Molecular Biological Identification Research Articles

Isolation and identification of epiphytic Pichia kudriavzevii from loquat peels and investigation of its fermentation characteristics for liquor production.

During the process of fruit wine production, yeast plays a crucial role in influencing the taste, flavor, and overall quality of the wine. This study aims to enhance the flavor and quality of loquat wine by isolating strains of Pichia kudriavzevii (P. kudriavzevii) with desirable winemaking characteristics from loquat fruit fermentation broth. A total of 12 strains of P. kudriavzevii were isolated and subjected to morphological and molecular biological identification. Their fermentation performance, ethanol production, ester production, hydrogen sulfide production, killer activity, and tolerance were evaluated. The results revealed that strains Q-2, Q-9, Q-10, Q-12, Q-20, and Q-42 exhibited robust growth and strong tolerance under conditions of 40°C temperature, 12% ethanol concentration, 350g/L glucose concentration, and pH 2.8. Strain Q-42 demonstrated the strongest gas production capacity, killer activity, and good ester and ethanol production. As a highly active fermentation strain with excellent wine making characteristics, P. kudriavzevii Q-42 provides a valuable yeast resource for the industrial production of loquat wine and offers technical support for improving the overall quality of loquat wine.

High-precision identification of highly similar Pinelliae Rhizoma and adulterated Rhizoma pinelliae pedatisectae through deep neural networks based on vision transformers.

Pinelliae Rhizoma is a key ingredient in botanical supplements and is often adulterated by Rhizoma Pinelliae Pedatisectae, which is similar in appearance but less expensive. Accurate identification of these materials is crucial for both scientific and commercial purposes. Traditional morphological identification relies heavily on expert experience and is subjective, while chemical analysis and molecular biological identification are typically time consuming and labor intensive. This study aims to employ a simpler, faster, and non-invasive image recognition technique to distinguish between these two highly similar plant materials. In the realm of image recognition, we aimed to utilize the vision transformer (ViT) algorithm, a cutting-edge image recognition technology, to differentiate these materials. All samples were verified using DNA molecular identification before image analysis. The result demonstrates that the ViT algorithm achieves a classification accuracy exceeding 94%, significantly outperforming the convolutional neural network model's 60%-70% accuracy. This highlights the efficiency of this technology in identifying plant materials with similar appearances. This study marks the pioneer work of the ViT algorithm to such a challenging task, showcasing its potential for precise botanical material identification and setting the stage for future advancements in the field.

An outbreak of Galerina sulciceps-like (Galerina cf. sulciceps) mushroom poisoning

Objective Amatoxin-containing mushroom poisoning is a significant threat to public health worldwide. We report a mass poisoning of Galerina sulciceps-like mushrooms (Galerina cf. sulciceps) in Luzhou, Sichuan Province, China, aiming to offer insights for future prevention and treatment strategies. Methods We performed a retrospective survey of mass mushroom poisoning patients admitted to our hospital. The demographic data, clinical presentations, laboratory findings, therapeutic measures and prognostic information were collected and analyzed. We used the 2020 Chinese consensus on the clinical diagnosis and treatment of amatoxin-containing mushroom poisoning to assess the severity of poisoning. Mushrooms were examined through morphological analysis, molecular biology identification, and toxin detection. Results Our patient cohort consisted of nine males and six females, with mean (±SD) age of 34.9 ± 13.0 years. Gastrointestinal symptoms were the first to manifest, with mean (±SD) latency period of 13.4 ± 3.9 h. The majority of patients (86.7%) experienced nausea, vomiting, and diarrhea. Liver dysfunction was noted in 66.7% of patients, and thrombocytopenia was present in 26.7% of patients. In terms of the severity of poisoning, there were 10 mild cases and 5 severe cases. The mushrooms were provisionally labeled as Galerina cf. sulciceps, containing the toxins α-amanitin, β-amanitin, and γ-amanitin. All patients eventually recovered. Discussion We report what appears to be a new type of mushroom that is morphologically and phylogenetically similar to the known Galerina sulciceps, but further study is required to determine if it represents a distinct species. Conclusion This poisoning event was caused by unintentional ingestion of Galerina cf. sulciceps, an amatoxin-containing mushroom. Early symptoms are primarily gastrointestinal, with acute liver damage and coagulopathy being the main toxic effects. Thrombocytopenia is also prominent, particularly in severe cases. Accurate assessment and prompt, individualized, and intensive treatment are crucial for managing patients with acute Galerina cf. sulciceps poisoning effectively.

Molecular biological identification of a case with A223B subtype

To study the molecular basis for a proband with A subtype B of the ABO blood group and explore the influence of amino acid variant on the activity of glycosyltransferase (GT). A proband who had presented at the First Affiliated Hospital of Zhengzhou University on July 2, 2020 was selected as the study subject. Serological identification of the ABO blood groups of the proband and her family members were performed by gel card and test tube methods. The ABO gene of the proband was identified by PCR-sequence specific primers (PCR-SSP) and DNA sequencing. A 3D molecular homologous model was constructed to predict the impact of the variant on the stability of α-(1→3)-D-N-acetylgalactosamine transferase (GTA). The red blood cells of the proband, her mother and two younger brothers showed weak agglutination with anti-A and strong agglutination with anti-B. The sera showed 1~2+ agglutination with Ac and no agglutination with Bc. Based on the serological characteristics, the proband was identified as AwB subtype. Pedigree analysis suggested that the variant was inherited from her mother. The blood group of the proband was identified as A223B type by PCR-SSP. ABO gene sequencing analysis showed that the proband has harbored heterozygous variants of c.297A>G, c.467C>T, c.526C>G, c.657C>T, c.703G>A, c.796C>A, c.803G>C, c.930G>A and c.1055insA. Based on the results of clone sequencing, it was speculated that the genotype was ABO*A223/ABO*B.01. There were c.467C>T and c.1055insA variants compared with ABO*A1.01, and c.1055insA variant compared with ABO*A1.02. Homologous modeling showed that the C-terminal of A223 GT was significantly prolonged, and the local amino acids and hydrogen bond network have changed. Above results revealed the molecular genetics mechanism of A223B subtype. The c.1055insA variant carried by the proband may affect the enzymatic activity of GTA and ultimately lead to weakening of A antigen.

Effect of carvacrol on the inhibitory of gas-producing spoilage microbes and volatile flavor in fermented pepper (Capsicum annuum L.)

In this study, two gas-producing spoilage microbes, namely CQ17 and CQ22, were isolated from fermented pepper. Combining the physiological and biochemical characteristics, molecular biological identification, and specific colony morphology, CQ17 was identified as Pichia manshurica while CQ22 was identified as Lentilactobacillus buchneri. Subsequently, our findings indicated that the CQ17 and CQ22 strains exhibited resistance to high temperature, low-pH, and high salinity environments. Meanwhile, our findings revealed that carvacrol, a commonly utilized preservative, exhibited remarkable inhibitory activities against Pichia manshurica and Lentilactobacillus buchneri with the EC50 values of 0.28 and 0.68 mg/L respectively, effectively suppressing the growth of gas-producing strains to prolong the shelf life of fermented pepper. Simultaneously, volatile components of the fermented pepper were analyzed using HS-GC-IMS technology resulting in identification of 55 volatile flavor compounds including acids, alcohols, esters, aldehydes, ketones, alkenes, and other compounds. Among them, (R/S)-linalool, 3-methyl-1-butanol acetate butanoic acid ethyl ester, 2-methyl butanoic acid ethyl ester, and ethyl 2-methylpropionate were identified as crucial components contributing to sensory attributes in fermented pepper as well as (E)-3-hexen-1-ol and l-Pentanol exhibited the highest VIP values and can be considered as the best reliable markers for differentiating fermented pepper samples with the addition of carvacrol as a preservative.

Recent research progress of soil nematode ecology in China.

Soil nematodes are a crucial component of belowground ecosystems. Soil nematode ecology, the studies of community distribution, structural composition, ecological functions, and interaction mechanisms with environment, has always been a hot spot in soil biology research. We systematically elaborated soil nematodes' high diversity and various diet, their advantages as bioindicator and model organisms, and their roles in biological control, ecological functions and soil health. Then, we reviewed the research progress of soil nematode ecology in China, including molecular biology identification methods, responses to global changes, food web structure and function, aboveground and belowground diversity relationship, and large-scale diversity pattern. We put forward the development trend of soil nematology, focusing on the high-throughput sequencing technology in nematode identification and quantification, the necessity of establishing a universal analysis platform to promote soil nematode research, and the importance of strengthening large-scale soil nematode survey.

Identification of Boveria labialis parasitism in the respiratory tree of the Cultured Sea cucumber, Apostichopus japonicus

Aquaculture of the sea cucumber Apostichopus japonicus has emerged as a pivotal industry in northern China in the early 21st century. It is estimated that the cultivation area for this species spans 250,356 ha, yielding an annual production of 248,508 tons. The swift growth and intensification of sea cucumber farming practices have triggered a spectrum of diseases, resulting in significant economic detriment. This study offers an exhaustive account of a particular ciliate species, identified through smear and histopathological observations, hematoxylin-eosin staining, scanning electron microscopy, and molecular biology techniques, detailing its morphology, size, cellular architecture, and reproductive mode. The ciliate exhibits a torch-like shape, measuring 40–82 μm in length and 12–35 μm in width. It is characterized by the presence of both a macronucleus and a micronucleus. The anterior end is slender and blunt, while the posterior end is the widest part of the organism. A peristomal disc (PD) is situated at the body's terminus, with the mouth positioned centrally on the PD and a lip-like projection (6–10 μm in length) extending from one side. The organism's surface, particularly the area surrounding the oral region, is adorned with an abundance of long cilia. A single contractile vacuole is observable at the aboral end of the ciliate. It possesses 17–21 somatic kineties, complemented by 3 membranelles (M1, M2, M3) and a paroral membrane (PM) within the buccal cavity. One contractile vacuole was seen at the aboral end. There were 17–21 somatic kineties, while three membranes (M1, M2, M3) and a paroral membrane (PM) located within the buccal cavity. The first somatic kinety is notably more extended than the others, uniquely reaching a length of 10 μm around the PM. The PM, comprised of 2 somatic kineties in a “zig-zag” formation, follows a spiral path, making approximately 360-degree turns in conjunction with M1, M2, and M3, and culminates at the mouth depression. The ciliate reproduces through transverse binary fission or sexual conjugation. Based on these distinguishing features and molecular biological identification results, the ciliate is provisionally classified within the genus Boveria, as Boveria labialis. Histopathological examination has shown that these ciliates are predominantly found within the respiratory trees of their hosts, where they inflict damage to the epithelial tissues. This damage manifests as cell necrosis, structural disintegration, and the shedding of cells from the respiratory tree's epithelial lining. In severe cases, the affected respiratory tree and other viscera may be expelled. Epidemiological studies have indicated that infected individuals do not present with any overt external lesions. The findings of this research are instrumental for the management of diseases and the promotion of health within the sea cucumber aquaculture industry.

Development of a DNA macroarray for the molecular biological identification of trade-relevant tropical CITES timber species and their look-alikes

Abstract The control authorities of timber trade lack quick and easy methods to verify the legality of the traded product. This includes the clear identification of the timber species. In this study, a simple genetic method, the macroarray technique, was modified and optimised for this purpose. The internal transcribed spacer (ITS) was used as barcode region. Specific probes were designed and tested using this barcode of trade-relevant, CITES protected wood species and their look-alikes. The results reveal that 61 of these probes are suitable for identification purposes. Hence, 32 of the 50 investigated species can be clearly identified using the developed macroarray. Additional 15 species are represented by probes in groups of two to three species, which enables a delimitation of the species present. For four species, no identification was possible applying the probes created. The findings indicate the potential of time and cost savings compared to currently established methods in species control in the timber trade.

Distribution of Ulva macroalgae before and after the outbreak of the Yellow Sea green tide in aquaculture ponds and rivers nearshore Jiangsu, China

Green tide caused by the extensive proliferation of Ulva macroalgae in the Yellow Sea has been continuously occurring for 17 years. Previous studies indicate the Neopyropia aquaculture area in Jiangsu to be the main source of green tides in the Southern Yellow Sea. However, whether there are additional supplementary sources for the green tide in the Yellow Sea remains to be studied. This study conducted sampling of Ulva macroalgae in 14 aquaculture ponds and rivers nearshore Jiangsu in February and November in 2022. The molecular biology identification of samples through ITS and 5S indicates that the Ulva macroalgae in aquaculture ponds and rivers are composed of Ulva prolifera, Ulva linza, Ulva simplex, Ulva torta, Ulva flexuosa, and Ulva meridionalis. The results of micropropagules indicate that the abundance of micropropagules in aquaculture ponds is significantly higher than in rivers. In both February and November, the points with the highest abundance of micropropagules were located in aquaculture ponds, reaching 2090 inds L−1 and891 inds L−1, respectively. This study found that before and after the outbreak of green tide, the dominant species of green tide outbreak,5S-II U. prolifera,existed in aquaculture ponds and rivers nearshore Jiangsu. 5S-II U. prolifera in aquaculture ponds and rivers may have a potential impact on the outbreak of green tide in the Yellow Sea.

Screening of Endophytic Antagonistic Bacteria in Wheat and Evaluation of Biocontrol Potential against Wheat Stripe Rust.

Wheat stripe rust is globally one of the most important diseases affecting wheat. There is an urgent need to develop environmentally safe and durable biological control options to supplement the control that is achieved with breeding and fungicides. In this study, endophytic bacteria were isolated from healthy wheat through the tissue separation method. Antagonistic endophytic bacteria were screened based on the control effect of urediniospore germination and wheat stripe rust (WSR). The taxonomic status of antagonistic strains was determined based on morphological, physiological, and biochemical characteristics and molecular biological identification (16S rDNA and gyrB gene sequence analysis). Finally, the potential growth-promoting effect of different concentrations of antagonists on wheat seedlings and the biological control effect of WSR were studied. A total of 136 strains of endophytic bacteria belonging to 38 genera were isolated. Pseudomonas was the most common bacterial genus, with 29 isolates (21%). The biological control effect of different isolates was assessed using an urediniospore germination assay. The isolate XD29-G1 of Paenibacillus polymyxa had the best performance, with 85% inhibition of spore germination during primary screening. In the deep screening, the control effect of XD29-G1 on wheat stripe rust was 60%. The antagonist XD29-G1 promoted the germination of wheat seeds and the growth of wheat seedlings at a solution dilution of 10-7 cfu/mL. The pot experiment results showed that different dilution concentrations of the strain had different levels of antibacterial activity against WSR, with the concentration of 10-1 cfu/mL having the best control effect and a control efficiency of 61.19%. XD29-G1 has better biological control potential against wheat stripe rust.

Modulation of the rat intestinal microbiota in the course of Anisakis pegreffii infection.

Anisakis are globally distributed, marine parasitic nematodes that can cause human health problems, including symptoms such as vomiting, acute diarrhea, and allergic reactions. As parasitic nematodes that primarily affect the patient's digestive tract, intestinal helminths can interact directly with the host microbiota through physical contact, chemicals, or nutrient competition. It is widely accepted that the host microbiota plays a crucial role in the regulation of immunity. Nematodes collected from the abdominal cavity of marine fish were identified by molecular biology and live worms were artificially infected in rats. Infection was determined by indirect ELISA based on rat serum and worm extraction. Feces were collected for 16S rDNA-based analysis of microbiota diversity. Molecular biology identification based on ITS sequences identified the collected nematodes as A. pegreffii. The success of the artificial infection was determined by indirect ELISA based on serum and worm extraction from artificially infected rats. Microbiota diversity analysis showed that a total of 773 ASVs were generated, and PCoA showed that the infected group was differentiated from the control group. The control group contained five characterized genera (Prevotellaceae NK3B31 group, Turicibacter, Clostridium sensu stricto 1, Candidatus Stoquefichus, Lachnospira) and the infected group contained nine characterized genera (Rodentibacter, Christensenella, Dubosiella, Streptococcus, Anaeroplasma, Lactococcus, Papillibacter, Desulfovibrio, Roseburia). Based on the Wilcoxon test, four processes were found to be significant: bacterial secretion system, bacterial invasion of epithelial cells, bacterial chemotaxis, and ABC transporters. This study is the first to analyze the diversity of the intestinal microbiota of rats infected with A. pegreffii and to determine the damage and regulation of metabolism and immunity caused by the infection in the rat gut. The findings provide a basis for further research on host-helminth-microbe correlationships.

Screening of a Saccharomyces cerevisiae Strain with High 3-Methylthio-1-Propanol Yield and Optimization of Its Fermentation Conditions.

3-Methylthio-1-propanol (3-Met) is an important flavor compound in various alcoholic beverages such as Baijiu and Huangjiu. To maintain the content of 3-Met in these alcoholic beverages, it is necessary to screen a micro-organism with high yield of 3-Met from the brewing environment. In this study, the ability of yeast strains from the Baijiu brewing to produce 3-Met was analyzed, aiming to obtain yeast with high-yield 3-Met, and its fermentation conditions were optimized. Firstly, 39 yeast strains were screened using 3-Met conversion medium. The results showed that the majority of the strains from Baijiu brewing sources could produce 3-Met, and nearly half of the strains produced more than 0.5 g/L of 3-Met. Among these, yeast F10404, Y03401, and Y8#01, produced more than 1.0 g/L of 3-Met, with yeast Y03401 producing the highest amount at 1.30 g/L. Through morphological observation, physiological and biochemical analysis, and molecular biological identification, it was confirmed that yeast Y03401 was a Saccharomyces cerevisiae. Subsequently, the optimal fermentation conditions for 3-Met production by this yeast were obtained through single-factor designs, Plackett-Burman test, steepest ascent path design and response surface methodology. When the glucose concentration was 60 g/L, yeast extract concentration was 0.8 g/L, L-methionine concentration was 3.8 g/L, initial pH was 4, incubation time was 63 h, inoculum size was 1.6%, shaking speed was 150 rpm, loading volume was 50 mL/250 mL, and temperature was 26 °C, the content of 3-Met produced by S. cerevisiae Y03401 reached a high level of 3.66 g/L. It was also noteworthy that, in contrast to other study findings, this yeast was able to create substantial amounts of 3-Met even in the absence of L-methionine precursor. Based on the clear genome of S. cerevisiae and its characteristics in 3-Met production, S. cerevisiae Y03401 had broad prospects for application in alcoholic beverages such as Baijiu.

Isolation and identification of non‐Saccharomyces yeasts and their flavour characteristics while brewing Yinhong plum wine

AbstractThe objective of this study was to screen non‐Saccharomyces yeast suitable for enhancing the aroma of Yinhong plum wine. Five non‐Saccharomyces yeasts with strong ester‐producing ability, namely, Wa3 (Wickerhamomyces anomalus), Hu12 (Hanseniaspora uvarum), Pk2A2, PkW2 and PkY2 (Pichia kluyveri), were selected from various naturally fermented fruit juices for molecular biological identification, analyses of physiological characteristics and tolerance and determination of their effects on the flavour of Yinhong plum wine. Analysis of brewing characteristics showed that they differed in their abilities of producing acetic acid, hydrogen sulfide, killer activity and tolerance. Among them, Wa3 showed the best tolerance to high concentrations of alcohol, sugar and SO2. Compared to the control Saccharomyces cerevisiae FX10, Yinhong plum wine fermented with non‐Saccharomyces yeast exhibited a decrease in alcohol content, while residual sugar, glycerol content and the types and quantities of volatile compounds all showed an increase. Among the fermented wines, PkY2 generated the highest content of ester compounds in the fermented wine, which was 5.66 times higher than that generated by the control. The compounds produced by PkY2 were closely related to various ethyl and acetate odour‐active compounds (odour‐active value >1), which could impart a rich floral and fruity aroma to Yinhong plum wine. Sensory analysis revealed that both floral and fruity aromas were significantly increased in Yinhong plum wine fermented by non‐Saccharomyces yeasts, with the highest scores of floral and fruity aromas for PkY2. In conclusion, a Pichia kluyveri strain, PkY2, with excellent brewing characteristics and potential for enhancing the aroma of Yinhong plum wine was identified.

Optimizing mycelial protein yield in Pleurotus djamor via ARTP mutagenesis and hybridization strategies

With the world’s population rapidly increasing, the demand for high-quality protein is on the rise. Edible fungi breeding technology stands as a crucial avenue to obtain strains with high yield, high-quality protein, and robust stress resistance. To address the protein supply gap, Atmospheric and Room Temperature Plasma (ARTP) mutagenesis, and spore hybridization techniques were employed to enhance Pleurotus djamor mycelium protein production. Beginning with the original strain Pleurotus djamor JD-1, ARTP was utilized to mutate spore suspension. The optimal treatment time for Pleurotus djamor spores, determined to achieve optimal mortality, was 240 s. Through primary and secondary screenings, 6 mutant strains out of 39 were selected, exhibiting improved protein yield and growth rates compared to the original strain. Among these mutagenic strains, 240S–4 showcased the highest performance, with a mycelial growth rate of 9.5±0.71 mm/d, a biomass of 21.45±0.54 g/L, a protein content of 28.75±0.92%, and a remarkable protein promotion rate of 128.03±7.29%. Additionally, employing spore hybridization and breeding, 7 single-nuclei strains were selected for pin-two hybridization, resulting in 21 hybrid strains. The biomass and protein content of 9 hybrid strains surpassed those of the original strains. One hybrid strain, H-5, exhibited remarkable mycelial protein production, boasting a mycelial growth rate of 26.5±0.7 mm/d, a biomass of 21.70±0.46 g/L, a protein content of 28.44±0.22%, and a protein promotion rate of 128.02±1.73%. Notably, both strains demonstrated about a 28% higher mycelial protein yield than the original strains, indicating comparable effectiveness between hybrid breeding and mutagenesis breeding. Finally, we analyzed the original and selected strains by molecular biological identification, which further proved the effectiveness of the breeding method. These findings present novel insights and serve as a reference for enhancing edible fungi breeding, offering promising avenues to meet the escalating protein demand.

Recovery and characterization of β-glucosidase-producing non-Saccharomyces yeasts from the fermentation broth of Vitis labruscana Baily × Vitis vinifera L. for investigation of their fermentation characteristics.

The present study focuses on investigating 60 strains of yeast isolated from the natural fermentation broth of Vitis labruscana Baily × Vitis vinifera L. These strains underwent screening using lysine culture medium and esculin culture medium, resulting in the identification of 27 local non-Saccharomyces yeast strains exhibiting high β-glucosidase production. Subsequent analysis of their fermentation characteristics led to the selection of four superior strains (Z-6, Z-11, Z-25, and Z-58) with excellent β-glucosidase production and fermentation performance. Notably, these selected strains displayed a dark coloration on esculin medium and exhibited robust gas production during Duchenne tubules' fermentation test. Furthermore, all four non-Saccharomyces yeast strains demonstrated normal growth under specific conditions including SO2 mass concentration ranging from 0.1 to 0.3g/L, temperature between 25 and 30°C, glucose mass concentration ranging from 200 to 400g/L, and ethanol concentration at approximately 4%. Molecular biology identification confirmed that all selected strains belonged to Pichia kudriavzevii species which holds great potential for wine production.

Investigation on screening, identification, and fermentation characteristics of Yunnan olive in the fermented liquid utilizing five strains of Saccharomyces cerevisiae.

Refined indigenous Saccharomyces cerevisiae can enhance refinement, sophistication, and subtlety of fruit wines by showcasing exceptional regional characteristics. In order to identify exceptional indigenous S. cerevisiae strains from Yunnan olive, this study isolated 60 yeast strains from wild Yunnan olive fermentation mash. The five S. cerevisiae strains were subjected to morphological and molecular biological identification, followed by evaluation of their fermentation performance, ethanol production capacity, ester production capacity, H2S production capacity, killing capacity, and tolerance. Strains LJM-4, LJM-10, and LJM-26 exhibited robust tolerance to 6% ethanol volume fraction, pH 2.8, sucrose concentration of 400g/L, SO2 concentration of 0.3g/L, glucose concentration of 400g/L at both 40°C and 15°C. Additionally, strain LJM-10 demonstrated a faster fermentation rate compared to the other strains. Among the tested S. cerevisiae strains evaluated in this study for olive wine fermentation process in Yunnan region; strain LJM-10 displayed superior abilities in terms of ester and ethanol production while exhibiting the lowest H2S production levels. These findings suggest that strain LJM-10 holds great potential as an excellent candidate for optimizing fruit wine S. cerevisiae fermentation processes in Yunnan olive fruit wine.

Analysis of the problem of molecular identification of wild (wtCT), plasmidless (p-CT) and Swedish (SE-nvCT) variants of Chlamydia trachomatis in Belarus

To date, it is known that the population of Chlamydia trachomatis is genetically heterogeneous. Along with the originally described wild type (wtCT), mutant variants (mtCT) have been found in the world: plasmidless (p-CT), Swedish (SE-nvCT), Mexican (MX-nvCT), Finnish (FI-nvCT), with different virulence and tropicity to various organs and tissues. These variants may escape PCR diagnostics due to the absence of targets or the occurrence of changes in them, which makes it ineffective to use a number of diagnostic test systems for pathogen detection.Isolates of C. trachomatis collected on the territory of the Republic of Belarus during the period 2013–2022 in reproductive age persons with inflammatory urogenital tract diseases were analyzed. It was found that the dominant pathogen genovariant is the wild type wtCT ‒, approximately 93 %. Mutant strains that make up about 7 % of the pathogen population are represented by p-CT and SE-nvCT genovariants. There were no cases of identification of MX-nvCT and FI-nvCT genovariants in the analyzed sample of C. trachomatis isolates.It is necessary to further optimize the tactics of molecular biological identification of various C. trachomatis genovariants for effective microorganism detection and study of the chlamydial urogenital infection pathogenesis.

First report of anthracnose caused by Colletotrichum karstii on Dalbergia odorifera in China.

Dalbergia odorifera (Family: Fabaceae) is a national second-grade protected tree in China with high medicinal and economic value (Zhao et al., 2020). In July, 2022, a leaves spot disease on D. odorifera with typical anthracnose symptoms was observed in plantations in Haikou (110.319153°E, 19.072900°N), Dongfang (108.630297°E, 19.103838°N) and Qiongzhong (109.704460°E, 19.088440°N), Hainan Province, China. Disease incidence was 7.5% (n = 50 plants). Early symptoms of infected leaves were small and round dark brown spots, which developed into larger irregular necrotic lesions and leaves withered. Leaf tissues (5×5 mm) at the disease-health junction of spots from 19 leaves were sterilized with 2.5% sodium hypochlorite for 1 min, and rinsed with sterile distilled water three times. These sterilized tissues were placed on potato dextrose agar (PDA) and incubated at 28 ℃ for 5 d. 7 strains of fungi with similar morphology were isolated, and 3 single-hyphal isolates (HHL01, HHL02 and HHL03) from each location were selected for further study. Colonies on PDA were fluffy orange-yellow mycelium. Conidia were aseptate, cylindrical, smooth-walled, straight, hyaline with both ends bluntly rounded, 11.82 to 15.77 × 3.87 to 6.71 μm (n = 100; average = 13.75 × 5.52 μm). Appressoria formed on slides, measured 5.54 to 10.64 × 4.19 to 7.41 μm (n = 30; average = 8.06 × 5.97 μm) were brown to black, elliptical to irregular. For molecular biological identification, the genomic DNA of three isolates was extracted by fungal genomic DNA extraction kit (Tiangen Biotech (Beijing) Co., Ltd.). The partial sequences of internal transcribed spacer region (ITS; ITS1/ITS4), glyceraldehyde-3-phosphate dehydrogenase (GAPDH; GDF1/GDR1), actin (ACT; ACT512F/ACT783R), β-tubulin (TUB2; TI/Bt2b) and calmodulin (CAL; CL1C/CL2C) were amplified and sequenced by Sangon Biotech (Shanghai) Co., Ltd (Carbone and Kohn, 1999; Weir et al., 2012). The sequences were deposited as GenBank Accession Nos. OR018110-OR018112 (ITS); OR050529-OR050537 (GAPDH, ACT and CAL) and OR192168-OR192170 (TUB). BLASTn results showed these sequences were more than 99% identity with the strain of C. karstii CORCK1 (GenBank Accession Nos. HM585406, HM585387, HM581991, HM585424 and HM582010, respectively). Multi-locus phylogenetic tree of Colletotrichum spp. showed that those three isolates were sister to C. karstii based on the maximum likelihood and bayesian inference methods. To verify pathogenicity, 2 mL spore suspension (1 × 106conidia/ml) of the isolates was sprayed on each leaves of 1-year-old D. odorifera plants, and sterile distilled water was similarly sprayed on other leaves as a negative control. The plants were incubated in a greenhouse under 90% ± 5% RH at 28 °C. Light brown small round necrotic patches developed 3 days after inoculation, while the control was asymptomatic. Photographs were taken on the fifth day after inoculation. The fungi were re-isolated from the diseased leaves and identified by morphological characterization and molecular identification, fulfilling Koch's postulates. C. karstii has been reported causing leaf rot of Carissa grandiflora in Spain (Garcia-Lopez et al., 2021), and anthracnose caused by C.tropicale was reported on D. odorifera (Yi et al., 2023). To our knowledge, this is the first report of Dalbergia odorifera leaf spot disease caused by Colletotrichum karstii. This finding provides an important basis for further research on the control of the disease.

Isolation, identification, and pathogenicity of Pseudomonas glycinae causing ginseng bacterial soft rot in China

By tissue separation method, tie-back experiment, and hypersensitive response test in potato, strain XJFL-1 was isolated and identified as the pathogen of ginseng bacterial soft rot in Liaoning Provence, China. The morphological characteristics of XJFL-1 were conformed to the Pseudomonads genus. Microbial fatty acid identification showed the principal cellular fatty acid traits of XLFJ-1 corresponded with Pseudomonas spp. API 50CH test results allowed the differentiation of strain XJFL-1 and MS586T from other closely related Pseudomonas species. The molecular identification, including 16S rRNA analysis and multilocus sequence typing (MLST) analysis, showed that XJFL-1 was in the same branch as P. glycinae MS586T.The genome of XJFL-1 was 6,296,473 bp, with an average guanine/cytosine (G + C) content of 60.72 %. Comparative genomics analysis using ANIb and GGDC algorithms indicated that the maximum value was observed between XJFL-1 and P. glycinae MS586T.The above morphological, cell morphology, and molecular biological identification results supported to identification of XJFL-1 as P. glycinae.This is the first report of P. glycinae as the plant pathogen causing ginseng bacterial root rot in China, which complements the biological significance of the species to a certain extent, enriches the pathogens of ginseng bacterial soft rot, and provides a theoretical basis for further investigation.

First Report of the guava root-knot nematode (Meloidogyne enterolobii) on Selenicereus costaricensis in Guangxi, China.

Pitaya (Selenicereus costaricensis), a tropical and subtropical fruit of Cactaceae family, become very popular in the fruit consumer market in recent years. In June 2022, plant stunting, reduced yields and galled root symptoms were observed on S. costaricensis plants sampled from a commercial production base in Wuming County (23°10'36.67″ N; 108°40'43.24″ E), Guangxi autonomous region, China. The area of S. costaricensis field we investigated was about 19.9 ha. The incidence of root-knot nematode disease was almost 60%. Roots of twenty S. costaricensis plants were dug up, and many root knots and egg masses were observed. The roots with galls were collected, nematodes at different stages were collected and morphologically identified. Females were annulated, pearly white and globular to pear-shaped. The perineal pattern was oval shaped with the dorsal arch being moderately high to high. Average length of adult females (n = 20): body = 614.4 ± 57.3 μm, stylet lengths = 15.1 ± 0.9 μm, dorsal esophageal gland orifice (DGO) = 4.7 ± 0.6 μm. The tail of the second stage juvenile (J2) was very thin with a bluntly pointed tip. The hyaline tail terminus was clearly defined. Average length of J2 (n = 20): body = 469.5 ± 36.7 μm, stylet lengths = 14.7 ± 0.5 μm, DGO = 3.5 ± 0.4 μm, tail lengths averaged = 43.6 ± 9.7 μm. The males were vermiform, annulated, slightly tapering anteriorly, bluntly rounded posteriorly. Typical characteristics of Meloidogyne enterolobii observed were consistent with those previously described by Yang & Eisenback (1983) and Bulletin (2016). J2s hatched from an individual egg mass were collected for DNA extraction and used for molecular biological identification. The specific primers of M. enterolobii, Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC), was used to validate the pathogen (Long et al. 2006). Approximately 236 bp of the target product was amplified, whereas no product was obtained from M. incognita. Further, the rDNA gene sequences (ITS; ITS1_5.8S_ITS2) and large subunit rDNA gene were amplified by the primers V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al. 1992) and D2A/D3B (ACAAGTACCGTGAGGGAAAGT/TCGGAAGGAACCAGCTACTA), respectively (Subbotin et al. 2006). The target sequences of 765 bp (GenBank accession no. OQ512155) and 759 bp (OQ512743) were recorded in the NCBI with GeneBank. The sequences showed 100% identity with M. enterolobii in ITSs (KJ146863, JQ082448) and D2/D3 (MF467276, OL681885). To verify reproduction on S. costaricensis (Jindu 1), twelve ten-week-old seedlings (12 pots) cultured on a sterile substrate soil were inoculated with 5,000 J2s from the original population in a greenhouse at 26 ˚C. Noninoculated control were set up at the same time. After 8 weeks, the noninoculated plants (n = 12) did not present galls in the roots. All inoculated plants had galled roots and showed dwarf plant. The average reproductive factor obtained was 11.6 and the mean root gall rating of the samples was 5.3 (rating scale of 0 to 10), confirming the pathogenicity of M. enterolobii to S. costaricensis. The red dragon fruits (Hylocereus polyrhizus) in Hainan Island (China) were reported infected by M. enterolobii in previous report (Long et al. 2022). To our knowledge, this is the first report of M. enterolobii parasitizing S. costaricensis in Guangxi, China. This finding has important implications for the control of M. enterolobii at the place of discovery, which is the major fruit production area.