Modified CTAB Protocol Research Articles

Optimization of the DNA isolation procedure for assessing the genetic diversity of essential oil roses (Rosa L.)

Background. High content of organic compounds that worsen nucleic acid purification in aromatic plants, as well as the use of such toxic substances as phenol and mercaptoethanol in many protocols for plant DNA isolation, make it advisable to take the above disadvantages into account when optimizing the DNA extraction technique for the work with essential oil rose plants. Material and methods. Rose accessions from the Crimean Federal University’s Botanical Garden, and those from the collection held by the Research Institute of Agriculture of Crimea were included in the study. DNA extraction was done according to a modified CTAB protocol. Effectiveness of the technique was assessed using spectrophotometry, horizontal electrophoresis, and ISSR-PCR. Results. DNA preparations extracted with the modified technique were well visualized on the electropherogram and demonstrated high spectrophotometric values. DNA content was twice as high in preparations isolated with an extraction buffer with PVP, compared to a PVP-free buffer. The concentration was also higher in DNA extracts from stems than that from leaves. Purity parameters expressed by the absorption ratios at wavelengths A260/280 and A260/230 were again higher for DNA extracts from stems isolated with an enriched buffer, the A260/230 ratio falling within the normal range only in DNA extracted from stems in the presence of PVP. Besides, DNA extracts were effectively purified from proteins without phenol or mercaptoethanol, due to double rinsing with a chloroform/isoamyl alcohol (24 : 1) mixture. Conclusion. Using rose stem tissues as the research material, adding 2% PVP to the extraction buffer, and twofold rinsing with a chloroform/isoamyl alcohol mixture made it possible to obtain DNA extracts with high concentrations and purity indices within normal ranges suitable for the ISSR analysis of essential oil rose genetic diversity.

Phylogeography of anabas testudineus bloch, 1792 (pisces: anabantidae) in asia

Anabas testudineus, the climbing perch, is a valuable and well-liked freshwater fish with significant commercial worth. This fish is found in Indonesia and other parts of Asia. Nonetheless, there hasn't been much research done on the genetic relationships across Asian populations of climbing perch. Thus, the aim of this work was to use the mitochondrial COI gene to examine the phylogeography of A. testudineus in freshwater Asia. The population sample was taken from South Aceh, Indonesia. The sample was extracted using a modified C-TAB protocol. In all, 48 sequences from the Genbank and three sequences from South Aceh were included in this investigation. Seven samples came from Indonesia, three from Malaysia, nine from Philippines, seven from Vietnam, eight from Thailand, ten from India, and four from Bangladesh. According to the findings, the sequences formed 17 different haplotypes. For every population, the haplotype diversity (Hd) value is 0.897. The genetic distance measuring the closest populations is 0.0007 between Indonesia and Philippines, whereas Indonesia and Vietnam populations are the furthest apart, at 0.0904. Between 0 and 0.0157 is the genetic distance within the population. Thus, the populations of A. testudineus in Aceh and Indonesia and the Philippines are genetically more similar.

Rapid genomic DNA extraction for Soybean (Glycine max L. Merr) using modified CTAB protocol to obtain high-quality DNA

Rapid genomic DNA extraction for Soybean (Glycine max L. Merr) using modified CTAB protocol to obtain high-quality DNA

Evaluation of DNA extraction methods for molecular traceability in cold pressed, solvent extracted and refined groundnut oils

Groundnut oil (GNO)/ peanut oil is one of the agro-food products with great economic value and hence an attractive target for adulteration and mislabeling. Simple Sequence Repeats (SSR) are markers of choice for DNA fingerprinting studies as they exhibit high polymorphism due to variable number of repeats. Hence, this study was designed to evaluate and optimized a method for DNA isolation from groundnut oil and study the possibility of using the isolated DNA for molecular traceability using SSR markers. Four methods to isolate DNA from groundnut oil were evaluated. All the four methods were modified CTAB protocols, but differed in procedures forextraction, buffer compositions, amount of oil used and DNA carriers. For molecular traceability of oils, extraction and recovery of DNA from edible oil is a key step, especially in refined oils. A method that employed DNA enrichment prior to extraction with CTAB buffer yielded amplifiable DNA from cold pressed GNO, crude hexaneextracted GNO and refined GNO. The optimized method for isolation of DNA from groundnut oil is simple, efficient, less costly and reproducible when compared to chromatography and spectroscopy based techniques.

ITS2 Isolation in Endemic Loka Pere Banana: A New Potential DNA Barcode Marker

The present research aimed to investigate Loka Pere banana (Musa sp.), an endemic species with distinct characteristics, but currently underrepresented in scientific literature. Our primary goal was to isolate the Internal Transcribed Spacer (ITS2) region from the leaf and corm samples of this unique banana variant. As a methodological approach, we utilized a modified CTAB protocol to extract DNA and amplified the ITS2 region via polymerase chain reaction (PCR) using ITS-S2F and ITS-S3R primers, achieving an amplicon size approximately 500 bp long. The results showed successful isolation of the ITS2 sequences from both leaf and corm samples of Loka Pere Banana. This finding signifies the potential of the ITS2 region of the Loka Pere banana as a novel and reliable DNA barcode marker. Future research can leverage this data for more accurate molecular identification and phylogenetic analyses, enhancing our understanding of the genetic diversity among the Musa genus.

Taxonomic Identification and Molecular DNA Barcoding of Collected Wild-Growing Orchids Used Traditionally for Salep Production.

Molecular DNA barcoding combined with botanical taxonomy can be used for the identification and conservation of collected Greek orchids used for salep production as well as in the regulation of fair salep trade. A modified CTAB protocol was used for DNA extraction, amplification of barcoding regions (ITS, matK, rbcL, trnH-psbA), and sequencing. Sequencing data were assembled using Bioedit software, and the BLAST algorithm was used on the NCBI database for species identification at the genus level. Molecular barcoding data based on genetic similarity identification was in full coherence with taxonomic classification based on morphological data. The combination of ITS and matK exhibited a greater capacity to identify a species among the Greek salep samples. Out of the 53 samples examined, 52.9% were classified as Dactylorhiza spp. and 33.3% as Anacamptis spp., whereas only 6 samples were identified as Orchis spp. (11.8%). Given that a superior-quality salep beverage comes from tubers of the latter, the number of samples classified as such in northwestern Greece is unexpectedly low. A database of 53 original reference sequences from wild-growing samples of Greek origin was generated, providing a valuable resource for the identification of other salep samples from different regions. The DNA barcoding results unveiled that salep samples from northwestern Greece are related to nine members of four different genera of Orchidaceae. All species are nationally protected and covered by the CITES convention, while many of these orchids are included in the EU Directive 92/43/EEC appendix as "Other Important Species". Thus, expedited coordinated management actions are needed to ensure their survival in the future.

Phylogeography pattern of Lutjanus kasmira in the Bengal Strait and the Arabian Sea

Lutjanus kasmira is one of the snappers occupying and commonly found in the Arabian Sea and the Bengal Strait. The purpose of this study was to examine the comparative phylogeography pattern of Lutjanus kasmira in the Bengal Strait and the Arabian Sea using the mitochondrial COI gene as a marker. The population sampled of Indonesia was taken from fish landing in Banda Aceh, Indonesia, while the population of India represented Bengal Strait, Oman, Yemen, Djibouti and Somalia respresented Arabian sea was retrieved from the NCBI Genbank. The extraction method was carried out using a modified C-TAB protocol. In this study at total of 47 sequences were analysed that produced 22 haplotypes where 18 haplotypes distributed in the Arabian Sea and 4 haplotypes from Bengal Strait. 10 samples of Oman population produced 6 haplotypes, 10 samples from Djibouti produced 5 haplotypes, 5 haplotypes from the population of Yemen, Somalia 2 haplotypes and India 1 haplotypes, respectively. Meanwhile, the Indonesian population, from 6 samples, produced 3 haplotypes. L. kasmira population from Arabian Sea and Bengal strait had no connectivity. The highest haplotype diversity (Hd) value was found in Oman population of 0.956 and the lowest found in Somalia population, while Indonesia population has a moderate genetic diversity.

First report of meadow saffron breaking virus on wild Colchicum autumnale from a stricly protected Natura2000 site at a Hungarian National Park.

In mid-April of 2018 light green to greenish yellow linear stripes (Fig. S1.) were observed on the foliage of meadow saffron (Colchicum autumnale) plants - which are native to Hungary - at a strictly protected Natura2000 site maintained by the Duna-Ipoly National Park (DNPI). By autumn, during the flowering season, flower breaking symptoms (Fig. S2.) were noticed, which indicated possible viral infection. With the permit of the Government Office of Pest County and the DNPI, 200 mg leaf sample was collected from one symptomatic plant in spring 2021 and stored at -70 °C until further processing. At the time of the sampling about 2.5 % of the ~ 5000 meadow saffron were symptomatic. Multiplex RT-PCR testing of the sample and an asymptomatic C. autumnale plant for cucumber mosaic virus, tomato spotted wilt virus (Nemes and Salánki 2020) and Nepovirus subgroup-A (Digiaro et al. 2007) gave negative results. The asymptomatic plant also tested negative for potyviruses (Salamon and Palkovics 2005). The asymptomatic (healthy) C. autumnale plant was inoculated with leaf sap of the sample (0.02M Sörensen's phosphate buffer pH 7.2 + 2 % PVP-40 (m/v)) resulting in symptoms of flower breaking in autumn of 2021, and linear stripes on the foliage in spring 2022, identical to symptoms on the originally infected plant. ELISA tests were carried out on the source plants in duplicate using potyvirus-specific MAb PTY1 antibodies (Jordan and Hammond 1991) (Agdia, Elkhart, IN, USA). Absorbance values were 1.519 and 1.530, while the negative controls were 0.003 and 0.007, respectively indicating potyvirus infection of the sample. Molecular tests were carried out on the source and inoculated plant samples in 2022. Total nucleic acid was extracted with the modified CTAB protocol of Xu et al. (2004), and reverse transcription was carried out with Maxima H Minus First Strand cDNA Synthesis Kit (Thermo Fisher Scientific Baltics UAB, Vilnius, Lithuania) with poly T2 (5'-CGGGGATCCTCGAGAAGCTTTTTTTTTTTTTTTTT-3') primer (Salamon and Palkovics 2005). PCR amplification was carried out with poty7941 (5'-GGAATTCCCGCGGNAAYAAYAGYGGNCARCC-3') and poly T2 primers as described earlier (Salamon and Palkovics 2005). A PCR product of ~ 1.6 kb was obtained in each case (Fig. S3.), cloned into pGEM®-T Easy vector (Promega, Madison, WI, USA) and transformed into E. coli DH5α strain. The obtained 1642 nucleotide (nt) sequence encompassing the complete coat protein (CP) was determined (Accession No: OP057214). The virus sequence present in the source and inoculated plants shared 100% nt identity. EcoRV digestion of the PCR products yielded two restriction fragments (369/1273 bp), indicating the presence of a single potyvirus in the infected plant tissue (Fig. S3.). BLASTN analysis of the CP cistron revealed highest nt identity (93.91 %) to meadow saffron breaking virus (MSBV) isolate FR GenBank Acc. No.: AY388995. MSBV was first reported in the Alsace region of France at an INRA research station in cultivated meadow saffron plants showing similar symptoms and the disease reached 100% incidence within a year (Poutaraud et al. 2004). Potyviruses are transmitted mechanically and by aphids (Inoue-Nagata et al. 2022). The spread of MSBV could lead to the infection and decline of the population of Colchicum in protected ecosystems. To our knowledge, this is the first report of MSBV on wild meadow saffron plant from a strictly protected Natura2000 site at a Hungarian National Park.

A Rapid and Efficient Loop-mediated Isothermal Amplification (LAMP) Assay for the Authentication of Food Supplements Based on Maitake (Grifola Frondosa).

Grifola frondosa (“Maitake”) is an edible fungus with several nutraceutical properties, largely used in traditional medicine. The increased use of Maitake as a food supplements ingredient raised the need of accurate authentication methods since the morphological identification of G. frondosa is not feasible in formulated food supplements. We developed a diagnostic tool based on loop-mediated isothermal AMPlification (LAMP) for the detection of G. frondosa in food supplements. First, a modified CTAB protocol for DNA extraction from food supplements has been set up and it has been shown to be able to isolate amplifiable total genomic material from different types of commercial products. Subsequently, the LAMP assay confirmed high specificity and good analytical sensitivity, allowing to detect up to 0.62 pg of genomic DNA in less than 20 min. Ten related fungal species resulted negative, confirming the specificity of the assay. The presence of Maitake in commercial food supplements was confirmed, except for one, revealing a mislabeling (or a food fraud). This assay proved to be a rapid powerful tool for food authentication purposes and routine inspections at any level of the supply chain of Maitake-based products and it can be used as a model for other quality control assays of fungal food products.Supplementary InformationThe online version contains supplementary material available at 10.1007/s12161-022-02235-0.

Do we have infraspecific taxa of Salvia macrosiphon Boiss. (Lamiaceae) in Iran?

Salvia macrosiphon is an aromatic perennial species of Lamiaceae family that grows naturally in different parts of Iran. This herb is widely used in folk and modern medicine. Although in Flora Iranica and Flora of Iran, no infraspecific taxonomic rank has been detected for S. macrosiphon, some infraspecific taxonomic ranks have been reported. In the current study, we evaluated the genetic diversity and structure of 11 populations of this species to detect inter and intrapopulation genetic diversity and to survey the possibility of infraspecific taxonomic ranks in this species. We utilized the modified C-TAB protocol for DNA extraction and amplified the genomes using several SCoT molecular markers. We calculated of genetic diversity and polymorphism parameters using GenAlex 6.4, Geno-Dive ver.2, PopGene, PopART and Structure 2.3.4. The parameters of genetic polymorphism differed between the populations. Moreover, a low rate of gene flow supported a moderate level of population's genetic diversity and differentiation. According to haplotypes network (TCS) analysis, a high level of genetic mutation has occurred among the individuals of some populations leading to high intrapopulation diversity. On the basis of structure analysis and Nei's genetic distance, the examined populations were classified into four genotypes. The clustering pattern of the populations in each group was not related to geographical distance or phytogeography. It seems that the wide geographic distribution, a small gene flow rate and the occurrence of a high level of genetic mutation lead to infraspecific genetic differentiation in the species and we suppose some infraspecific ranks exist for it.

Nigrospora sphaerica Causing Leaf Blight Disease on Sesame in Pakistan

Sesame (Sesamum indicum L.) commonly known as 'til' is the most ancient and widely grown oilseed crop of Pakistan. During 2020, field survey conducted in various research fields of Faisalabad (31°26'00.2″N, 73°04'25.4″E) revealed the occurrence of characteristic leaf blight disease with an incidence of 10 to 13%. The symptoms were characterized by yellow-brown and irregular lesions. At later stages, the lesions expanded and the affected leaves turned grayish to dark-brown and finally became wilted. Symptomatic leaves (both the diseased and healthy tissue) were cut into approximately 2 × 2 mm pieces, surface sterilized with 1% sodium hypochlorite for 30 s, 70% ethanol for 30 s, and finally, three times in sterile distilled water prior to culturing on Potato Dextrose Agar (PDA) and incubated at 25 °C under a 12-h photoperiod for 7 days. To obtain pure cultures, hyphal tips of growing mycelia from leaf tissues were carefully isolated and transferred onto fresh PDA plates. Fungal colonies of 11 isolates were initially white, becoming light to dark-gray. The conidia were black, spherical to subspherical, and single-celled (12 to 14 × 18 to 20 μm) in diameter, which were borne on a hyaline vesicle at the tip of the conidiophore. Further, to identify the pathogen to the species level, genomic DNA was extracted using a modified CTAB protocol described by (Guo et al. 2000). The internal transcribed spacer (ITS) region of the ribosomal DNA and translation elongation factor 1-alpha (TEF1-α) gene were amplified using ITS1/ITS4 (White et al. 1990) and EF1-728F/EF1-986R primer sets (Carbone and Kohn 1999), respectively. The sequences were submitted to GenBank (accession no. MW287214 for ITS and MW325222 for TEF1. The sequences comparison revealed 99% and 100% similarity to multiple sequences of N. sphaerica (GenBank accessions KX834822 and MN995332). On the basis of cultural features, conidial morphology and molecular data, the fungus was identified as Nigrospora sphaerica (Sacc.) Mason (Wang et al. 2017; Chen et al. 2018). To test the pathogenicity, fresh and healthy leaves of ten 6-week-old growth stage sesame plants were spray inoculated with a conidial suspension (105 conidia/ml), collected from a 7-day-old culture on PDA. In addition, 10 plants sprayed with sterile distilled water served as controls. Inoculated plants were covered with polyethylene bags to maintain high humidity and kept at 28°C, and observations were made at regular intervals. After 8-10 days of inoculation, leaves developed blight symptoms similar to those observed on naturally infected leaves, whereas control leaves remained asymptomatic. The pathogen was re-isolated from the inoculated leaves, and its identity was confirmed by morphological and molecular (ITS and TEF1) means, thus fulfilling Koch's postulates. N. sphaerica is distributed on a wide range of hosts and has been reported from different host genera including monocotyledonous and dicotyledonous (Wang et al. 2017). Previously, N. sphaerica has been reported to cause leaf blight of Cunninghamia lanceolata in China (Xu and Liu, 2016). To the best of our knowledge, this is the first report of Nigrospora sphaerica as the causal agent of leaf blight of sesame in Pakistan. Because sesame is an important oilseed crop of Pakistan, appropriate disease management practices should be developed and implemented.

First report of strains related to the phytoplasma associated with Tanzanian Lethal Decline on Cocos nucifera on the western coast of Madagascar.

Madagascar is a high diversity hotspot in the world, and palms are highly represented with nearly 200 endemic species (Rakotoarinivo et al., 2014). Coconut tree (Cocos nucifera) could have been introduced in Madagascar by Austronesians around AD 400 or 700 (Beaujard, 2011). Sporadic coconut trees showing very severe wilt were observed in 2016 in three localities of the western and northern coast of the island: Katsepy (Sample MG16-001), Antsohyhi (MG16-004 and MG16-005) and Ambaritsatrana (MG16-010). Symptoms correspond on a severe ascendant wilt of the leaves, associated with necrosis of the inflorescences and absence of nuts and death of all trees was confirmed eventually. We investigated the implication of phytoplasma because of the apparent similarity in the symptomatology with Coconut Lethal Yellowing Disease and Coconut Lethal Decline occurring in East Africa (Mpunami et al., 1999), and because the western coast of Madagascar faces the Mozambican channel only 400 km apart from areas along the East African coast where those two diseases occur. Symptomatic (n=4) and asymptomatic (n=6) coconut trees were sampled by stem drilling. DNA was extracted from sawdust samples using a modified CTAB protocol (Mpunami et al., 1999). A direct polymerase chain reaction (PCR) targeting the 16S rRNA gene plus Internal transcribed spacer with the P1-1T (AAGAGTTTGATCCTGGCTCAGGAT)/P7 primers (Schneider et al., 1998) amplified a product of about 1.8 kb for MG16-001 and MG16-005 samples only, while the four DNA extracts from symptomatic trees showed a 1.2 kb amplicon by nested PCR using R16F2n/R16R2 primer pairs in the second round (Lee et al., 1998). Amplification of the secA gene using the primer pair secAFor1/secARev3 (Hodgetts et al., 2008) was performed in a single round and gave a product of 850 bp exclusively for the symptomatic tree DNAs. All amplicons were double strand sequenced (Genewiz, UK). Corresponding high quality sequences were deposited in GenBank and submitted to Blastn on NCBI. The partial 16S rRNA gene sequences (accessions MN264629 to MN264632) obtained using R16F2n/R16R2 primers presented the highest similarity (from 99.47 to 99.56%) to the reference sequence for the phytoplasma associated with the Tanzanian Lethal Decline (GenBank accession X80117). This genetic proximity of the Malagasy strains was confirmed by the partial secA gene sequences (accessions MN267853 to MN267856) presenting the highest similarity (from 89.92 to 90.70%) to the Tanzanian Lethal Decline phytoplasma secA gene partial sequence (Genbank accession KJ462071). Full-length 16S rRNA gene sequences of MG16-001 and MG16-005 strains (accessions MN388765 and MN388766) were submitted to iPhyClassifier virtual RFLP tool (Zhao et al., 2009). The iPhyClassifier tool confirmed that Malagasy strains are related to the reference strain X80117 but belong to a different 16Sr subgroup (similarity coefficient from 0.90 to 0.93, Dev. 1). Both Malagassy strains and LDT phytoplasma should be assigned to a new 16Sr group since X80117 is itself erroneously assigned to 16SrIV group while the closest reference sequence AF509322, 16SrIV-A, shared only a similarity of 0.83 (Dev. 1). Occurrence of a phytoplasma associated with a lethal yellowing type syndrome in Madagascar could represent a dangerous threat to coconut crops that play an important socio-economic role in the coastal areas, but also to the many endemic palm species already on high extinction risk.

Fungal Basidiomycete Ceratobasidium theobromae DNA obtained directly from cocoa petioles

Abstract. Junaid M, Purwantara A, Guest G. 2021. Fungal Basidiomycete Ceratobasidium theobromae DNA obtained directly from cocoa petioles. Biodiversitas 22: 2838-2843. Understanding the biology of the fastidious Basidiomycete Ceratobasidium theobromae occupying host-tissue is essential for plant disease management. Direct pathogen DNA extraction from infected plant tissue avoids the need for isolation in artificial media. We report a modified DNA isolation protocol to obtain total plant DNA designed to overcome DNA extraction and isolation problems caused by infected petioles rich in polysaccharides and phenolic substances as a primary source of gummosis. This study examined and compared total plant DNA isolated from petioles high in polysaccharides and polyphenolic compounds using two methods: conventional CTAB lysis buffer and Kits (the standard method), and a new modified CTAB protocol to address these PCR inhibitors. The modified method resulted in higher quality and quantity of C. theobromae crude DNA and amplified PCR product. The modified method produced large quantities of clear, transparent, aqueous DNA-containing lysate (crude DNA) with a clear separation between the upper crude DNA and organic waste layers. Mean DNA absorbance was 1.80, and the lowest DNA yield was 836.6 ng/µl. With the standard method, the blurred, viscous lysate obtained showed signs of gummosis, with poor separation between layers of crude DNA, polysaccharides, protein, and organic waste layers and low yield. Gel electrophoresis indicated poor quality DNA extract. We conclude that this modified method will be valuable for genetic diversity and disease studies in a range of previously challenging plant tissues and their pathogens.

Evaluation of DNA extraction methods for molecular traceability in cold pressed, solvent extracted and refined groundnut oils.

Groundnut oil (GNO)/peanut oil is one of the agro-food products with great economic value and hence an attractive target for adulteration and mislabeling. Simple Sequence Repeats (SSR) are markers of choice for DNA fingerprinting studies as they exhibit high polymorphism due to variable number of repeats. Hence, this study was designed to evaluate and optimize a method for DNA isolation from groundnut oil and study the possibility of using the isolated DNA for molecular traceability using SSR markers. Four methods to isolate DNA from groundnut oil were evaluated. All the four methods were modified CTAB protocols, but differed in procedures for extraction, buffer compositions, amount of oil used and DNA carriers. For molecular traceability of oils, extraction and recovery of DNA from edible oil is a key step, especially in refined oils. A method that employed DNA enrichment prior to extraction with CTAB buffer yielded amplifiable DNA from cold pressed GNO, crude hexane extracted GNO and refined GNO. The optimized method for isolation of DNA from groundnut oil is simple, efficient, less costly and reproducible when compared to chromatography and spectroscopy based techniques.

Modified CTAB protocol for RNA extraction from Lemon balm (Melissa officinalis L.)

Ribonucleic acid (RNA) quality and integrity are crucial for many studies in plant molecular biology. High-quality RNA extraction from plants with high levels of compounds such as polysaccharides, polyphenols, and other secondary metabolites are problematic. RNA extraction from Lemon balm tissues can be difficult due to the presence of polyphenolic and polysaccharide compounds or can be done by expensive protocols. This study shows improvement of a CTAB-based protocol which allows rapid and easy isolation of high-quality RNA from Lemon balm plant. The RNA obtained is suitable for cDNA synthesis and RT-PCR experiments.

Comparison of DNA extraction methods for non-marine molluscs: is modified CTAB DNA extraction method more efficient than DNA extraction kits?

Isolation of high molecular weight DNA from gastropod molluscs and its subsequent PCR amplification is considered difficult due to excessive mucopolysaccharides secretion which co-precipitate with DNA and obstruct successful amplification. In an attempt to address this issue, we describe a modified CTAB DNA extraction method that proved to work significantly better with a number of freshwater and terrestrial gastropod taxa. We compared the performance of this method with Qiagen® DNeasy Blood and Tissue Kit. Reproducibility of amplification was verified using a set of taxon-specific primers, wherein modified CTAB extracted DNA could be replicated at least four out of five times but kit extracted DNA could not be replicated. In addition, sequence quality was significantly better with CTAB extracted DNA. This could be attributed to the removal of polyphenolic compounds by polyvinyl pyrrolidone which is the only difference between conventional and modified CTAB DNA extraction methods for animals. The genomic DNA isolated using modified CTAB protocol was of high quality (A260/280 ≥ 1.80) and could be used for downstream reactions even after long-term storage (more than 2years).

Morphological and molecular barcode analysis of the medicinal tree Mimusops coriacea (A.DC.) Miq. collected in Ecuador.

BackgroundMimusops coriacea (A.DC.) Miq., (Sapotaceae), originated from Africa, were introduced to coastal areas in Ecuador where it is not extensively used as a traditional medicine to treat various human diseases. Different therapeutically uses of the species include: analgesic, antimicrobial, hypoglycemic, inflammation and pain relieve associated with bone and articulation-related diseases. Furthermore, Mimusops coriacea could be used as anti-oxidant agent. However, botanical, chemical or molecular barcode information related to this much used species is not available from Ecuador. In this study, morphological characterization was performed from leaves, stem and seeds. Furthermore, genetic characterization was performed using molecular barcodes for rbcL, matk, ITS1 and ITS2 using DNA extracted from leaves.MethodsMacro-morphological description was performed on fresh leaves, stem and seeds. For anatomical evaluation, tissues were embedded in paraffin and transversal dissections were done following incubation with sodium hypochlorite and safranin for coloration and fixated later in glycerinated gelatin. DNA extraction was performed using a modified CTAB protocol from leaf tissues, while amplification by PCR was accomplished for the molecular barcodes rbcL, matK, ITS1 and ITS2. Sequence analysis was performed using blast in the GenBank. Phylogenetic analysis was performed with accessions queried in the GenBank belonging to the subfamily Sapotoideae.ResultsLeaf size was 13.56 ± 1.46 × 7.49 ± 0.65 cm; where is a macro-morphological description of the stem (see Methods). The peel of the seeds is dark brown. Sequence analysis revealed that amplicons were generated using the four barcodes selected. Phylogenetic analysis indicated that the barcodes rbcL and matK, were not discriminated between species within the same genus of the subfamily Sapotoideae. On the other hand, the ITS1 and ITS2 were discriminative at the level of genus and species of the Sapotoideae.

Comparative investigation of DNA extraction methods in black gram (Vigna mungo (L.)

Isolation of intact, double stranded, pure and non- contaminated genomic DNA is prerequisite for large scale genotyping analysis including DNA-banks. Three methods of DNA isolation (Dellaporta, CTAB and Hi-PurAg DNA isolation kits) from 25 black gram genotypes were compared in terms of the yield, purity, integrity, and stability of extracted DNA. Purity and quantification of isolated DNA samples was confirmed by using the UV nano-spectrophotometer at OD260/280 and the same is confirmed based by agarose gel electrophoresis. The CTAB method showed the best results followed by Hi-PurAg and Dellaporta method. The CTAB DNA extraction method was found to be the most efficient DNA extraction method, capable of providing high quality, pure and stable DNA and could be used for various molecular related works. All the 25 black gram genotypes for this research gave good yield of DNA from the established modified CTAB protocol.

Determination of quality and quantity of DNA template using modified CTAB protocol

Determination of quality and quantity of DNA template using modified CTAB protocol

DNA extraction and amplification from Pinaceae dry wood

Abstract Wood constitutes the unique source of DNA in dead trees, but extraction of adequate quality DNA from dry wood is usually challenging. However, many different molecular studies require the use of such DNA. We have standardized and validated a modified CTAB protocol to isolate DNA from dry wood from Abies pinsapo and Cedrus atlantica species. Due to the degradation and very little DNA that is normally present in the wood from dead trees we have developed a PCR based test to certify the quality of the extracted samples. In the present study, we have proved too the effectiveness of this methodology to isolate DNA from conifer dry wood samples of sufficient quality to perform further molecular genetic experiments.