Replication Control Mechanism Research Articles

A ProQ/FinO family protein involved in plasmid copy number control favours fitness of bacteria carryingmcr-1-bearing IncI2 plasmids

The plasmid-encoded colistin resistance gene mcr-1 challenges the use of polymyxins and poses a threat to public health. Although IncI2-type plasmids are the most common vector for spreading the mcr-1 gene, the mechanisms by which these plasmids adapt to host bacteria and maintain resistance genes remain unclear. Herein, we investigated the regulatory mechanism for controlling the fitness cost of an IncI2 plasmid carrying mcr-1. A putative ProQ/FinO family protein encoded by the IncI2 plasmid, designated as PcnR (plasmid copy number repressor), balances the mcr-1 expression and bacteria fitness by repressing the plasmid copy number. It binds to the first stem-loop structure of the repR mRNA to repress RepA expression, which differs from any other previously reported plasmid replication control mechanism. Plasmid invasion experiments revealed that pcnR is essential for the persistence of the mcr-1-bearing IncI2 plasmid in the bacterial populations. Additionally, single-copy mcr-1 gene still exerted a fitness cost to host bacteria, and negatively affected the persistence of the IncI2 plasmid in competitive co-cultures. These findings demonstrate that maintaining mcr-1 plasmid at a single copy is essential for its persistence, and explain the significantly reduced prevalence of mcr-1 following the ban of colistin as a growth promoter in China.

Antiviral activity of ISG15 against classical swine fever virus replication in porcine alveolar macrophages via inhibition of autophagy by ISGylating BECN1

Interferons (IFNs) induce the expression of interferon-stimulated genes (ISGs) for defense against numerous viral infections, including classical swine fever virus (CSFV). However, the mechanisms underlying the effect of ISGs on CSFV infection are rarely reported. In this study, we demonstrate that IFN-α treatment induces upregulation of ISG15 and thus attenuates CSFV replication. To determine whether ISG15 is critical for controlling CSFV replication, we established porcine alveolar macrophages (PAMs) with stable overexpression or knockdown of ISG15. Overexpression of Flag-ISG15 significantly prevented CSFV replication, whereas loss of ISG15 led to abnormal proliferation of CSFV. Furthermore, upregulated ISG15 promoted beclin-1 (BECN1) ISGylation and dysfunction and subsequently inhibited autophagy, which is indispensable for CSFV replication. In addition, HECT and RLD domain containing E3 ubiquitin protein ligase 5 (HERC5), which functions to catalyze conjugation of ISG15 protein, was confirmed to interact with BECN1. Collectively, these results indicate that IFN-α restricts CSFV replication through ISG15-mediated BECN1 ISGylation and autophagy inhibition, providing insight into the mechanism of CSFV replication control by type I IFN. This mechanism may not be the only antiviral mechanism of ISG15; nonetheless, this study may contribute to the development of CSFV treatment and prevention strategies.

Budding Yeast Rif1 Controls Genome Integrity by Inhibiting rDNA Replication.

The Rif1 protein is a negative regulator of DNA replication initiation in eukaryotes. Here we show that budding yeast Rif1 inhibits DNA replication initiation at the rDNA locus. Absence of Rif1, or disruption of its interaction with PP1/Glc7 phosphatase, leads to more intensive rDNA replication. The effect of Rif1-Glc7 on rDNA replication is similar to that of the Sir2 deacetylase, and the two would appear to act in the same pathway, since the rif1Δ sir2Δ double mutant shows no further increase in rDNA replication. Loss of Rif1-Glc7 activity is also accompanied by an increase in rDNA repeat instability that again is not additive with the effect of sir2Δ. We find, in addition, that the viability of rif1Δ cells is severely compromised in combination with disruption of the MRX or Ctf4-Mms22 complexes, both of which are implicated in stabilization of stalled replication forks. Significantly, we show that removal of the rDNA replication fork barrier (RFB) protein Fob1, alleviation of replisome pausing by deletion of the Tof1/Csm3 complex, or a large deletion of the rDNA repeat array all rescue this synthetic growth defect of rif1Δ cells lacking in addition either MRX or Ctf4-Mms22 activity. These data suggest that the repression of origin activation by Rif1-Glc7 is important to avoid the deleterious accumulation of stalled replication forks at the rDNA RFB, which become lethal when fork stability is compromised. Finally, we show that Rif1-Glc7, unlike Sir2, has an important effect on origin firing outside of the rDNA locus that serves to prevent activation of the DNA replication checkpoint. Our results thus provide insights into a mechanism of replication control within a large repetitive chromosomal domain and its importance for the maintenance of genome stability. These findings may have important implications for metazoans, where large blocks of repetitive sequences are much more common.

Structural and sequence requirements for the antisense RNA regulating replication of staphylococcal multiresistance plasmid pSK41

pSK41 is a prototypical 46-kb conjugative multiresistance plasmid of Staphylococcus aureus. The pSK41 replication initiation protein (Rep) is rate-limiting for plasmid replication, and its expression is negatively regulated by a small, non-coding antisense transcript, RNAI, that is complementary to the rep mRNA leader region. In this study, enzymatic probing was used to verify the predicted secondary structures of RNAI and its target RNA. We demonstrated that two stem–loop structures of RNAI, SLRNAI-II and SLRNAI-III, were important for inhibition. A putative U-turn motif detected in the loop of SLrep-I (5′-UUGG-3′) was analysed for its significance to RNAI-mediated inhibition in vivo and Northern blotting suggested that rep mRNA was processed. Taken together, these observations support our previously proposed model but also raise new questions about the replication control mechanism.

Evidence for Two Different Regulatory Mechanisms Linking Replication and Segregation of Vibrio cholerae Chromosome II

Understanding the mechanisms that coordinate replication initiation with subsequent segregation of chromosomes is an important biological problem. Here we report two replication-control mechanisms mediated by a chromosome segregation protein, ParB2, encoded by chromosome II of the model multichromosome bacterium, Vibrio cholerae. We find by the ChIP-chip assay that ParB2, a centromere binding protein, spreads beyond the centromere and covers a replication inhibitory site (a 39-mer). Unexpectedly, without nucleation at the centromere, ParB2 could also bind directly to a related 39-mer. The 39-mers are the strongest inhibitors of chromosome II replication and they mediate inhibition by binding the replication initiator protein. ParB2 thus appears to promote replication by out-competing initiator binding to the 39-mers using two mechanisms: spreading into one and direct binding to the other. We suggest that both these are novel mechanisms to coordinate replication initiation with segregation of chromosomes.

“Chromosome kissing” and modulation of replication termination

Previously, inter-chromosomal interactions called "chromosome kissing" have been reported to control tissue-specific transcription and cell fate determination. Using the fission yeast as a model system we have shown that physiologically programmed replication termination is also modulated by chromosome kissing. The published report reviewed here shows that a myb-like replication terminator protein Reb1 of S. pombe and its cognate binding sites (Ter) are involved in chromosome kissing that promotes a cooperative mechanism of replication termination. We also suggest that at least one other replication terminator protein namely Sap1, which is also an origin binding protein, is likely to be involved in a similar mechanism of control not only of fork arrest but also of replication initiation and in possible ori-Ter interaction. We discuss the roles of chromatin remodeling and other proteins in this novel mechanism of replication control.

The ubiquitin proteasome system in neuropathology

The ubiquitin proteasome system (UPS) orchestrates the turnover of innumerable cellular proteins. In the process of ubiquitination the small protein ubiquitin is attached to a target protein by a peptide bond. The ubiquitinated target protein is subsequently shuttled to a protease complex known as the 26S proteasome and subjected to degradative proteolysis. The UPS facilitates the turnover of proteins in several settings. It targets oxidized, mutant or misfolded proteins for general proteolytic destruction, and allows for the tightly controlled and specific destruction of proteins involved in development and differentiation, cell cycle progression, circadian rhythms, apoptosis, and other biological processes. In neuropathology, alteration of the UPS, or mutations in UPS target proteins may result in signaling abnormalities leading to the initiation or progression of tumors such as astrocytomas, hemangioblastomas, craniopharyngiomas, pituitary adenomas, and medulloblastomas. Dysregulation of the UPS may also contribute to tumor progression by perturbation of DNA replication and mitotic control mechanisms, leading to genomic instability. In neurodegenerative diseases caused by the expression of mutant proteins, the cellular accumulation of these proteins may overload the UPS, indirectly contributing to the disease process, e.g., sporadic Parkinsonism and prion diseases. In other cases, mutation of UPS components may directly cause pathological accumulation of proteins, e.g., autosomal recessive Parkinsonism and spinocerebellar ataxias. Defects or dysfunction of the UPS may also underlie cognitive disorders such as Angelman syndrome, Rett syndrome and autism, and muscle and nerve diseases, e.g., inclusion body myopathy and giant axon neuropathy. This paper describes the basic biochemical mechanisms comprising the UPS and reviews both its theoretical and proven involvement in neuropathological diseases. The potential for the UPS as a target of pharmacological therapy is also discussed.

Growth rate dependent numbers of SeqA structures organize the multiple replication forks in rapidly growing Escherichia coli

When the bacterium Escherichia coli is grown in rich medium, the replication and segregation periods may span two, three or four generations and cells may contain up to 24 replication forks. The newly synthesized, hemimethylated DNA at each fork is bound by SeqA protein. The SeqA-DNA structures form distinct foci that can be observed by immunofluorescence microscopy. The numbers of foci were lower than the numbers of replication forks indicating fork co-localization. The extent of co-localization correlated with the extent of replication cycle overlap in wild-type cells. No abrupt increase in the numbers of foci occurred at the time of initiation of replication, suggesting that new replication forks bind to existing SeqA structures. Manipulations with replication control mechanisms that led to extension or reduction of the replication period and number of forks, did not lead to changes in the numbers of SeqA foci per cell. The results indicate that the number of SeqA foci is not directly governed by the number of replication forks, and supports the idea that new DNA may be 'captured' by existing SeqA structures.

Persistence of Bovine Viral Diarrhea Virus Is Determined by a Cellular Cofactor of a Viral Autoprotease

Polyprotein processing control is a crucial step in the life cycle of positive-strand RNA viruses. Recently, a vital autoprotease generating an essential viral replication factor was identified in such a virus, namely, the pestivirus bovine viral diarrhea virus. Surprisingly, the activity of this protease, which resides in nonstructural protein 2 (NS2), diminishes early after infection, resulting in the limitation of viral RNA replication. Here, we describe that a cellular chaperone termed Jiv (J-domain protein interacting with viral protein) acts as a cofactor of the NS2 protease. Consumption of the intracellular Jiv pool is responsible for temporal regulation of protease activity: overexpression of Jiv interfered with regulation and correlated with increased accumulation of viral RNA; downregulation of the cellular Jiv level accelerated the decline of protease activity and reduced intracellular viral RNA levels and virion production. Accordingly, the amount of a cellular protein controls pestiviral replication by limiting the generation of active viral protease molecules and replication complexes. Importantly, this unique mechanism of replication control is essential for maintenance of the noncytopathogenic phenotype of the virus and thereby for its ability to establish persistent infections. These results add an entirely novel aspect to the understanding of the molecular basis of viral persistence.

Replication of a unit-copy plasmid F in the bacterial cell cycle: a replication rate function analysis

For stability, the replication of unit-copy plasmids ought to occur by a highly controlled process. We have characterized the replication dynamics of a unit-copy plasmid F by a replication rate function defined as the probability per unit age interval of the cell cycle that a plasmid will initiate replication. Analysis of baby-machine data [J. Bacteriol. 170 (1988) 1380; J. Bacteriol. 179 (1997) 1393] by stochastics that make no detailed reference to underlying mechanism revealed that this rate function increased monotonically over the cell cycle with rapid increase near cell division. This feature is highly suggestive of a replication control mechanism that is designed to force most plasmids to replicate before cells undergo division. The replication rate function is developed anew from a mechanistic model incorporating the hypotheses that initiators are limiting and that steric hindrance of origins by handcuffing control initiation of replication. The model is based on correctly folded initiator protein monomers arising from an inactive dimer pool via chaperones in limiting amounts, their random distribution to high affinity sites (iterons) at the origin ( ori) and an outside locus ( incC), the statistical mechanics of bound monomer participation in pairing the two loci ( cis-handcuffing), and initiation probability as proportional to the number of non-handcuffed ori-saturated plasmids. Provided cis-handcuffing is present, this model closely accounts for the shape of the replication rate function derived from experiment, and reproduces the observation that replication occurs throughout the cell cycle. Present concepts of iteron-based molecular mechanisms thus appear capable of yielding a quantitative description of unit-copy-number plasmid replication dynamics.

Biochemical Investigations of Control of Replication Initiation of Plasmid R6K

The mechanistic basis of control of replication initiation of plasmid R6K was investigated by addressing the following questions. What are the biochemical attributes of mutations in the pi initiator protein that caused loss of negative control of initiation? Did the primary control involve only initiator protein-ori DNA interaction or did it also involve protein-protein interactions between pi and several host-encoded proteins? Mutations at two different regions of the pi-encoding sequence individually caused some loss of negative control as indicated by a relatively modest increase in copy number. However, combinations of the mutation P42L, which caused loss of DNA looping, with those located in the region between the residues 106 and 113 induced a robust enhancement of copy number. These mutant forms promoted higher levels of replication in vitro in a reconstituted system consisting of 22 purified proteins. The mutant forms of pi were susceptible to pronounced iteron-induced monomerization in comparison with the WT protein. As contrasted with the changes in DNA-protein interaction, we found no detectable differences in protein-protein interaction between wild type pi with DnaA, DnaB helicase, and DnaG primase on one hand and between the high copy mutant forms and the same host proteins on the other. The DnaG-pi interaction reported here is novel. Taken together, the results suggest that both loss of negative control due to iteron-induced monomerization of the initiator and enhanced iteron-initiator interaction appear to be the principal causes of enhanced copy number.

Stabilizing plasmid copy number to improve recombinant protein production.

The key objective for recombinant protein production in bacteria is the maximum exploitation of the cell factory's potential, whereby often strong expression vectors are used to increase product yield. If the metabolic load caused by recombinant expression exceeds the host's capacity, the system exhausts itself, resulting in a loss of protein yield. Excessive plasmid replication is observed after inducing recombinant gene expression, which greatly contributes to metabolic overload of the host cell. The transcriptional and translational machineries are extremely overstrained. By abolishing sequence homology between ColE1 RNA I/RNA II and tRNAs, we were able to restore the plasmid's replication control mechanisms and to keep the plasmid copy number constant throughout the culture process, thereby prolonging metabolic activity and productivity of the bacterial expression system. Because the bacterial host cell is not being exploited beyond its tolerable potential with this method, the constancy of the plasmid copy number level throughout the whole period of the bioprocess provides novel strategies for bioprocess optimization.

Dimers of pi protein bind the A+T-rich region of the R6K gamma origin near the leading-strand synthesis start sites: regulatory implications.

The replication of gamma origin, a minimal replicon derived from plasmid R6K, is controlled by the Rep protein pi. At low intracellular concentrations, pi activates the gamma origin, while it inhibits replication at elevated concentrations. Additionally, pi acts as a transcription factor (auto)repressing its own synthesis. These varied regulatory functions depend on pi binding to reiterated DNA sequences bearing a TGAGNG motif. However, pi also binds to a "non-iteron" site (i.e., not TGAGNG) that resides in the A+T-rich region adjacent to the iterons. This positioning places the non-iteron site near the start sites for leading-strand synthesis that also occur in the A+T-rich region of gamma origin. We have hypothesized that origin activation (at low pi levels) would require the binding of pi monomers to iterons, while the binding of pi dimers to the non-iteron site (at high pi levels) would be required to inhibit priming. Although monomers as well as dimers can bind to an iteron, we demonstrate that only dimers bind to the non-iteron site. Two additional pieces of data support the hypothesis of negative replication control by pi binding to the non-iteron site. First, pi binds to the non-iteron site about eight times less well than it binds to a single iteron. Second, hyperactive variants of pi protein (called copy-up) either do not bind to the non-iteron site or bind to it less well than wild-type pi. We propose a replication control mechanism whereby pi would directly inhibit primer formation.

Dictyostelium discoideum nuclear plasmid Ddp5 is a chimera related to the Ddp1 and Ddp2 plasmid families.

The 14,955-bp Dictyostelium discoideum nuclear plasmid Ddp5 contains six transcribed open reading frames. One of these is related to the rep gene of the Ddp2 plasmid, and the other five are related to genes present on the Ddp1 plasmid. The absence of a homolog of the Ddp1 G1 gene, coupled with the presence of the Ddp2 rep gene homolog and of a 1.6-kb inverted repeat analogous to the inverted repeats on members of the Ddp2 plasmid family, suggests that Ddp5 uses Ddp2-like replication and copy number control mechanisms and that it should be assigned to the Ddp2 plasmid family. Ddp5 carries genes homologous to the D1/D3 and D2 genes of the Ddp1 plasmid as well as the Ddp1 G2/G3/D4, G5/D6, and G6/G4/D5 genes. The products of the Ddp5 G2-like, G5-like, and G6-like genes are likely to be transcription factors regulating the expression of themselves and of the other Ddp5 genes. The D1-like and D2-like genes may confer a selective advantage to plasmid-bearing cells, because they can be deleted from plasmid-based shuttle vectors with no apparent effect on vector maintenance. Updated sequence information for the Ddp1 G5/D6, D1/D3, and D2 genes as well as the Dmp1 and Dmp2 G5-like genes is presented. The locations of introns in the G5-like and D1-like genes of Ddp5 and in the homologous genes of the Ddp1, Dmp1, and Dmp2 plasmids were identified. These introns all have GU at the 5' intron border and AG at the 3' intron border, are short (59 to 71 nucleotides), and are AT-rich. A conserved HHCC domain was identified in the G5 proteins; this is a putative zinc binding domain and may be involved in protein-DNA interaction.

Introduction to Plasmid Biology

An array of issues pertaining to plasmid biology are presented in this unit. Topics include replicators, an explanation of the mechanism of replication and copy-number control, plasmid incompatibility, selectable markers, cloning sites, and factors to consider when choosing a plasmid vector, whether it be for production of ssDNA, cloning of large inserts, or expression of large quantities of recombinant proteins. Considerations are discussed for the use of plasmids in yeast, cultured mammalian cells and non-E. coli bacteria. Finally, maps of many common useful plasmids are presented. This unit has recently been updated and extensively revised to include some of the latest developments in plasmid construction and experimental use.

Quantitative Model of ColE1 Plasmid Copy Number Control

Initiation of replication of the Escherichia coli plasmid ColE1 is inhibited by formation of a complex between a small RNA (RNA I) and the pre-primer for DNA synthesis (RNA II). Complex formation (and inhibition of replication) is enhanced by the plasmid-encode Rom protein. The in vitro kinetics of complex formation were previously studied both experimentally and theoretically. The in vivo concentrations and half-lives of RNA I, RNA II and Rom protein have been measured recently. We present a dynamic model for the in vivo replication control mechanism that accounts for the measured concentration values. From the model we deduce a simple formula for the steady-state plasmid concentration. Our result agree with a previous simple steady-state analysis done by Brenner and Tomizawa, in that plasmid copy number is most strongly dependent on the per plasmid rate of RNA I synthesis. However, our model predicts other parameter dependencies that are not evident from or at variance with the previous analysis. Accordingly, we predict that plasmid copy number is greatly influenced by changes in the rate constant describing the formation of an initial unstable RNA I-RNA II complex, but is only slightly influenced by changes in the dissociation rate of this complex. Plasmid copy number per average cell volume is predicted to increase linearly with increases in the RNA II synthesis rate and with increases in the generation time of the host culture. Rom protein, which promotes conversion of the unstable RNA I-RNA II complex to a stable complex, serves to decrease copy number, however, its presence or absence does not seem to qualitatively alter the copy number control mechanism. Our model predicts the quantitative increase of plasmid copy number in rom - mutants. Several experiments are suggested to investigate the predications of the model.

Staphylococcus aureus chromosomal mutation plaC1 amplifies plasmid pT181 by depressing synthesis of its negative-effector countertranscripts.

A Staphylococcus aureus chromosomal mutation, plaC1, which leads specifically to the amplification of plasmid pT181 has previously been described (S. Iordanescu, Plasmid 10:130-137, 1983). The mechanism by which plaC1 amplifies plasmid pT181 has been approached in two ways: determination of the plasmid region required for the specific response to the plaC1 mutation and evaluation of different parameters of pT181 replication control by using transcriptional and translational fusions with the beta-lactamase gene as an indicator gene. The results obtained indicate that the control region of plasmid pT181 represents the target of the plaC1 effect, which acts primarily by depressing the synthesis of plasmid pT181 countertranscripts, those small, untranslated RNA molecules playing the roles of negative effectors in the replication control mechanism of the plasmid. In turn, the reduction in countertranscript synthesis leads to an increase in the production of the initiator protein RepC, which is limiting for plasmid replication, and a higher plasmid copy number.

Staphylococcus aureus chromosomal mutations that decrease efficiency of Rep utilization in replication of pT181 and related plasmids.

Staphylococcus aureus chromosomal mutants which maintain pT181 and related plasmids at a much reduced copy number but which do not affect the replication of other plasmids have been isolated. The origin of replication and the initiator protein of the affected plasmids are the only elements required for the response to these mutations. The host mutations do not interfere with the pT181 replication control mechanism.

Complete nucleotide sequence of the low copy number plasmid pRAT11 and replication control by the RepA protein in Bacillus subtilis.

The 2.6 kb kanamycin-resistant (Kmr) plasmid, pRAT11, was constructed using both the replication determinant (repA) region of the 10.8 kb tetracycline-resistant (Tcr) low copy number plasmid pTB52 and another fragment (0.9 kb) that contained solely the Kmr gene of pUB110. The complete nucleotide sequence of this plasmid was determined. The repA region contained a large open reading frame encoding RepA protein (396 amino acid residues). In vitro transcription and translation of the repA gene were confirmed. RepA protein was shown to be indispensable for plasmid replication, and acted in trans on DNA. The part of the repA gene encoding the specific recognition region of the RepA protein was located and contained 3.5 direct repeats of 24 bp (GGTTTCAAAAATGAAACGGTGGAG). Upstream and downstream of the direct repeats were the recognition sequence (TTATCCACA) of the Escherichia coli DnaA protein and an AT-rich region, respectively. The replication control mechanism of the low copy number Bacillus plasmid is discussed.

The copy number of Bacillus plasmid pRBH1 is negatively controlled by RepB protein.

The replication control mechanism of Bacillus plasmid pRBH1 was analysed; pRBH1 contains four promoters, P1 to P4, and a large inverted repeat (63 base pairs) upstream of the protein (RepB) coding sequence. The stem and loop structure is surrounded by two promoters, P1 and P3, with different directions of transcription. One base substitution in the loop structure caused a change in copy number. Since the P1 promoter is located upstream of the replication origin of pRBH1, the transcript from the P1 promoter might serve as the primer of DNA replication. In vivo transcription from the P1 promoter was repressed by a trans-acting plasmid gene product. Since the RepB protein is involved in copy number control and RepB contains the consensus amino acid sequence of DNA binding proteins, RepB was thought to be the repressor. It was concluded from these data that the inverted repeat is involved in the control of copy number of the plasmid pRBH1. The RepB protein also contains two regions highly homologous with the Rom protein encoded on Escherichia coli plasmid ColE1. The possible mechanism for the copy number control of the plasmid via RepB protein and/or RNAs is discussed.