Molecular Genetic Identification Research Articles

First Report of Exserohilum pedicellatum Causing Root Rot of Wheat (Triticum aestivum L.) in Uzbekistan.

Wheat is the major staple food in Uzbekistan, and it occupies the largest harvested area (1,3 million hectares) in the country (USDA 2024). In June 2023, a survey was conducted to investigate root pathogens in wheat growing fields of Kaspi district in the Kashkadarya region of Uzbekistan. A total of 24 symptomatic plants with root rot and dark brown root lesions were collected from focal lesions in 4 different fields. From each plant, roots were excised and surface sterilized with 1% sodium hypochlorite for four minutes, then rinsed three times with sterile distilled water. Following surface sterilization, the excised roots were air dried in a laminar flow on sterile tissue sheets, rinsed twice with sterile distilled water, and then cut into 1 cm lengths segments (5 segments per one plant). The root pieces were cultured at 24°C for 4 days with a 12-hour photoperiod on potato dextrose agar supplemented with streptomycin (0.1 g/liter) and chloramphenicol (0.05 g/liter). From 24 symptomatic plants a 5 dematiaceous hyphomycete monoconidial pure isolates with abundant conidia were isolated. The conidia (n = 60) were mostly fusiform, straight, four to seven distoseptate, olivaceous brown to dark brown, and measured 51 to 88.7 × 17.9 to 25.4 μm (average 69.7 × 21.57 μm). Based on morphological characteristics the fungus was identified as E. pedicellatum according to Sivanesan (1987) and Hernandez-Restrepo et al. (2018). From five isolated monoconidial colonies, one has been chosen for molecular-genetic identification. Total DNA was extracted from it using PureLink™ Genomic DNA Mini Kit (Thermo Fisher Scientific, Waltham, MA, USA). For more informative analysis two loci, he translation elongation factor 1-alpha (tef1) and beta-tubulin (tub) genes were PCR-amplified and sequenced using gene specific primers: EF-1F （5'-CGGTGGTATCGACAAGCGT-3'), EF-2R （5'-AGCATGTTGTCGCCGTTGAAG-3'）designed by Primer3web v4.1.0 software (Untergasser et al. 2012), and Bt2a （5'- GGTAACCAAATCGGTGCTGCTTTC, Bt2b （5'-ACCCTCAGTGTAGTGACCCTTGGC -3'）described by Glass and Donaldson (1995), respectively. The resulting sequences were deposited in NCBI database under accession number PQ095881 and PQ095882. After BLAST analysis they showed highest similarity with the corresponding sequences of tef1 JQ672389 (100% identity, from 287 bp 287 bp are matching) and tub JQ671941 (100% identity, from 273 bp 273 bp are matching) of BMP 0384 isolate of E. pedicellatum from USA. In the plant inoculations (pathogenicity test), three isolates of E. pedicellatum were evaluated. For the pathogenicity test, conidia were scraped from PDA plate, suspended in water, and mixed with sterile sand to obtain a density of 500 conidia/g. A total of 20 wheat seed (Grom variety) previously disinfected 2 min with 10% NaOCl, were sown in each plastic pot (14 cm x 4 cm, 2 seeds per pot) filled with the inoculated soil (5 pots) and with sterilized soil (5 pots) as a control. Plants were grown in a growth chamber with a 12-h photoperiod at 24°C for 4 weeks. Plants grown in inoculated soil displayed symptoms on their roots similar to those observed in the field-grown plants, whereas the roots of the control plants remained asymptomatic. The fungus was reisolated from the symptomatic roots and confirmed morphologically and molecular genetically as E. pedicellatum, fulfilling Koch's postulates. To the best of our knowledge this is the first report of E. pedicellatum on wheat in Uzbekistan.Since phylogenetic analysis of the GPEB-70 strain showed clustering with strains from USA and also taking into account intensification of globalization in agriculture, rising of global seeds market and increasing demand for high-yielding USA and Canadian wheat seeds in Central Asian farmers, we speculate that there may have been a recent introduction of E. pedicellatum from USA into Uzbekistan. Given that wheat is an important and popular staple food in Uzbekistan, further work would focus on developing efficient strategies to manage this root rot disease, the development of effective management strategies for this root rot disease would be the main focus of future research.

Monogenic Kidney Diseases in Adults With Chronic Kidney Disease (CKD).

According to current evidence, every 10th to 11th adult with chronic kidney disease (CKD) has a monogenic disease of the kidney. This review is based on reported studies in which molecular genetic diagnostic techniques were used to investigate monogenic kidney diseases in adults with CKD. The studies were identified by a selective literature search using predefined criteria. In 12 selected studies, diagnostic variants of 179 different genes were identified in 1467 out of 6607 study participants with CKD (22.2%). More than 60% of these variants affected 8 genes (PKD1, PKD2, COL4A3, COL4A4, COL4A5, UMOD, MUC1, HNF1B). Three diseases are associated with these genes: autosomal dominant polycystic kidney disease (ADPKD), Alport syndrome, and autosomal dominant tubulo-interstitial kidney disease (ADTKD). Physicians treating patients with CKD should be alert to the presence of any red flags, such as onset at a young age, a positive family history, or hematuria of unknown cause. When a genetic etiology is suspected, a specialized work-up is indicated, often including a molecular genetic investigation. A positive genetic finding usually leads to a modification of the patient's specific diagnosis and/or treatment. Awareness of the high prevalence of monogenic kidney diseases in adults with CKD and alertness to their suggestive clinical features are crucial for the timely initiation of targeted diagnostic testing. The molecular genetic identification of these diseases is a prerequisite for appropriate patient management.

Comparison in Bioactive Compounds and Antioxidant Activity of Cheonggukjang Containing Mountain-Cultivated Ginseng Using Two Bacillus Genus.

In this study, the nutrients, phytochemicals (including isoflavone and ginsenoside derivatives), and antioxidant activities of cheonggukjang with different ratios (0%, 2.5%, 5%, and 10%) of mountain-cultivated ginseng (MCG) were compared and analyzed using microorganisms isolated from traditional cheonggukjang. The IDCK 30 and IDCK 40 strains were confirmed as Bacillus licheniformis and Bacillus subtilis, respectively, based on morphological, biological, biochemical, and molecular genetic identification, as well as cell wall fatty acid composition. The contents of amino acids and fatty acids showed no significant difference in relation to the ratio of MCG. After fermentation, isoflavone glycoside (such as daidzin, glycitin, and genistin) contents decreased, while aglycone (daidzein, glycitein, and genistein) contents increased. However, total ginsenoside contents were higher according to the ratio of MCG. After fermentation, ginsenoside Rg2, F2, and protopanaxadiol contents of cheonggukjang decreased. Conversely, ginsenoside Rg3 (2.5%: 56.51 → 89.43 μg/g, 5.0%: 65.56 → 94.71 μg/g, and 10%: 96.05 → 166.90 μg/g) and compound K (2.5%: 28.54 → 69.43 μg/g, 5.0%: 41.63 → 150.72 μg/g, and 10%: 96.23 → 231.33 μg/g) increased. The total phenolic and total flavonoid contents were higher with increasing ratios of MCG and fermentation (fermented cheonggukjang with 10% MCG: 13.60 GAE and 1.87 RE mg/g). Additionally, radical scavenging activities and ferric reducing/antioxidant power were significantly increased in fermented cheonggukjang. This study demonstrates that the quality of cheonggukjang improved, and cheonggukjang with MCG as natural antioxidants may be useful in food and pharmaceutical applications.

Molecular identification and morphological characterisation of multiple fungal pathogens of triticale in Northern Kazakhstan

Background and Aim. Тtriticale is classified as an amphidiploids and is the first grain crop created by humans, possessing high yield potential along with favorable biochemical and technological characteristics. For a long time, it was believed that triticale, during selection, inherited disease resistance from wheat and resistance to abiotic factors from rye. However, in recent years, there have been several reports that triticale is to fungal diseases, which reduces the quality of the harvested crop. The aim of our study is to examine and characterize the fungal pathogens of triticale in Northern Kazakhstan, and conduct molecular-genetic identification of the main fungal pathogens.MaterialsandMethods. The study was conducted of triticale from two varieties, Dauren and Rossika. Primary fungal isolation was carried out on agarized nutrient media, with preliminary identification using microscopy. Molecular genetic analysis was performed to determine the species of fungi. Results. During the study, we isolated five major fungal pathogens from different parts of the plant. Data on the percentage of infection by the main fungal pathogens were provided. Three of them are pathogens of alternariosis – Alternaria alternate (more common in grains 39%, in leaves and scales of seeds 19-21%), fusariosis – Fusarium tricinctum (occurrence: in roots 57%, in grains 17%, in leaves 10%) and helminthosporiosis – Bipolaris sorokiniana (occurrence in roots and leaves 0.83%) of grain crops, which can lead to a decrease and loss of yield due to their production of mycotoxins. A cultural and morphological description of the main fungal pathogens of grain crops was provided. Moleculargenetic identification was carried out using the ribosomal marker ITS (internal transcribed spacer).Conclusion. According to result of our research, we characterized and molecular-genetically identified the most common fungi found on different parts of the triticale plant.

Biocontrol Potential of the New Codling Moth Granulovirus (CpGV) Strains.

The use of CpGV strains as the basis for bioinsecticides is an effective and safe way to control Cydia pomonella. The research is aimed at the identification and study of new CpGV strains. Objects of identification and bioinformatic analysis: 18 CpGV strains. Sequencing was carried out on a NextSeq550. Genome assembly and annotation were carried out using Spades, Samtools 1.9, MinYS, Pilon, Gfinisher, Quast, and Prokka. Comparative genomic analysis was carried out in relation to the reference genome present in the «Madex Tween» strain-producer (biological standard) according to the average nucleotide identity (ANI) criterion. The presence/absence of IAP, cathepsin, MMP, and chitinase in the genetic sequences of the strains was determined using simply phylogeny. Entomopathogenic activity was assessed against C. pomonella according to the criterion of biological efficacy. Thus, molecular genetic identification revealed that 18 CpGV strains belong to a genus of Betabaculovirus. For all the strains under study ANI values of 99% or more were obtained, and the presence of the cathepsin, chitinase, IAP, and MMP genes was noted. The strains BZR GV 1, BZR GV 3, BZR GV 7, BZR GV 10, and BZR GV L-8 showed the maximum biological efficacy: 100% on the 15th day of observation. Strains BZR GV 4, BZR GV 8, and BZR GV 13 showed efficacy at the level of the «Madex Tween» preparation: 89.5% on the 15th day of observation. The strains with the highest mortality rate of the host insect were identified: BZR GV 9, BZR GV 10, BZR GV L-6, and BZR GV L-8.

Molecular occurrence and genetic identification of Babesia spp. and Theileria spp. in naturally infected cattle from Thailand.

Piroplasm including Babesia spp. and Theileria spp. in cattle can cause illness that affects livestock productivity, resulting in significant production losses, especially in tropical and subtropical regions such as Thailand. This study aimed to investigate the prevalence of bovine piroplasms and to identify these blood parasites based on the 18S ribosomal RNA gene in cattle in the northeastern part of Thailand. Piroplasmid infections among beef and dairy cattle were examined using nested PCR. Furthermore, amplicon DNA was sequenced and analyzed, and a phylogenetic tree was constructed to determine the genetic diversity and relationships of the parasite in each area. A total of 141 out of 215 (65.6%) cattle were positive for infection with Babesia or Theileria. DNA analysis revealed that infection by Babesia bigemina, Babesia bovis, Theileria orientalis, Theileria sinensis, and Theileria sp. were common piroplasms in cattle in this region, with a high sequence shared identity and similarity with each other and clustered with isolates from other countries. This study provides information on the molecular epidemiology and genetic identification of Babesia spp. and Theileria spp. in beef and dairy cattle to provide a better understanding of piroplasm infection in cattle in this region, which will help control these blood parasites. Moreover, this is the first report identifying T. sinensis circulating among Thai cattle.

Molecular genetic identification of Wuzhishan ant chicken, a newly discovered resource in China.

The Wuzhishan ant (MY) chicken exhibits significant differences from other chicken breeds. However, the molecular genetic relationship between the MY breed and other chicken breeds has not been assessed. Whole-genome resequencing was used to compare genetic diversity, nucleotide diversity, the fixation index, the linkage disequilibrium coefficient, and phylogenetic tree relationships between the MY breed and the Wenchang (WC), Danzhou (DZ), Bawangling (BW), and Longsheng Feng (LF) breeds. A total of 21,586,378 singlenucleotide polymorphisms and 4,253,341 insertions/deletions were screened out among the five breeds. The MY breed had the second highest genomic genetic diversity and nucleotide diversity and the lowest LD coefficient among the five breeds. Moreover, the phylogenetic tree analysis showed that individual birds of each breed clustered together with those of their respective breeds. Our data indicated that the MY breed is distinct from the other breeds and can be considered a new genetic resource.

First report of Macrophomina phaseolina causing сharcoal rot in soybean (Glycine max (L.) Merr.) plants in Uzbekistan.

The soybean production area is expanding in Uzbekistan. Soybeans were planted on an area of 10 thsd ha and the harvest amounted to 30 thsd metric tons in 2023 (IPAD, https://ipad.fas.usda.gov/countrysummary). Macrophomina phaseolina (Mp) is a soil- and seed-borne fungal pathogen causing economically important diseases of legume crops (Pennerman et al. 2024). Drought stress and a warm climate are favorable to this pathogen (Irulappan et al. 2022). Under these conditions, its microsclerotia survive for a longer period and become more virulent (Chamorro et al. 2015). In August 2022, typical symptoms of charcoal rot were observed in about 25% of "Orzu" soybean cultivar affecting 6 ha located on the experimental base "Durmon" of our institute. Diseased plants displayed the following charcoal rot symptoms: leaves turn yellow, then wilt, die, and remain attached to the plant; the lower portion of the stem and tap root have a light gray or ashy black discoloration; tiny black specks on the lower stem and root; after splitting the stem, it has the appearance of fine charcoal powder. In order to determine the causal agent of these symptoms, a total of 17 diseased plants were collected from focal lesions in soybean plantings. From each plant, twelve sections of stem and root tissue were selected, cut into small 5-mm pieces, and surface sterilized with 1% sodium hypochlorite for four minutes, then rinsed three times with sterile distilled water. The disinfected tissues were dried on sterile filter paper for 5 min and placed on PDA Petri plates, which were incubated in an incubation chamber for 3 days (16 h light (26oC) and 8 h dark (18oC)). Fungi were subsequently subcultured on PDA and incubated for 7 days to obtain pure cultures. Six monohyphal colonies were purified. The colonies showed dense growth, with a gray initial mycelium becoming darker with aging. After 8 days on PDA, black-colored microsclerotia with spherical to oblong shapes were observed. On average, they measured 60 µm in width and 130 µm in length (n = 30). From six isolated monohyphal colonies, one has been chosen for molecular-genetic identification. Molecular-genetic analysis was conducted by amplification and sequencing of the ITS region with the ITS1 and ITS4 primers (White et al. 1990). The resulting sequence was deposited in the NCBI database under accession number OQ073450. After BLAST analysis (Altschul et al. 1990) it was 100% identical with the reference sequences of Mp (accession MT039671, MT039663 and MH496040) isolated in sugar beet, maize and sunflower, respectively, from Serbia. In order to verify the pathogenicity, soybean seedlings (cv. Orzu) were dipped into spore suspension (1 × 107 spores/ml) of sequenced strain R-17 for 1 minute and transferred to a 15 cm diameter plastic pot with 350 g of sterilized soil mix. After 25 days, the inoculated plants showed classic charcoal rot symptoms, while the control plants remained healthy. The pathogen was successfully reisolated from the infected seedlings onto PDA, fulfilling Koch's postulate. The identity of the re-isolated strain was confirmed by morphological features and sequencing of the ITS region. It should be noted that in Uzbekistan, Mp has not been documented in any plants. Therefore, according to our knowledge, this is the first report of this fungus affecting soybean plants in Uzbekistan. Since molecular-genetic analysis of the R-17 strain showed clustering with strains from Serbia, we speculate that there may have been a recent introduction of Mp from Serbia into Uzbekistan. This assumption is additionally confirmed by the fact that Serbia is the largest seed exporter in Uzbekistan. The increase in charcoal rot disease poses a major challenge to soybean production in Uzbekistan. Understanding the genetic diversity of Mp can be utilized to manage this disease, improve soybean yield, and help soybean breeding programs in Uzbekistan.

The Diversity of Parasitoids and Their Role in the Control of the Siberian Moth, Dendrolimus sibiricus (Lepidoptera: Lasiocampidae), a Major Coniferous Pest in Northern Asia.

The Siberian moth, Dendrolimus sibiricus Tschetv., 1908 (Lepidoptera: Lasiocampidae) is a conifer pest that causes unprecedented forest mortality in Northern Asia, leading to enormous ecological and economic losses. This is the first study summarizing data on the parasitoid diversity and parasitism of this pest over the last 118 years (1905-2022). Based on 860 specimens of freshly reared and archival parasitoids, 16 species from two orders (Hymenoptera and Diptera) were identified morphologically and/or with the use of DNA barcoding. For all of them, data on distribution and hosts and images of parasitoid adults are provided. Among them, the braconid species, Meteorus versicolor (Wesmael, 1835), was documented as a parasitoid of D. sibiricus for the first time. The eastern Palaearctic form, Aleiodes esenbeckii (Hartig, 1838) dendrolimi (Matsumura, 1926), status nov., was resurrected from synonymy as a valid subspecies, and a key for its differentiation from the western Palaearctic subspecies Aleiodes esenbeckii ssp. esenbecki is provided. DNA barcodes of 11 parasitoid species from Siberia, i.e., nine hymenopterans and two dipterans, represented novel records and can be used for accurate molecular genetic identification of species. An exhaustive checklist of parasitoids accounting for 93 species associated with D. sibirisus in northern Asia was compiled. Finally, the literature and original data on parasitism in D. sibiricus populations for the last 83 years (1940-2022) were analysed taking into account the pest population dynamics (i.e., growth, outbreak, decline, and depression phases). A gradual time-lagged increase in egg and pupal parasitism in D. sibiricus populations was detected, with a peak in the pest decline phase. According to long-term observations, the following species are able to cause significant mortality of D. sibiricus in Northern Asia: the hymenopteran egg parasitoids Telenomus tetratomus and Ooencyrtus pinicolus; the larval parasitoids Aleiodes esenbeckii sp. dendrolimi, Cotesia spp., and Glyptapanteles liparidis; and the dipteran pupal parasitoids Masicera sphingivora, Tachina sp., and Blepharipa sp. Their potential should be further explored in order to develop biocontrol programs for this important forest pest.

Molecular genetic identification and certification of sugar beet hybrids using microsatellite markers

Molecular genetic identification and certification of sugar beet hybrids using microsatellite markers

Molecular Characterization and Genetic Identification of Pakistani Partridges Through DNA-Barcoding

Molecular Characterization and Genetic Identification of Pakistani Partridges Through DNA-Barcoding

Diversity of Arbuscular Mycorrhizal Fungi in Distinct Ecosystems of the North Caucasus, a Temperate Biodiversity Hotspot.

Investigations that are focused on arbuscular mycorrhizal fungus (AMF) biodiversity is still limited. The analysis of the AMF taxa in the North Caucasus, a temperate biodiversity hotspot, used to be limited to the genus level. This study aimed to define the AMF biodiversity at the species level in the North Caucasus biotopes. The molecular genetic identification of fungi was carried out with ITS1 and ITS2 regions as barcodes via sequencing using Illumina MiSeq, the analysis of phylogenetic trees for individual genera, and searches for operational taxonomic units (OTUs) with identification at the species level. Sequences from MaarjAM and NCBI GenBank were used as references. We analyzed >10 million reads in soil samples for three biotopes to estimate fungal biodiversity. Briefly, 50 AMF species belonging to 20 genera were registered. The total number of the AM fungus OTUs for the "Subalpine Meadow" biotope was 171/131, that for "Forest" was 117/60, and that for "River Valley" was 296/221 based on ITS1/ITS2 data. The total number of the AM fungus species (except for virtual taxa) for the "Subalpine Meadow" biotope was 24/19, that for "Forest" was 22/13, and that for "River Valley" was 28/24 based on ITS1/ITS2 data. Greater AMF diversity, as well as number of OTUs and species, in comparison with that of forest biotopes, characterized valley biotopes (disturbed ecosystems; grasslands). The correlation coefficient between "Percentage of annual plants" and "Glomeromycota total reads" r = 0.76 and 0.81 for ITS1 and ITS2, respectively, and the correlation coefficient between "Percentage of annual plants" and "OTUs number (for total species)" was r = 0.67 and 0.77 for ITS1 and ITS2, respectively. High AMF biodiversity for the river valley can be associated with a higher percentage of annual plants in these biotopes and the active development of restorative successional processes.

Primary Screening of Microorganisms against Meloidogyne hapla (Chitwood, 1949) under the Conditions of Laboratory and Vegetative Tests on Tomato.

Highly adapted obligate endoparasites of the root system, root-knot nematodes (Meloidogyne spp.), cause great damage to agricultural crops. Our research is aimed at the assessment of nematicidal activity and effectiveness of antagonist fungal and bacterial strains against the most common type of root-knot nematode in the south of Russia. By means of molecular genetic identification, it was found that in the south of Russia, the species Meloidogyne hapla Chitwood, 1949 and Meloidogyne incognita (Kofoid and White, 1919) Chitwood, 1949 cause galls on the roots of open-ground and greenhouse tomato. Screening of microbial agents against second-stage juvenile (J2) M. hapla was carried out in the laboratory. At the end of the experiment, two liquid fungal cultures of Paecilomyces lilacinus BK-6 and Metarhizium anisopliae BK-2 were isolated, the nematicidal activity of which reached 100.0 and 70.2%, and exceeded the values of the biological standard (Nemotafagin-Mikopro) by 38.4% and 8.8%. The highest biological efficacy was noted in the liquid cultures of P. lilacinus BK-6, M. anisopliae BK-2, and Arthrobotrys conoides BK-8 when introduced into the soil before planting tomato. The number of formed galls on the roots was lower in comparison with the control by 81.0%, 75.5%, and 74.4%.

Universal Panel of Insertion–Deletion Polymorphism for Human Genetic Identification and a Biochip-Based Kit <i>ChipID106</i> for This Purpose

The paper proposes a panel of 106 insertion–deletion (InDel) polymorphisms and practical testing of the method of their genotyping on biochips. Such fundamental properties of InDel markers as short length and low mutation rate provide them with significant advantages in expert practice over widely used tandem repeats (STRs). In this work, we analyzed the allele distribution of InDel polymorphisms in the five largest world populations (European, East Asian, South Asian, African and American), and selected markers that meet the following criteria: minor allele frequency of more than 0.30, physical distance between markers more than 3 million bp, the absence of polymorphisms, tandem repeats and palindromes in the flanking sequences, the proximity of the AT/GC ratio to 1. As a result, a panel of 106 polymorphisms was formed with an average frequency of the minor allele for all five populations of 0.396. For panel genotyping, a method was developed that included one-step multiplex PCR followed by hybridization on a biological microarray. The average amplicon length was 72 bp. On a sample of 201 residents of Moscow and St. Petersburg, the main characteristics of the formed panel were determined: the probability of a random match (MP) 1.89 × 10–43, the paternity exclusion potential (CPE) 0.99999999063. The proposed method is an alternative to molecular genetic identification of a person based on variations in the lengths of STR loci.

Prospects for diagnostics and treatment of neurofibromatosis type 1 in Russia

Purpose of the study. Analysis of available data on modern methods of diagnosis and treatment of neurofibromatosis type 1 (NF1) and their application in the Russian Federation. Material and Methods. The search for relevant sources was carried out in the Scopus, Web of Science, PubMed, Elibrary systems, including publications from February 1992 to December 2022. Of the 1873 scientific articles found, 48 were used to write a systematic review. Results. Neurofibromatosis type 1 (NF1) is caused by germline heterozygous mutations in the NF1 gene, which encodes the neurofibromin protein, which suppresses mitogen-activated signaling pathways necessary for cell proliferation. Clinical manifestations of NF1 are similar to Peutz–Jeghers, Laugier–Hunziker, Rusalkab–Muret–Smith, Bannayan–Zonnana, LEOPARD syndromes, neurofibromatosis type 2 and lipomatosis; therefore, to confirm the diagnosis, the most important criterion is the detection of a gene mutation by sequencing, since there are no mutagenesis hotspots in the NF1 gene. To detect 17q11.2 locus microdeletions, MLPA method is used. In Russia, such methods of molecular genetic identification of NF1 were carried out in Moscow and in the Republic of Bashkortostan. Surgical interventions using a neodymium laser and therapy with mitogen-activated protein kinase inhibitors are the most effective for the treatment of tumor syndrome. Scientific results of the use of a surgical laser in the treatment of plexiform neurofibromas and extramedullary tumors of the spinal cord have been published in Russia. Treatment of NF1 with selumetinib in Russia was announced by the interregional public organization for assistance to patients with neurofibromatosis “22/17”, which provides the drug to children with inoperable neurofibromas free of charge. Conclusion. In modern medicine, it is necessary to widely use methods for identifying mutations in the NF1 gene by creating universal panels of targeted sequencing. This will allow not only the differential diagnosis of NF1, but also the identification of the cause of chemoresistance of sporadic malignant neoplasms for the introduction of mitogen-activated protein kinase inhibitors in their treatment. Combination of this method with surgical excision of neurofibromas using a neodymium laser is optimal.

Development of an Integrated System for Molecular-Genetic Identification of <i>Yersinia pestis</i> Strains

The paper describes a developed comprehensive system for molecular-genetic identification of Yersinia pestis strains according to their appurtenance to certain subspecies, biovars, phylo-geographic populations, using realtime PCR (RT-PCR), allele-specific RT-PCR, and multiplex PCR with hybridization fluorescent registration of results on a solid substrate. Application of this system makes it possible to establish the appurtenance of Y. pestis strains to the following phylogenetic branches: 0.ANT1, 0.ANT2, 0.ANT3, 0.ANT5, 3.ANT, 4.ANT of antique biovar of the main subspecies; 2.MED0, 2.MED1, 2.MED2, 2.MED3, 2.MED4 of medieval biovar of the main subspecies; 1.IN1, 1.IN2, 1.IN3 of intermedium biovar of the main subspecies; 1.ORI1, 1.ORI2, 1.ORI3 of oriental biovar of the main subspecies; 0.PE3 (angolica subspecies), 0.PE7 (tibetica subspecies) and 0.PE10 (qinghaica subspecies). The first stage of the studies within the frames of the developed system is indication of plague agent using registered diagnostic drugs. The second stage is the determination of belonging to individual subspecies through RT-PCR or by the method of multiplex PCR system with hybridization-fluorescent registration of results on a solid substrate, which also allows for establishing to which biovars of the main subspecies and the main phylogenetic lines of the ancient biovar the strains belong. The third stage is the identification of strain appurtenance to phylogenetic branches by the AS-RT-PCR method. The designed complex system for molecular-genetic identification of Y. pestis strains can be applied at the regional and federal levels of the laboratory network of the Russian Federation for diagnostics of infectious diseases. Its use will considerably facilitate and increase the efficiency of intraspecific differentiation of Y. pestis strains within the framework of the epidemiological investigation of outbreaks or importation of strains of plague pathogen into the territory of the Russian Federation or during the certification of strains in collection activities.

Metrological Support of Nucleic Acid Sequence Analysis

Metrological support for the process of molecular genetic identification is proposed. An establishment of a nucleotide sequence is the main objective of the DNA/RNA analysis. Such nucleotide sequence provides key information about the role and function of nucleic acids in living systems, as well as the origin of biological objects during molecular genetic identification. The molecular genetic identification is based on the modern methods of studying DNA sequences, which are inherited by the living organisms from generation to generation. In some cases, comparison of DNA sequences is required to establish the authenticity of biological objects, as well as determine biological affiliation or kinship with other biological objects. The problems of metrological support of molecular genetic identification by Sanger DNA sequencing using fluorescent-labeled reaction terminators and capillary electrophoresis are considered. Methods and means of metrological support of the DNA/RNA analysis were developed, which include the determination of a nucleotide as a nucleic acid monomer, the use of a nucleotide sequence of nucleic acids used in certified methods and procedures, the use of a genetic analyzer as a measurement tool along with related auxiliary equipment, as well as the use of a standard sample of a fragment of human mitochondrial DNA has been developed and approved. A Nanofor 05 domestic genome analyzer was tested. The following two procedures were developed and certified: for measuring the nucleotide sequence of the section of the control region of mitochondrial DNA of fish (sturgeon and paddlefish families) by Sanger sequencing, and for measuring the nucleotide sequence of the 5' region of the COI gene of the mitochondrial DNA of aquatic biological resources by Sanger sequencing. Both measurement procedures are based on the use of fluorescent-labeled reaction terminators and capillary electrophoresis. The results are important for use in the DNA studies in the field of biological sciences, food industry, biotechnology, and DNA forensics.

Metrological support of sequence analysis of nucleic acids

Metrological support for the process of molecular genetic identification is provided. An establishment of a nucleotide sequence is the general aim in nucleic acids analysis. A nucleotide sequence of DNA/RNA is the key information which gives an idea of the role and functioning of nucleic acids in living systems, as well as it allows establishing the origin of biological objects during molecular genetic identification. The molecular genetic identification is based on modern methods of research in the sequencing of DNA, which is inherited from generation to next generation of living organisms. DNA sequence comparison in some cases is mandatory to establish the authenticity of biological objects and to determine biological affiliation or kinship with other biological objects. The problems of metrological support of molecular genetic identification by Sanger DNA sequencing using fluorescently labeled reaction terminators and the use of capillary electrophoresis on the example of fish identification are considered. Metrological support of the process includes the use of such definitions as a nucleotide (the nucleic acid monomer), a sequence of nucleotides of nucleic acids. Also, it involves the procedures used in certified methods, a standard sample of a known DNA sequence of an approved type, and a genetic analyzer.Standard Reference Materials of a fragment of human mitochondrial DNA was developed, approved, entered into the Federal registry. The tests of the domestic genetic analyzer Nanophore 05 were carried out. Two measurement procedures “The measurement methodology the partial nucleotide sequence of the control region of mitochondrial DNA of fish (families Acipenseridae and Polyodontidae) by Sanger sequencing with fluorescently-labeled terminators and using capillary electrophoresis” and “The measurement methodology the nucleotide sequence of the 5’ region of the mitochondrial COI gene of water biological resources by Sanger sequencing with fluorescently-labeled terminators and using capillary electrophoresis” were tested and certified. The results are relevant to research in biological sciences, the food industry, biotechnology, and DNA forensics.

MOLECULAR GENETIC IDENTIFICATION OF BACTERIA ISOLATED FROM GOAT MILK

In recent years there has been a steady trend towards an increase in the number of studies on the study of probiotics, which have a beneficial effect on the body: improve the intestinal microflora; contribute to the reduction of pathogenic bacteria; have the ability to produce substances with antimicrobial activity. In order to obtain probiotics from domestic raw materials, molecular genetic identification of bacterial strains was carried out. The object for the isolation of lactic acid bacteria was natural goat milk from the Almaty region, IE "Bekezhanova". Identification of bacterial strains was carried out on an ABI 3500 xL genetic analyzer (Applied Biosystems) using 16S primers 8F and 806R at the Scientific and Practical Center for Microbiology and Virology (Almaty). Phylogenetic analysis was performed using MEGA 6 software. Nucleotide sequence alignment was performed using the ClustalW algorithm. The results were obtained using the method of determining the direct nucleotide sequence of the 16S rRNA gene fragment, followed by comparison of the nucleotide identity with the sequences deposited in the international GenBank database. According to the results of the studies, the isolated strains of lactic acid bacteria according to the GenBank database were assigned to Lactobacillus fermentum (identity above 99.73%). These strains of microorganisms isolated from goat's milk may be promising for the production of domestic food products. On their basis it is proposed to create fermented milk products for preventive purposes.

Biological and molecular genetic properties of <i>Trichophyton benhamiae</i>, a new pathogen of dermatomycoses in cats

The results of isolation of two strains OVB_T. b-19 and OVB_T. b-20 of a new microscopic fungus species Trichophyton benhamiae from the samples of biological material from cats with clinical signs of dermatomycosis are presented.This type of fungus was isolated from domestic cats for the first time in Russia. Molecular genetic studies, species identification and determination of the properties of the isolated cultures were carried out using approved methodological recommendations and determinants of pathogenic and opportunistic fungi. The keratinolytic and biochemical activity, cultural-morphological (phenotypic) and molecular-genetic properties of T. benhamiae were studied. Both strains of the fungus were characterized by a variety of phenotypic properties: they formed colonies on the nutrient media that differed in morphology and color of aerial and substrate mycelium. They revealed the similarity of micromorphology: the presence of a septate bamboo-like mycelium with characteristic branching of two-layer macroconidia and microconidia. The studied strains were characterized by similar biochemical properties (pronounced saccharolytic and urease activities) and keratinolytic activity. The identified keratinolytic activity of the T. benhamiae strains indicates their etiological role in the development of dermatomycoses in domestic cats. The phenotypic characteristics fully corresponded to the culture of the microscopic fungus T. benhamiae. Molecular genetic studies revealed that microscopic fungi isolated from cats belonged to the genus Trichophyton, species Benhamiae. Molecular genetic studies established that the sequences of OVB_T. b-19 and OVB_T. b-20 strains that had been obtained were identical. Both strains are listed in the GenBank database with individual numbers in the international NCBI database, ON479483 and ON479484.