Mild Isolates Of Citrus Tristeza Virus Research Articles

Transmission of isolates of Citrus tristeza virus by single aphids (Toxoptera citricida)

Citrus tristeza virus (CTV) can be transmitted by several aphid species in a semi-persistent mode, with Toxoptera citricida being the most efficient vector. In Brazil, mild CTV isolates are used for pre-immunization of citrus trees against severe isolates. We aimed to determine the capacity and efficiency of T. citricida in separating the viral complex into haplotypes from three well-characterized CTV isolates (PIAC, CS1, and Forte Rolândia). Single-aphid transmission assays were conducted to determine CTV transmission efficiency. The results showed that T. citricida transmitted only haplotypes from the PIAC and CS1 isolates, with efficiencies of 8 and 4%, respectively. Both isolates caused mild CTV symptoms in Brazil. However, isolate Forte Rolândia, which causes severe symptoms in citrus trees, was not transmitted by T. citricida. The detection of CTV haplotypes from PIAC and CS1 isolates in sweet orange (Citrus sinensis) plants after a single aphid transmission occurred at different time points. The first haplotype observed was from PIAC 150 days after citrus was challenged by a single aphid, followed by CS1 at day 210 after transmission. In addition, differences in the single-strand conformation polymorphism patterns between the CTV isolates and CTV haplotypes were determined, suggesting that an aphid can acquire and transmit only one CTV haplotype to citrus plants during phloem feeding. The study of the mechanism of transmission by the vector can increase our knowledge of the interactions among hosts, vectors, and pathogens, which are often neglected.

PM 7/31 (2) Citrus tristeza virus

<scp>PM</scp> 7/31 (2) Citrus tristeza virus

From the smallest to the largest subcellular plant pathogen: Citrus tristeza virus and its unique p23 protein

Knowledge on diseases caused by Citrus tristeza virus (CTV) has greatly increased in last decades after their etiology was demonstrated in the past seventies. Professor Ricardo Flores substantially contributed to these advances in topics like: i) improvement of virus purification to obtain biologically active virions, ii) sequencing mild CTV isolates for genetic comparisons with sequences of moderate or severe isolates and genetic engineering, iii) analysis of genetic variation of both CTV genomic RNA ends and features of the highly variable 5′ end that allow accommodating this variation within a conserved secondary structure, iv) studies on the structure, subcellular localization and biological functions of the CTV-unique p23 protein, and v) potential use of p23 and other 3′-proximal regions of the CTV genome to develop transgenic citrus resistant to the virus. Here we review his main achievements on these topics and how they contributed to deeper understanding of CTV biology and to new potential measures for disease control.

Prevalence of mild citrus tristeza virus isolates of the T30 genotype in Cuban commercial citrus fields after the dissemination of huanglongbing

Huanglongbing (HLB) disease detection in Cuba in 2006 led to a turn in citrus management in the country, including the production of certified budwood in protected nurseries, eradication of symptomatic plants and old orchards, and chemical control of the vector Diaphorina citri. This dramatic shift in citrus farming could have affected the incidence and composition of citrus tristeza virus (CTV) populations. This work aimed to determine CTV incidence and characterize viral isolates from the main Cuban citrus-producing areas. A survey throughout the country was carried out which resulted in the collection of 27 CTV isolates. Results showed a decrease of CTV incidence in western and central areas of the country, but an increase in the East, compared to previous reports. Bioindexing showed that most of the isolates induced none or mild symptoms. Serological characterization using seven different CTV specific monoclonal antibodies (MAb) showed heterogeneity among the 27 isolates. Six out of twenty-seven were MCA13-reactive, a MAb associated to the presence of severe CTV isolates. Nevertheless, sequence comparison of the p20, p23 and p25 genes evidenced a high nucleotide sequence identity among isolates, and according to the phylogenetic analyses, all the sequences belonged to the CTV T30 genotype. Thus, our results showed a decrease in the CTV incidence in the surveyed areas and the broad dissemination of mild CTV isolates of the T30 genotype, which could be partially explained by the shift in the management programs implemented for CTV and HLB control in Cuba.

Biological and molecular characterization of Uruguayan citrus tristeza virus field isolates

Citrus tristeza virus (CTV) is the causal agent of the most important viral disease of citrus. Symptoms that may affect the productive potential of citrus plants are observed in Uruguayan orchards even though resistant rootstocks are used. CTV is fully eliminated in propagative materials by the National Sanitation and Certification Program, but since the virus and its vector are widespread in the country, the risk of infection in the field persists. In this situation, using mild CTV strains in a cross-protection program would be a useful alternative to attempt to increase yield and quality of the local citrus industry. To this aim, this study assessed the biological and molecular characteristics of 32 local CTV isolates. Bioassays were conducted in a greenhouse with controlled conditions. Each isolate was graft-inoculated on Mexican lime, sweet orange, sour orange and Duncan grapefruit indicator plants. Symptoms and their intensity were evaluated. Molecular characterization was carried out by RT-PCR amplification, using primers for the p25, p20 and p23 genes. PCR products were sequenced, nucleotide sequences were aligned with international reference strains and phylogenetic trees were constructed. Results of the biological and molecular analysis showed the prevalence of severe CTV isolates with a high genetic variability. Two out of 32 characterized isolates were selected as mild CTV isolates to be tested as candidates for future cross-protection experiments. The survey showed a complex scenario for the management of CTV in Uruguay.

Evaluation of the protective capacity of new mild Citrus tristeza virus (CTV) isolates selected for a preimmunization program

The use of tolerant rootstocks and preimmunization has satisfactorily controlled losses associated with the Citrus tristeza virus (CTV). Several researchers have shown that CTV mild isolates that are selected in the same region where they are used are superior to isolates obtained from other areas. Thus, budwoods of 20 outstanding citrus trees were collected in north and northwestern Parana state (Brazil) citrus-producing areas and established to be used in a preimmunization program. These budwoods were tested to evaluate the potential protection of the inherently present viral complex. Based on biological indexing and molecular characterization of the capsid protein gene by RFLP (restriction fragment length polymorphism, which indicated that the plants were infected with mild isolates of CTV), some of the selected plants could be used in a preimmunization program. These potentially mild and protective isolates were challenged with severe 'Rolândia' isolate inoculations by grafting and by the brown citrus aphid (Toxoptera citricida Kirkaldy) vector, which was faster in transmitting the virus. Some isolates had a better protective value than others, particularly when challenged with the severe CTV isolate. The SSCP (single strand conformational polymorphism) molecular analysis was an excellent complementary tool for monitoring the performance of the experiments and the stability of the viral complex present in the plants. Isolate number 1, collected in the municipality of Cruzeiro do Sul (CS-1), was the most promising for protecting commercial Pera sweet orange (C. sinensis L.) orchards in northern and northwestern Parana. The Rolândia severe CTV isolate was stable and had a high genetic divergence among the severe isolates used as a control (Capao Bonito and Barao B) and all of the isolates tested.

Mild strain cross protection of tristeza: a review of research to protect against decline on sour orange in Florida.

Tristeza, caused by Citrus tristeza virus (CTV), has long been present in Florida but outbreaks of decline on sour orange rootstock were occasional events until the late 1970s. Sour orange rootstock was valued for the high quality of fruit produced and was widely used because of its tolerance of citrus blight, a disease of unknown etiology. Research was directed towards the selection and screening of mild strains of CTV which could protect against sour orange decline strains. Following the introduction of Toxoptera citricida (also known as the brown citrus aphid) in 1995 there was a greater concern for maintaining production of existing blocks of citrus on sour orange rootstock. Availability of the CTV genome sequence around the same time as well as molecular characterization of in planta CTV populations led to the selection of mild CTV isolates which when inoculated into existing field trees, extended the productive life of the groves and enabled a more graduate replanting of trees on CTV-tolerant rootstocks. The history of CTV in Florida and the methods developed to select mild isolates for use for mild strain cross protection will be reviewed.

Identification of differentially expressed genes in response to infection of a mild Citrus tristeza virus isolate in Citrus aurantifolia by suppression subtractive hybridization

Citrus tristeza virus (CTV) is the most serious viral pathogen of citrus. Pathogenicity differentiation among CTV isolates has been found in some countries. In order to better understand the responses of Mexican lime ( Citrus aurantifolia) to the infection of a mild CTV isolate (CTV-N4), we constructed two suppression subtractive hybridization (SSH) libraries. A total of 589 expressed sequence tags (ESTs) were screened from two SSH libraries by dot blot analysis. Sequencing results showed that these ESTs represented 202 genes, of which 111 and 91 genes were up-regulated and down-regulated, respectively. The differential expression of 10 out of 13 selected genes was confirmed by quantitative real-time RT-PCR (qRT-PCR). All differently expressed genes were functionally categorized into eight groups, of which the majority was associated with stress and disease defenses. The transcriptional levels of three genes in lime plants with the infection of a mild isolate CTV-N4 and a severe isolate CTV-N21 were comparatively analyzed by qRT-PCR over a 120 days time course. Results indicated that transcriptional changes of three studied genes were more greatly induced by CTV-N21 than those induced by CTV-N4. The obtained results provided novel information on genes potentially involved in citrus responses to CTV infection.

Ectopic expression of the p23 silencing suppressor of Citrus tristeza virus differentially modifies viral accumulation and tropism in two transgenic woody hosts

Citrus tristeza virus (CTV), a phloem-restricted closterovirus infecting citrus, encodes three different silencing suppressors (p25, p20 and p23), one of which (p23) is a pathogenicity determinant that induces aberrations resembling CTV symptoms when expressed ectopically in transgenic citrus hosts. In this article, the effect of p23 ectopic expression on virus infection was examined in sweet orange (SwO), a highly susceptible host, and sour orange (SO), which severely restricts CTV cell-to-cell movement. Transgenic plants of both species ectopically expressing p23, or transformed with an empty vector, were graft inoculated with the mild CTV isolate T385 or with CTV-BC1/GFP, a clonal strain derived from the severe isolate T36 carrying the gene for the green fluorescent protein (GFP). CTV distribution in infected tissues was assessed by direct tissue blot immunoassay and fluorescence emission, and virus accumulation was estimated by quantitative real-time reverse transcriptase-polymerase chain reaction. CTV accumulation in p23-expressing and control SwO plants was similar, whereas the viral load in transgenic SO expressing p23 was 10-10(5) times higher than in the cognate control plants. Although few infection foci composed of a single cell were observed in the phloem of CTV-infected control SO, the number of foci in p23-expressing plants was higher and usually comprised two to six cells, indicating viral cell-to-cell movement. CTV was detected in mesophyll protoplasts and cells from infected SO and SwO expressing p23, but not in similar protoplasts and cells from infected control plants. Our results show that the ectopic expression of p23 enables CTV to escape from the phloem and, in addition, facilitates systemic infection of the resistant SO host. This is the first report of a viral-encoded protein that enhances virus accumulation and distribution in woody hosts.

New isolates of Citrus tristeza virus naturally occurring in old lemon and mandarin trees in Greece

Citrus tristeza virus (CTV) has quarantine status in Greece. The virus was first reported in 2000 in non-certified sweet orange trees grafted on CTV-tolerant Carrizo citrange originating from Spain (Dimou et al., 2002). High homology of these isolates was then found with the Spanish mild T385 isolate (bio-group 1, Garnsey et al., 2005) from sweet orange grafted on sour orange rootstock, sharing 100% nucleotide sequence identity for the p20 gene (Varveri, 2006). In 2009, surveys were conducted in the area of Poros (Trizinia, Prefecture of Pireaus), where about 20,000 citrus trees grow, mainly lemon. (This was an area previously devoted to citrus cultivation for more than 100 years but now consisting virtually of a wood protected only for its beauty and historical importance). A total of 285 citrus trees, 87% of which were lemon, were tested by ELISA (Enzyme-Linked Immunosorbent Assay) in a programme lasting until September 2010. Six trees (four lemons and two mandarins) were found positive. None of the above mentioned trees showed any symptoms. All ELISA positive samples were confirmed with reverse transcription-polymerase chain reaction (RT-PCR). Two sets of primers targeting the p20 protein (PM48 CGAGCTTACTTTAGTGTTA and PM49 TAATGTCAAACTGACCGC) (Sambade et al., 2002) and the coat protein (cp) genes (CTV1 ATGGACGACGAAACAAAGAA and CTV10 ATCAACGTGTGTTGAATTTCC) (Nolasco et al., 2002) were used. PCR products were purified using the QIAquick Gel Extraction Kit (QIAGEN GmbH, Hilden, Germany) and subjected to bidirectional direct sequencing (Macrogen, Inc., Seoul, Korea). Partial sequences of the p20 (483 bp) and cp (617-632 bp) genes of two lemon (L192GR, L594GR) and one mandarin (M8GR) CTV isolates were obtained and deposited in GenBank with the Accession Numbers recorded in Table 1. Sequence comparisons of the cp gene nucleotide sequences (HQ270181, HQ270182, and HQ270183) revealed a 99% identity with CTV isolates from Brazil (I141-62, I141-59), Cyprus (CY96-18, CY93-10, CY89-507) and Portugal (28C) (Table 1), belonging to the 3b genotype group of CTV isolates (Nolasco et al., 2009). Nucleotide sequences of the p20 gene (HQ270180, HQ270185, and HQ270186) showed a 99% identity with a seedling yellows (SY) isolate from Brazil (Galego 50) belonging to bio-group 3 of CTV isolates (Garnsey et al., 2005). Further phylogenetic analysis involving standard, fully sequenced and well characterized natural CTV isolates showed that the newly recovered isolates share a common ancestor with the VT seedling yellows (bio-group 4) isolate from Israel, which reveals a totally different topology in the obtained phylogenetic trees from the mild CTV isolates recovered in 2000-2001 in the country (data not shown). The immunological reaction with the MCA13 monoclonal antibody confirmed the occurrence of a virus strain more virulent than the one thus far recorded in orange groves in Greece. Natural isolation of the “lemonwood” in Poros from hills and the sea has apparently hindered the spread of these isolates in sweet orange trees further on in the same region, which however represents a threat for the local citrus industry. Surveys are being continued intensively in Poros aiming at eradicating CTV. Our findings confirm previous conclusions on the diversity of CTV isolates in the Mediterranean basin reflecting the worldwide virus diversity.

Sscp analysis of variations in haplotypes of citrus tristeza virus isolated from yuzu (Citrus junos) in geographically separate regions of Korea

Yuzu (Cittus junos) trees were examined from six geographically separate provinces in the Republic of Korea, including four islands (Geoje, Namhae, Wan, and Jeju), 1 peninsula (Goheung), and 1 inland area (Boseong). The population of sequence variants of citrus tristeza virus (CTV) was isolated and analyzed by single-strand conformation polymorphism (SSCP) analysis of cDNA from thep20 gene. SSCP profiles of 65 PCR products showed different band patterns but with similar intensities. Sixteen haplotypes were subgrouped according to their SSCP profiles and severity of symptoms. Their genomes were sequenced and compared. DNA analysis of thep20 genes revealed nucleotide identities ranging from 88-99.8%. Based on SSCP analysis, the pathologically mild isolates of CTV yielded two to three DNA bands, whereas the most virulent isolates contained more than two bands. Comparisons of these physically separate haplotypes suggest that CTV isolates with multiple SSCP profiles could have arisen as a result of a mixed infection and genetic recombination of two divergent isolates. Plants with severe disease symptoms, such as stem pitting, closely corresponded to a CTV strain showing typical SSCP profiles in Florida (USA) and Japan.

Inefficient Transmission of Citrus Tristeza Virus from Grapefruit by Single Brown Citrus Aphids

Six severe and six mild Florida isolates of citrus tristeza virus (CTV) were used to evaluate the transmission efficiency of the virus from grapefruit seedlings by single brown citrus aphids (Toxoptera citricida Kirkaldy) (BrCA) from colonies initiated by aphids obtained from citrus groves in Fort Pierce, Fla. The transmission rate to 2120 receptor plants [`Mexican' lime (Citrus aurantifolia)] from grapefruit by single BrCA was 1.5%. Single BrCA transmitted four of the six severe isolates and three of the six mild isolates of CTV. The average transmission rate of severe isolates was 1.8%, higher than that (0.9%) of mild isolates. Severe isolate Y-7 had the highest transmission rate among six severe isolates, 3.6%. Mild isolate Y-23 had the highest transmission rate among the mild isolates, 3.0%. The transmission rates of CTV by alatae, apterae, or nymphs of BrCA were 1.5%, 1.5%, and 1.0%, respectively. The results suggested that BrCA is an inefficient vector of CTV when the source plant is grapefruit.

In Situ Immunoassay (ISIA) of Field Grapefruit Trees Inoculated with Mild Isolates of Citrus tristeza virus Indicates Mixed Infections with Severe Isolates.

Ten grapefruit trees that had been inoculated with a mild isolate of Citrus tristeza virus (CTV) and maintained in the field for 18 years were found in a previous study to be declining and infected with severe isolates of CTV, or symptomless and infected with mild isolates of CTV, using enzyme-linked immunosorbent assay (ELISA). They were assayed with an in situ immunoassay (ISIA) procedure using monoclonal antibodies 17G11 (reacts with most Florida isolates of CTV) and MCA13 (reacts with severe, but not Florida mild isolates of CTV). All the grapefruit trees were 17G11 positive by ELISA and ISIA. The five trees that showed moderate decline symptoms were MCA13 positive by ELISA and ISIA. The five symptomless trees were MCA13 negative by ELISA. However, four of the five symptomless trees were MCA13 positive by ISIA, which showed that ISIA with MCA13 had greater sensitivity in detecting severe CTV isolates than ELISA. These results suggested that the cross-protected grapefruit trees, regardless of symptoms, were infected with both mild and severe isolates of CTV.

Cross-Protection of Grapefruit from Decline-Inducing Isolates of Citrus Tristeza Virus.

The ability of three mild isolates of citrus tristeza virus (CTV) to prevent natural infection of 84 Ruby Red grapefruit on sour orange rootstock by aphid-transmitted, decline-inducing isolates of CTV was assessed by symptoms and verified by enzyme-linked immunosorbent assay (ELISA) after 16 years. Of 21 trees in each of four treatments protected by the DD 102 bb, Guettler HS, and DPI 1-12-5-X-E mild CTV isolates, 14, 10, and 14% were infected by severe isolates (MCA13 monoclonal antibody reactive) compared with 67% for unprotected control trees. The health of trees protected by the DD 102 bb CTV isolate was significantly better than that of unprotected control trees as measured by decline, tree ratings, and tree height. These data suggest that infection by certain mild isolates of CTV can cross-protect grapefruit trees on sour orange rootstock from decline-inducing isolates of CTV that are prevalent in the Indian River region of Florida.

The complete genome sequence of the major component of a mild citrus tristeza virus isolate.

The genome of the Spanish mild isolate T385 of citrus tristeza virus (CTV) was completely sequenced and compared with the genomes of the severe isolates T36 (Florida), VT (Israel) and SY568 (California). The genome of T385 was 19,259 nt in length, 37 nt shorter than the genome of T36, and 33 and 10 nt longer than those of VT and SY568, respectively, but their organization was identical. T385 had mean nucleotide identities of 81.3, 89.3 and 94% with T36, VT and SY568, respectively. The 3' UTR had over 97% identity in all isolates, whereas the 5' UTR of T385 had 67% identity with VT, 66.3% with SY568 and only 42.5% with T36. In the coding regions, the nucleotide differences between T385 and VT were evenly distributed along the genome (around 90% identity); this was not observed between T385 and the other isolates. T385 and T36 had nucleotide identities around 90% in the eight 3'-terminal ORFs of the genome, but only 72.3% in ORF 1a, a divergence pattern similar to that reported previously for T36 and VT. T385 and SY568 had nucleotide identities close to 90% in the 5'- and 3'-terminal regions of the genome, whereas the central region had over 99% identity. Our data suggest that the central region in the SY568 genome results from RNA recombination between two CTV genomes, one of which was almost identical to T385.

Efficient search for new resistant genotypes to the citrus tristeza closterovirus in the orange subfamily Aurantioideae

Virulent isolates of the citrus tristeza virus (CTV) are continuously arising and their spread threatens the world citrus industry. Methods for effective utilization of material conserved in germplasm banks are needed in plant improvement. Two objectives are pursued in the present paper: a search for new CTV-resistant genotypes and tests of two strategies for this search. One of these tests is based on a study of genetic relationships among genera and species of the orange subfamily and the other on scores of molecular markers known to be linked to the CTV-resistant locus. Sampled plants were graft-inoculated with a mild CTV isolate (T-346) and two virulent ones (T-388 and T-305). Susceptible plants were those where CTV multiplication was detected beyond 4 months after inoculation. All cultivars of Poncirus trifoliata tested, as well as Severinia buxifolia and Atalantia ceylanica, were resistant to the three CTV isolates; Fortunella crassifolia (Meiwa kumquat) resists two of them. The finding of CTV resistance in this species, closely related to cultivated Citrus species, opens a new arena for CTV-resistance improvement of oranges and mandarines by sexual hybridization. The searching strategy based on phylogenetic data has been successful, whereas the other one may be worthwhile only when the search is restricted to the species where linkage analysis is available. A good documentation system that allows quick sampling of accessions to build up core collections and where the location of new and useful genes could be easily worked out, is suggested to enhance germplasm utilization.

Separation and interference of strains from a citrus tristeza virus isolate evidenced by biological activity and double‐stranded RNA (dsRNA) analysis

Separation of strains of citrus tristeza virus (CTV), differentiated by their double‐stranded RNA (dsRNA) profiles, was obtained by graft‐inoculating citron plants from a Mexican lime that had been recently aphid‐ or graft‐inoculated with a mild CTV isolate (T‐385). Up to 24 sub‐isolates with differing dsRNA profiles were obtained from the aphid‐inoculated lime. Some of these sub‐isolates induced stronger symptoms in several citrus species than the original T‐385 isolate. One sub‐isolate, T‐385‐33, was mild in Mexican lime, but induced stem pitting on sweet orange. Inoculation of this isolate on Mexican lime, sour orange and Eureka lemon induced mild or no symptoms when inoculum was taken from citron, but very severe symptoms when the inoculum was from sweet orange. Mexican lime and sweet orange plants co‐inoculated with T‐385‐33 from sweet orange in combination with the other 23 sub‐isolates showed mild symptoms. The results obtained suggest that there is natural cross‐protection among sub‐isolates in the original T‐385 isolate.