluster originated in the Old World about 3600 years ago, with an important diversification in Africa.

FIRST REPORT OF CUCURBIT APHID-BORNE YELLOWS VIRUS AFFECTING SUMMER SQUASH AND MELON IN MONTENEGRO

The phytosanitary status of cucurbit crops in the central and coastal regions of Montenegro was evaluated with a survey in 2015. Leaf samples of summer squash, zucchini squash (Cucurbita pepo L.) and melon (Cucumis melo L.) showing mosaic, interveinal mottling or yellowing, bright yellowing, blisters and distortions were collected from 101 plants. All samples were screened by DAS-ELISA (Bioreba, Switzerland) for Cucumber mosaic virus (CMV), Watermelon mosaic virus (WMV), Moroccan watermelon mosaic virus (MWMV), Zucchini yellow mosaic virus (ZYMV), Zucchini yellow fleck virus (ZYFV) and Papaya ringspot virus (PRSV). Serological analysis showed that 91.1% of the samples were infected with at least one of three viruses, the most prevalent of which was CMV (62.4%), followed by WMV (50.5%) and ZYMV (12.9%). Samples from 20 plants showing symptoms resembling those caused by poleroviruses were analyzed by RT-PCR using the coat protein (CP) gene-specific primers CE9/CE10 of Cucurbit aphid-borne yellows virus (CABYV) (Juarez et al., 2004) An amplicon of the expected size (600 bp) was generated from six samples of summer squash and one of zucchini squash. Single infections by CABYV were found in two of seven positive samples, while other five were co-infected with CMV, WMV and/or ZYMV. Nucleotide sequences of the complete CP gene from four Montenegrin isolates (accession Nos. KX398662-KX398665) were identical to one another, sharing the highest nucleotide identity (99.1%) with an isolate from France (X76931). A previous survey in the former Yugoslavia did not reveal the presence of CABYV (Dukic et al., 2002). Afterwards, the virus has been reported in several neighboring countries (Tomassoli and Meneghini, 2007; Vucurovic et al., 2011), but to our knowledge, this is the first report of CABYV infecting C. pepo in Montenegro.

Use of a chimeric transgene construct to confer broad resistance in zucchini (Cucurbita pepo L.) plants against cucurbit-infecting potyviruses occurring in KwaZulu-Natal, South Africa

The frequent identification of cucurbit-infecting viruses across the province of KwaZulu-Natal (KZN) in South Africa necessitates developing effective methods of controlling these diseases. Putative transgenic baby marrow (Cucurbita pepo L.) plants resistant to Zucchini yellow mosaic virus (ZYMV), Moroccan watermelon mosaic virus (MWMV) and Zucchini shoestring virus (ZSSV), three potyviruses occurring in KZN, were developed in this study. A portion of the coat protein coding sequences of each of the selected viruses was amplified by RT-PCR and inserted into the plant expression vector pEPJ86-m/2N. The segment containing the expression cassette was subcloned into the binary vector pGA482G before being introduced into Rhizobium radiobacter (formerly Agrobacterium tumefaciens) strain LBA4404 (pAL4404)(pBI121). Baby marrow cotyledon explants, transformed using Rhizobium-mediated transformation, were regenerated in vitro under kanamycin selection. A total of 94 putative transgenic marrows lines were successfully regenerated from 250 explants. PCR results showed that 84 out of the 94 lines had the transgene. Of these 84 lines, 76 showed resistance after mechanical inoculation with the viruses under study. The preliminary results show the potential of using transgenic cucurbits with resistance to the three potyviruses as an effective strategy to control potyvirus diseases on cucurbits.

Occurrence of viruses infecting melon in Xinjiang of China and molecular characterization of Watermelon mosaic virus isolates

Cucurbit viruses have been associated with important economic losses in Xinjiang of China. Therefore, a comprehensive survey and sample collection was performed during the 2013 and 2014 growing seasons from the major melon-growing locations in Xinjiang which is the largest area for melon production in China. Samples were analyzed using reverse transcription-polymerase chain reaction (RT-PCR) to detect Watermelon mosaic virus (WMV), Zucchini yellow mosaic virus (ZYMV), Cucumber mosaic virus (CMV), Papaya ringspot virus (PRSV), Squash mosaic virus (SqMV), Tomato ringspot virus (ToRSV), Moroccan watermelon mosaic virus (MWMV), Tomato spotted wilt virus (TSWV), Watermelon silver mottle virus (WSMoV), Cucumber green mottle mosaic virus (CGMMV), and Zucchini yellow fleck virus (ZYFV). We collected 492 melon samples with virus-like symptoms. Out of these, 94.5 % of the samples were infected by at least one of these viruses. WMV was the most prevalent virus detected. WMV, CMV, and ZYMV were detected in 77.0 %, 60.0 %, and 41.1 % of infected samples, respectively, and the infection rate of these three viruses changed significantly among melon cultivars. Other viruses analysed were not detected in any sample tested. The number of multiple infections was high (average 57.2 %), with the most common double infection WMV + CMV (17.8 %), closely followed by WMV + ZYMV (14.4 %). Statistical analysis of the potential association among viruses showed that there was a strong association between several viruses for multiple infections. An analysis of WMV genetic diversity suggested that all isolates obtained in this study clustered into group A and that purifying selection was restricting variability in the population.

Genome sequence analysis of two South African isolates of Moroccan watermelon mosaic virus infecting cucurbits.

Moroccan watermelon mosaic virus (MWMV) has been prevalent in cucurbits in the Republic of South Africa (RSA) since it was first reported in 1987. However, full genome studies of the South African isolates have never been conducted previously. The full genome of two MWMV isolates infecting cucurbits (Cucurbita pepo L.) in the province of KwaZulu-Natal, RSA, was compared with the genome of the Tunisian isolate in this communication. The genome sequences of the RSA MWMV isolates were elucidated using next-generation sequencing and Sanger sequencing. The analyses performed included nucleotide and amino acid sequence comparison, determination of the genetic distances, detection of potential recombination, and phylogeny. The genome sequences of the RSA MWMV isolates were found to be 9719 nucleotides long, excluding the poly(A) tail. Sequence homology, genetic distances, and phylogenetic analyses indicated close relationships between the RSA isolates. This record will contribute to building up the MWMV isolate sequences from the different countries where the virus occurs, a useful step toward understanding MWMV evolution.

Zucchini shoestring virus: a distinct potyvirus in the papaya ringspot virus cluster.

Zucchini shoestring virus (ZSSV) has been proposed to be a putative potyvirus in the papaya ringspot virus (PRSV) cluster, based on the sequence similarity of its coat protein to those of related potyviruses. ZSSV has been associated with the outbreak of a damaging disease of baby marrow (Cucurbita pepo L.) that had been observed throughout the province of KwaZulu-Natal, in the Republic of South Africa (RSA). We report the genome sequence of ZSSV, determined by next-generation sequencing of total RNA extracted from an infected baby marrow (Cucurbita pepo L.). The ZSSV genome is 10,295 nucleotides long excluding the poly(A) tail and displays a typical potyvirus organization. Algerian watermelon mosaic virus (AWMV; EU410442.1) was identified as the closest relative of ZSSV, sharing the highest nucleotide sequence identity of 65.68%. The nucleotide and amino acid sequence identity values for each protein support the differentiation of ZSSV as a member of a distinct species in the genus Potyvirus. This taxonomic position was also confirmed using the Pairwise Sequence Comparison online tool from the National Center for Biotechnology Information. Phylogenetic analysis of the polyprotein coding sequence of ZSSV grouped ZSSV together with AWMV and Moroccan watermelon mosaic virus, but in different clusters. ZSSV is the second cucurbit-infecting virus in the PRSV cluster present in RSA.