Maximum Body Width Research Articles

Caffeic acid: A game changer in pine wood nematode overwintering survival.

Following the invasion by the pine wood nematode (PWN) into north-east China, a notable disparity in susceptibility was observed among Pinaceae species. Larix olgensis exhibited marked resilience and suffered minimal fatalities, while Pinus koraiensis experienced significant mortality due to PWN infection. Our research demonstrated that the PWNs in L. olgensis showed a 13.43% reduction in lipid content compared to P. koraiensis (p < 0.05), which was attributable to the accumulation of caffeic acid in L. olgensis. This reduction in lipid content was correlated with a decreased overwintering survival of PWNs. The diminished lipid reserves were associated with substantial stunting in PWNs, including reduced body length and maximum body width. The result suggests that lower lipid content is a major factor contributing to the lower overwintering survival rate of PWNs in L. olgensis induced by caffeic acid. Through verification tests, we concluded that the minimal fatalities observed in L. olgensis could be attributed to the reduced overwintering survival of PWNs, a consequence of caffeic acid-induced stunting. This study provides valuable insights into PWN-host interactions and suggests that targeting caffeic acid biosynthesis pathways could be a potential strategy for managing PWN in forest ecosystems.

Morphometric characteristics of Antarctic krill (Euphausia superba) and finfish bycatch in the krill fishery in the waters of South Orkney Islands during the 2022/23 fishing season

Determination of bar spacing of bycatch reduction devices (BRDs) should consider species composition and morphometric characteristics (particularly width) of target species krill and bycatch. This study conducted a scientific investigation of the finfish bycatch in the Antarctic krill (Euphausia superba) trawl fishery by the fishing vessel SHEN LAN in the waters surrounding the South Orkney Islands from December 24, 2022, to February 20, 2023. The results show that scientific observers sampled 676 individuals of finfish bycatch. Of these, 665 were identified to species (17 species from 8 families), while the remaining 11 specimen were juveniles of the Nototheniidae family that could not be identified to the species level. IRI (index of relative importance) calculations showed three dominant (IRI value greater than 1,000) finfish bycatch species (Champsocephalus gunnari, Pseudochaenichthys georgianus, and C. aceratus from the Channichthyidae family) and four important (IRI value between 1,000 and 100) finfish bycatch species (Electrona carlsbergi and Gymnoscopelus nicholsi from the Myctophidae family, Gobionotothen gibberifrons from the Nototheniidae family, and Notolepis coatsi from the Paralepididae family). Our study provides morphometric data (particularly body width) that is crucial to model the potential for bycatch reduction by use of bycatch reduction devices (BRDs) and to determine the appropriate candidate bar spacings for BRD sea trials. Predictions suggest that a 10 mm (the maximum body width of krill) bar spacing releases a significant amount of dominant and important bycatch species (93.94% of C. gunnari, 53.99% of P. georgianus, 76.25% of C. aceratus, and 100% of G. gibberifrons). Reduced fishing pressure would reduce the risks to dominant and important bycatch species to make the krill fishery sustainable. We recommend that future BRD sea trials should initially test a 10 mm bar spacing. If marked loss of krill is observed, wider spacings (e.g. 15 mm) must be tested.

A new species of Australotaenia (Cestoda: Proteocephalidae) from a hylid frog in Australia

A new species of the little-known genus Australotaenia de Chambrier &amp; de Chambrier, 2010 is described from Ranoidea australis (Gray) (Anura: Hylidae), commonly known as the giant frog, northern snapping frog or round frog and which is a burrowing frog species native to Australia. Australotaenia hobbsi n. sp. is the fourth species of the genus, but the first taxon found in a burrowing frog and in northern Australia. The other species were found in Australian tree frogs (Litoria spp.) in southwestern and southeastern Australia, and in the homalopsid snake Enhydris enhydris (Schneider) in Cambodia. Australotaenia hobbsi n. sp. differs from its congeners (i) by the wider strobila (maximum body width 1,750 µm versus &lt; 930 µm), scolex (570 µm versus &lt; 390 µm) and suckers (diameter 215–230 µm versus &lt; 140 µm); (ii) by the smaller relative size of the cirrus sac (12–15% of proglottid width versus 17–33%); (iii) by the absence of a vaginal sphincter (present in the other three species); (iv) different arrangement of the inner longitudinal musculature, which consists of a few individual muscle fibres (in contrast to the fibres grouped in bundles in other species). Australotaenia species and Pangasiocestus romani Scholz &amp; de Chambrier, 2012 from the spot pangasius Pangasius lernaudii Boucourt, both of the subfamily Acanthotaeniinae, are unique among proteocephalids in terms of intermediate uterine development, with a high concentration of chromophilic cells around the tip of the lateral uterine diverticula.

First Report of the Root-Knot Nematode Meloidogyne incognita on Bletilla striata Rchb.f. (Orchidaceae) in China.

Bletilla striata Rchb.f., is a perennial herbaceous bulbous plant known as the Chinese ground or hyacinth orchid classified in the Orchidaceae. It is native to southeast Asia and mainly distributed in China, Japan and northern Myanmar (He et al. 2017). It has the functions of astringent hemostasis and analgesia, and can also be used to treat traumatic bleeding, ulcers, swelling and chapped skin. Therefore, it occupies an important position in traditional Chinese medicine (Xu et al. 2019). In June 2023, three farmers in Mengzi (103.39°N, 23.21°E), Yunnan Province, China, observed that some Bletilla striata Rchb.f. plants grew poorly with small and chlorotic leaves (Figure 1 A). We suspected that these symptoms were caused by root-knot nematode infection, but the galls on the roots were small and inconspicuous (Figure 1 A). The presence of nematode females in both the galled regions and the normal roots (Figure 1 B), revealed by fuchsin staining (Byrd et al. 1983), indicated that the symptoms were probably caused by root-knot nematode infection. To estimate the incidence rates, we randomly selected 100 B. striata Rchb.f. plants from each of five fields representing a total area of 3000 m2. In these fields, the occurrence of stained root-knot nematodes were 19.3%, 17%, 18.3%, 15%, and 13%, respectively. The gall rating of the infected plants in the B striata Rchb.f. samples collected from the five fields was 2 (rating scale of 0 to 5). Females (n=20), second-stage juveniles (J2s, n=20) and egg masses (n=20) were extracted and collected from roots and soil for morphological and molecular identification. The females had a white, pyriform body and their perineal patterns exhibited a high and square dorsal arch, lacking distinct lateral line (Figure 1. C & D). Measurements of females (n = 20) were: body length (BL) = 708.64±89.6 µm (554.36 to 844.51 µm); maximum body width (BW) = 461.73±47.44 µm (365.25 to 561.49 µm); stylet length (ST) = 15.49±3.15 µm (10.55 to 19.78 µm); and distance from dorsal esophageal gland opening to the stylet knobs (DGO) = 3.33±0.27 µm (2.77 to 3.93 µm). Measurements of J2s (n=20) were BL = 417.7±47.67 µm (342.16 to 499.68 µm); BW = 15.74±2.66 µm (11.05 to 25.63 µm); ST = 12.49±1.12 µm (10.19 to 15.02 µm); DGO = 2.64±0.59 µm (40.17 to 68.74 µm); tail length = 51.93±8.55 µm (10.43 to 27.22 µm); hyaline tail terminus = 18.23±3.99 µm (1.48 to 3.98 µm). These morphological features match the description of Meloidogyne incognita (Eisenback et al. 1981). To further confirm the species, we selected three infected plants from each field for molecular identification, the ITS region amplified using the primers 18S/26S (5'-TTGATTACGTCCCTGCCCTTT-3',5'-TTTCACTCGCCGTTACTAAGG-3') (Vrain et al. 1992) . A 729 bp PCR product of ITS region (accession nos. OR463907) was obtained from all infected plants. The amplicons from 18S/26S primer pair were sequenced and the sequences showed 95.29% homology with sequences of M. incognita (accession nos. MT209948.1). Moreover, a 835 bp DNA fragment (accession nos. OR469000) was obtained using the specific primers Mi-F/Mi-R (5'-GTGAGGATTCAGCTCCCCAG-3',5'-ACGAGGAACATACTTCTCCGTCC-3') for M. incognita (Meng et al. 2004), the sequence showed 99.28% homology with sequences of M. incognita (accession nos. ON416569). The morphological features and molecular data confirmed the identification of the root-knot nematode on B. striata Rchb.f. as M. incognita. To confirm the pathogenicity, ten healthy B. striata Rchb.f. seedlings were each inoculated with 500 freshly hatched J2s isolated from field Bletilla striata Rchb.f.. Five healthy seedlings without J2 inoculation were used as controls. At 60 days after inoculation, most of the inoculated plants exhibited similar symptoms to those initially observed by farmers in the field. On average, 1532 J2s were recovered from each inoculated plant, yielding a reproductive factor of 2.1. The gall rating for these inoculated plants was 2. Fuchsin staining revealed the presence of root-knot nematode females within the roots, with an average of 17 females detected per inoculated plant. No symptoms were observed in the control plants. This is the first report of M. incognita infecting B. striata Rchb.f. in China. M. incognita can cause severe infection and damage to some crops, resulting in serious economic losses (Eisenback, 2022). The growers need to take measures to prevent the spread of this nematode.

Pollinators of Arisaema nambae (Araceae), endemic to Okayama and Hiroshima prefectures, western Japan

Effective pollinators of Arisaema nambae Kitam., endemic to western Okayama and eastern Hiroshima prefectures, western Japan, were determined, and 113 insects from 24 spathes of A. nambae in three populations in Okayama Prefecture were collected. Most floral visitors were fungus gnats (Mycetophilidae and Sciaridae). Their maximum body width was less than the internal diameter (ca. 2 mm) of the exit at the bottom of the staminate spathe. Pollen grains of Arisaema attached to the bodies of fungus gnats collected from pistillate spathes provided evidence that they visited the pistillate spathe after escaping from staminate spathes. Based on their visitation frequency, size compatibility between their body and the exit from the staminate spathes and the pollen loads they carry, fungus gnats appear to play an important role in the pollination of A. nambae.

First report of the root-knot nematode Meloidogyne enterolobii on sweet potato in Georgia, United States.

Five species of root-knot nematodes (RKN), Meloidogyne spp. (M. haplanaria, M. incognita, M. floridensis, M. javanica, and M. arenaria) were detected in 67% of vegetable-growing regions in Georgia, United States (Marquez et al. 2021a, b; Marquez and Hajihassani 2022a, b). In October 2021, two sweet potato (Ipomoea batatas) samples (FF1 and FF2) collected at harvest from a field located in Tattnall County, Reidsville, GA were received for assessment. Symptoms of RKN damage on storage roots included a veiny appearance, surface cracking, and bumpy yellow to brown colored specks (Fig. 1). The population density of RKN second-stage juveniles (J2) was 148 and 180 J2/100 cm3 of soil for FF1 and FF2 samples, respectively. Genomic DNA was isolated by smashing females (n=10) individually in 20 µL of PCR-grade water, followed by freezing at -20°C overnight and thawing at 95°C for 1 min. Each DNA sample was first analyzed with a duplex PCR method using RKN species-specific primer sets for the most common nematode species: Mi2F4/Mi1R1 (M. incognita) and Far/Rar (M. arenaria) and SEC-1F/SEC-1R (M. incognita) and Fjav/Rjav (M. javanica) (Zijlstra et al. 2000; Hajihassani et al. 2022). Since this method failed to identify the RKN species, DNA samples were amplified with Me-F and Me-R primers, specific for diagnosing M. enterolobii (Long et al. 2006). Species-specific PCR produced a 240 bp DNA fragment for FF1 and FF2 samples (Fig. 2), corresponding to M. enterolobii. RKN species identification was confirmed by DNA sequencing using C2F3/1108 and TRNAH/MRH106 primers (Powers et al. 2018; Stanton et al. 1997). Products of C2F3/1108 (GenBank accessions ON320401 and ON320405) were 100% identical with 100% query coverage to a North Carolina M. enterolobii isolate (MN809527), while TRNAH/MHR106 sequences (ON320402 and ON320406) was 99.4-99.8% identical with 89-91% query coverage to a China isolate (MF467278). Measurements [Mean (range)] of body length of M. enterolobii J2 (BL): 454.0 (411.3-485.1) µm; maximum body width (BW): 15.1 (13.8-17.0) µm; stylet length: 14.3 (12.7-15.2) µm; total BL/greatest BW: 30.1 (28.6-31.4) µm; and BL/head end to posterior end of metacorpus: 7.3 (6.5-8.2) µm. Morphological measurements of J2 were comparable to the original description of M. enterolobii Yang and Eisenback. The host suitability of sweet potato varieties [Covington (susceptible to M. enterolobii), Beauregard (susceptible to intermediate), and Regal (resistant)] to the M. enterolobii isolate was assessed (Rutter et al. 2021). Nematode eggs were extracted from skin/bumps of samples FF1 and FF2 by blending (15 sec) and shaking in a 0.5% NaOCl solution (5 min), followed by washing and centrifugation in a standard sucrose solution. Sweet potato slips were transplanted in 10.8-cm-diam. pots filled with sand and steamed field soil (1:1 v/v), and two days after planting, were inoculated with 10,000 eggs of M. enterolobii (six replicates per plant variety). Plants were maintained in a greenhouse at 25-28°C for 85 days in a completely randomized design. Root galling index (scale of 0 to 5) of 4.4, 4.2, and 0.8 (Fig. 3) and reproduction factor (final egg numbers/initial egg number) of 8.2, 7.5, and 0.01 were obtained for Covington, Beauregard, and Regal, respectively confirming that Covington and Beauregard are susceptible to M. enterolobii while Regal is resistant. Meloidogyne enterolobii has not been reported in GA and this is the first report of the nematode on sweet potato in the state. This RKN species is an emerging pest of economic importance in many crops in the Southern United States (Brito et al. 2004; Rutter et al. 2018; Ye et al. 2013). Development of effective short- and long-term control procedures is urgently needed for managing M. enterolobii.

First Report of Stunt Nematode, Tylenchorhynchus zeae, on Corn in Republic of Korea.

Corn (Zea mays), one of the major food sources it contains rich in fiber and many vitamins, is one of the most widely consumed cereal grains in Republic of Korea. A survey of plant-parasitic nematodes (PPNs) was carried out in corn fields in Goesan, Republic of Korea from August in 2021. PPNs were extracted from the corn roots and soil using modified Baermann funnel methods and were identified using morphological and molecular analyses. Among the roots and soil samples of 21 fields, 5 fields (23.8%) were infected with stunt nematodes. Tylenchorhynchus zeae was originally described in India from soil around corn and is reported to dwarf plants, yellow leaves (Sethi and Swarup, 1968). Morphologically, characteristics of females were very similar to T. zeae with cylindrical body and slightly ventrally arcuated after fixation. Lip region slightly offset from body with four annuli. Stylet with anteriorly flattened knobs, the vulva was located in the center of the body, didelphic-amphidelphic reproductive system and tail conoid, tail terminus with obtuse smooth, with four incisures areolated throughout body. Bodies of males were similar to females but with shaper tails, with relatively strong bursa and spicules (Fig. S1). The morphology of Korean populations was in agreement with the described populations of India and China (Alvani et al., 2017; Xu et al., 2020). Measurements and micrographs with the light-microscope (DM5000; Leica[Germany]) and camera (DFC450; Leica[Germany]) were taken from females (n=10) for mean, standard deviation and range of body length: 553.2 ± 41.2 (492.7-643.6) µm, maximum body width: 19.4 ± 1.0 (17.6-21.0) µm, stylet length: 18.1 ± 0.4 (17.5-18.7) µm, percent of distance from anterior end to vulva / body length: 58.5 ± 1.3 (56.1-60.9), tail length: 31.7 ± 1.2 (30.3-34.0) µm, and distance of anterior to excretory pore: 96.5 ± 1.8 (94.1-99.4) µm. In addition, PCR was performed for the 28S rDNA D2-D3 segments using the primers D2A and D3B, and ITS region with the primers TW81 and AB28. The newly obtained sequences were submitted to GenBank database under accession numbers ON909086, ON909087 and ON909088 of 28S rDNA D2-D3 segments, and ON909123, ON909124 and ON909125 of ITS region. The resulting 28S rDNA D2-D3 segment sequences were 100% identical to KJ461565 and the BLASTn search of the ITS region sequences was most similar to T. zeae (KJ461599), which is the species isolated from corn in Spain. The identities of ITS region sequences on these populations were 99.89% (893/894), with no insertions/deletions. The phylogenetic relationships of the population strongly support T. zeae (Fig. S2). Phylogenetic relation analysis based on the two genes was constructed using PAUP version 4.0 and MrBayes 3.1.2 programs. To confirm pathogenicity, a modified version of Koch's postulates was conducted in the greenhouse by inoculating 100 females and males onto each of five pots of seedling corn (cv. Daehakchal) filled with the sterilized sandy soil and maintained for 60 days at 25℃ under the conditions. Tylenchorhynchus zeae reproduction factor was 2.21 ± 0.37 was observed at the end of the trial in soil on pots. The stunted and swollen roots and dwarfed and yellowing leaf shoots symptoms in the greenhouse pots trial were confirmed the same as those typical damage symptoms. To the best of our knowledge, this is the first report of T. zeae in Republic of Korea. The host range of T. zeae includes some economic crops such as cabbage, cauliflower, grapevine, and olive (Chen at al., 2007; Handoo et al., 2014). It is necessary to investigate the damage to economic crops in the Republic of Korea to this nematode.

First Record of Meloidogyne incognita on Maize (Zea mays) in Shaanxi Province of China.

Meloidogyne incognita can severely infect and harm some crops in temperate zones under open field in some cases, even though it's more widespread and economically important in tropical and subtropical regions (Eisenback, 2020). In early June 2022, patches with poor growth maize plants were observed in Dali County (109.93E, 34.80N) of Shaanxi province, China. The infected maize plants were stunted with galled and small roots. Females, males, second-stage juveniles (J2s) and egg masses were extracted and collected from galled roots and soil for morphological identification. The perineal pattern of females had a dorsally high square arch lacking obvious lateral lines. Stylet knobs of females were rounded and set off. The excretory pores were at level of or posterior to stylet knobs, 10-20 annules behind head. The head cap of males was flat to centrally concave, the stylet shaft constricted slightly at the junction with the knobs, and stylet knobs were broadly elongate to round, set off, flat and the width usually greater than the height. Measurements of females (n=20) were: body length (L)= 734.63 ± 79.24 µm (642.15 µm to 788.48 µm); maximum body width (W)= 487.14 ± 50.79 µm (426.09 µm to 556.42 µm); stylet length (ST)= 14.78 ± 1.57 µm (13.17 µm to 16.56 µm); and distance from dorsal esophageal gland opening to the stylet knobs (DGO)= 3.55 ± 0.13 µm (3.17 µm to 3.90 µm). Measurements of males (n=10) were: L=1483.76 ± 134.81 µm (1174.39 µm to 1635.62 µm); W=44.37 ± 3.28 µm (39.76 µm to 50.26 µm); ST= 19.76 ± 1.05 µm (17.84 µm to 22.36 µm); and DGO= 3.48 ± 0.28 µm (3.08 µm to 3.87 µm). The morphological characteristics of this nematode were consistent with Meloidogyne incognita (Kofoid and White, 1919) Chitwood, 1949 (Williams, 1973; Eisenback and Hirschmann, 1981). Moreover, the identification was further confirmed by PCR using two pairs of primers, D2A/D3B and NAD5F/R, with DNA extracted from 20 individual females, respectively (Subbotin et al., 2006; Janssen et al., 2016). Both the D2-D3 region sequence (MZ665547) amplified by D2A/D3B and the 597 bp sequence (MZ665548) amplified by NAD5F/R showed >99% identity with sequences of other M. incognita isolates. Both morphological and molecular data identified the root-knot nematodes on maize as M. incognita. Then ten maize seedlings maintained in pots containing autoclaved sandy soil at 25°C were each inoculated with 2000 freshly hatched J2s of the original population of M. incognita. At 45 days after inoculation, all inoculated plants developed gall symptoms on the roots similar to those in the field. And five non-inoculated maize seedlings showed no symptoms. Females dissected from inoculated plants were identified to be M. incognita with species-specific primers IncK-14F/IncK-14R (Randig et al., 2002). According to consultation, in the same field root-knot nematode infected carrots were harvested in November last year, the field was left unploughed until March when maize was sowed. As Dali County locates in north temperate zone with a warm temperate climate, where the average annual temperature is 14.4°C, and the highest and lowest temperature was 18°C and -9°C in last winter, the overwintering rate of M. incognita in open field in such area needs further study.

RESURRECTION OF PLESIOCREADIUM WINFIELD, 1929 (DIGENEA: MACRODEROIDIDAE) WITH PHYLOGENETIC ANALYSES AND SUPPLEMENTAL OBSERVATIONS OF ITS TYPE SPECIES FROM RIVERS IN ARKANSAS, MISSISSIPPI, NEW YORK, AND TENNESSEE.

We herein resurrect and emend PlesiocreadiumWinfield, 1929 (Digenea: Macroderoididae) and provide a supplemental description of its type species, Plesiocreadium typicumWinfield, 1929, based on adult specimens collected from the intestine of bowfins, Amia calva Linnaeus, 1766 (Amiiformes: Amiidae), captured in the L'Anguille River (Mississippi River Basin, Arkansas), Big Lake (Pascagoula River Basin, Mississippi), Chittenango Creek (Oneida Lake, New York), and Reelfoot Lake (Tennessee River Basin, Tennessee). Plesiocreadium spp. (Pl. typicum and Plesiocreadium flavum [Van Cleave and Mueller, 1932] n. comb.) differ from other macroderoidids by having a dorsoventrally flat forebody, ceca that extend posteriad beyond the testes and that do not form a cyclocoel, testes that are greater than one-half of maximum body width, a cirrus sac that is dorsal to the ventral sucker and arches dextrad or sinistrad, a uterine seminal receptacle, asymmetrical vitelline fields that remain separated anteriorly and posteriorly and that extend anteriad to the level of the ventral sucker, and an I-shaped excretory vesicle. Bayesian phylogenetic analyses (ITS2 and 28S) recovered monophyletic Plesiocreadium sensu stricto (as defined herein) sister to Macroderoides trilobatusTaylor, 1978 and that clade sister to the remaining macroderoidids, with sequences ascribed to species of Macroderoides Pearse, 1924 recovered as paraphyletic. We regard Macroderoides parvus (Hunter, 1932) Van Cleave and Mueller, 1934, M. trilobatus, and RauschiellaBabero, 1951 as incertae sedis. Arkansas, New York, and Tennessee comprise new locality records for Pl. typicum.

First report of the root-knot nematode Meloidogyne incognita on Salvia miltiorrhiza Bunge in Henan Province, China.

First report of the root-knot nematode Meloidogyne incognita on Salvia miltiorrhiza Bunge in Henan Province, China.

First Report of Northern Root-Knot Nematode Meloidogyne hapla on Atractylodes lancea in Hubei Province, China.

Atractylodes lancea (Thunb.) DC. is a well-known medicinal plant with high medicinal and economic value, and currently more than 6000 hectares are planted in China. Root-knot nematodes Meloidogyne hapla has been one of the most important pathogens on A. lancea. In September 2019, A. lancea plants exhibiting symptoms of severely stunting and gall formation in the roots associated with root-knot nematode (RKN; Meloidogyne spp.) were detected in a commercial production field in Yingshan, Hubei Province, China (30.96°N; 115.94° E). Females and second-stage juveniles (J2s) collected from roots had the following morphometric characteristics: females (n=20) were pear-shaped, the front part of the worm had a prominent neck, and the stylet was short and obvious. The perineal pattern of females were generally round hexagonal or round-shaped, with a squared-off dorsal arch or a rounded-off arch, some had lateral lines marked (Eisenback et al. 1980). Body length (L) = 750.49 ± 87.02 μm (578.75 - 902.65 μm), maximum body width (W) = 471.97 ± 70.95 μm (318.7 - 586.3 μm), stylet length = 15.18 ± 0.96 μm (13.52 - 17.04 μm), dorsal pharyngeal gland orifice to stylet base (DGO) = 3.07 ± 0.37 μm (2.60 - 3.80μm). The second-stage juveniles (n=20): L = 480.05 ± 42.73 μm (375.3 - 552.5 μm), stylet length =12.59 ± 1.39 μm (10.5 - 16.8 μm), tail length= 53.35 ± 1.55 μm (51.8 - 54.9 μm), hyaline tail terminus =11.45 ± 0.65 μm (10.2 - 12.1 μm). The morphological characteristics matched the original description of M. hapla (Chitwood 1949). Males were not found. Matrix code for the polytomous key proposed by Castillo (Castillo et al. 2021): Female: A23, B43, C213, D1 (A, Body length; B, Stylet length; C, The excretory pore position in the female in relation to the stylet length (EP/ST) ratio; D, Perineal pattern morphology); J2: A3, B3, C34, D324, E32, F3 (A, Body length; B, Stylet length; C, Tail length; D, Hyaline region length; E, The long tail length to the short tail length ratio; F, The long hyaline region length to the short hyaline region length ratio). The DNA, extracted from six single females, was used for species identification, and 28S rDNA D2/D3 universal primers D2A (5'ACAAGTACCGTGAGGGAAAGTTG3') and D3B (5'TCGGAAGGAACCAGCTACTA3') were used (Nunn 1992). The DNA fragment obtained showed that the amplified sequences of the D2/D3 region (GenBank Accession No. MZ 570969, 769bp) shared 100% homology with the sequences of M. hapla (MN752204.1, MN752204.1, MN752204.1). Furthermore, species-specific SCAR primers JMV1 (5'GGATGGCGTGCTTTCAAC3') and JMV hapla (5'AAAAATCCCCTCGAAAAATCCACC3') were used as described by Dong et al. (2015). PCR produced 442-bp sequences. Fragments were sequenced (GenBank Accession No. OM 864510, 442bp) and compared with available sequences on NCBI. Sequences were 99%-100% identical to the M. hapla sequences (GenBank Accession Nos. AJ421708.1, GQ130137.1 and AJ421707.1). To verify the nematode pathogenicity on A. lancea, ten RKN-free A. lancea seedlings were transplanted into plastic pots. After 21 days, the roots of eight plants were inoculated with 1,200 J2s and eggs of M. hapla that were the same isolate collected from the field per plant and two uninoculated plants were used as control. Plants were maintained in a greenhouse at 25°C and 70% relative humidity with a 12-h/12-h light/dark photoperiod. After 70 days, all inoculated plants exhibited stunting and had scarce galling on roots. This is similar to those fieldgrown plants. No galling or symptoms were observed on the control plants. The nematode reproduction factor (RF = final population/initial population) was 2.3. These results had confirmed that the root-knot nematode population on A. lancea was M. hapla. The rhizome yields and quality of the A. lancea infected by M. hapla were seriously affected, which caused severe economic losses. Moreover, the infected plants tended to be more susceptible to some bacterial and fungal diseases, such as root rot disease. To our knowledge, this is the first report of A. lancea as a new host of M. hapla in Hubei Province, China.

Functional traits of soil nematodes define their response to nitrogen fertilization

Abstract Nitrogen (N) fertilization and warming are two crucial global change factors affecting the soil nematode communities. The effects of N fertilization and warming, however, on nematode communities in soils are inconsistent across ecosystems and maybe be even opposite. One key reason is that the commonly used taxonomic diversity is less sensitive to environmental changes than the seldom‐used trait‐based indicators. To verify this, we performed an 8‐year field experiment with four N fertilization levels with and without soil warming and collected an extensive dataset consisting of (i) six traits related to the nematode performance, that is, body size, maximum body length, maximum body width, stylet length, oesophagus length and intestinal length; (ii) the taxonomic alpha (richness and abundance) and beta diversity (Bray–Curtis dissimilarities) of the whole nematode community and each nematode functional group, (iii) soil food web resources (the total taxonomic richness and abundance of plant, bacterial and fungal communities) and (iv) soil properties (pH, total, ammonium and nitrate N, microbial N and C, total and available P and soil water content). We found that N fertilization altered plant diversity and soil nitrate levels, which in turn decreased taxonomic alpha diversity of two nematode functional groups (phytophagous nematodes and predators), but taxonomic diversity for the whole nematode community remained stable. The decreased taxonomic alpha diversity of phytophagous nematodes resulted in increased maximum body width, but decreased stylet length and oesophageal length. Mild warming (~ 0.7°C) had no effects on soil properties and soil food web resources, and the taxonomic diversity or nematode traits remained unchanged. Our results reveal that nematode functional traits show strong responses to N fertilization as individual nematode groups adapted quickly to changed soil properties and food web resources. Taxonomic diversity indices, however, were more stable under these changes showing that the functional composition of nematode communities may respond in the short term despite little effects on species diversity. Thus, the trait‐based indicators not only reveal how nematodes respond to N fertilization, but also how nematodes mediate the effects of N fertilization on ecosystem functioning (i.e. soil nutrient cycling). Read the free Plain Language Summary for this article on the Journal blog.

First Report of the Root-Knot Nematode Meloidogyne enterolobii infecting Acalypha australis in China.

Copperleaf (Acalypha australis; Euphorbiaceae), widely cultivated in China, is a traditional Chinese herbal medicine that is used for clearing heat and detoxifying, astringency and hemostasis (Zhang and Zhang 1994). In September 2021, wild Asian copperleaf plants showed leaf yellowing in a corner outside a greenhouse (22°50' N; 108°17' E), Guangxi Province, China. Galls and egg masses were observed on the plant roots on approximately 60% of plants. Females and second-stage juveniles (J2) were dissected and extracted from roots with galls. The perineal pattern of females was dorsal-ventrally oval with low and round dorsal arches, lacking clear lateral lines. Morphological measurements of females (n=20; mean ± standard error) were body length (BL) 697.7 ± 17.3 μm, maximum body width (BW) 521.5 ± 18.3 μm, stylet length 14.8 ± 0.3 μm, and dorsal pharyngeal gland orifice to stylet base (DGO) 5.1 ± 0.2μm. J2s (n = 20) were vermiform, had a slender tail, with a tapering to rounded tip with distinct hyaline region at the tail terminus and had the following morphological measurements: BL 475.5 ± 32.7 μm, BW 16.7 ± 0.6 μm, stylet length 14.4 ± 1.4 μm, DGO 3.9 ± 0.1 μm, hyaline tail length 18.0 ± 0.6 μm, and tail length 50.1 ± 1.2 μm. These morphological characteristics fit the description for Meloidogyne enterolobii (Yang and Eisenback 1983). In order to confirm species identification, genomic DNA was extracted from 12 single J2 (Luo et al. 2020). Species identity was further explored by the rDNA-internal transcribed spacer (ITS) region using primers V5367/26S (Vrain et al. 1992), and the D2-D3 fragment of the 28S ribosomal RNA gene using primers D2A/D3B (De Ley et al. 1999). The sequences for the target genes were 733 bp (GenBank accession no. OM168996) and 734 bp (GenBank accession no. OM177195), respectively. Homologies were 99 to 100% identical with those in GenBank for known sequences of M. enterolobii. Furthermore, species identification was confirmed using PCR to amplify a portion of the rDNA-IGS2 with M. enterolobii-specific primers Me-F/Me-R (Long et al. 2006). Koch's postulates was tested in a greenhouse at 25 to 28˚C temperature. Eggs were multiplied on tomato in the greenhouse using a single egg mass hand-picked from originally natural infected A. australis roots. Fifteen A. australis seedlings maintained in 14.5-cm diameter and 10-cm high pots containing autoclaved sandy soil (sand/soil = 3:1), one seedling/pot, inoculated with 5,000 eggs/plant, and five noninoculated seedlings were used as controls. After 60 days, all inoculated plants showed galling root symptoms and the control plants displayed no symptoms. The reproduction factor (Rutter et al. 2021) on A. australis was 4.3. Furthermore, the morphological and molecular characterization of the nematode was identical to the original samples. To our knowledge, this is the first report of M. enterolobii infecting Asian copperleaf that is cultivated in 29 provinces/regions of China. The growers should be aware of this nematode and take measures to avoid spread and serious economic losses.

First Report of Pratylenchoides leiocauda parasitic on Perilla frutescenes in the Republic of Korea.

Perilla (Perilla frutescens (L.) Britton var. japonica) is an annual herbaceous crop belonging to Lamiaceae. It is one of the most important crops in Korea. A survey of plant parasitic nematodes was carried out in 70 perilla fields in Geumsan and Miryang, Korea in 2020. Migratory endo-parasitic nematodes were extracted from the perilla roots using modified root incubation methods (Mountain and Patrick, 1959). False root-lesion nematodes (Pratylenchoides) were recovered from 41.4% of the fields. They were identified using morphological and molecular analyses. Among the Pratylenchoides species, Pratylenchoides leiocauda was described in France from soil around non-identified grass and weeds. P. leiocauda is reported to weaken the root systems of tomato, potato and strawberry (Sher, 1970; Li et al., 2020). The morphological characteristics of males and females from the 2020 survey were very similar to P. leiocauda. The lateral field contained six incisures and the pharyngeal glands overlapped the intestine dorsally for 1-2 times the body width. Additionally, they had a second nucleus near the pharyngeal intestine valve, female tails with incisures, and a smooth conical tail with 18-23 annules. Measurements and micrographs with the light-microscope (DM5000, Leica, Germany) and camera (DFC450, Leica, Germany) were taken from females (n=23) for mean, standard deviation and range of body length: 824.5 ± 71.0 (657.7-993.8) µm, maximum body width: 28.4 ± 2.7 (24.8-36.2) µm, stylet length: 22.8 ± 0.7 (21.4-24.0) µm and percent of distance from anterior end to vulva / body length: 57.7 ± 1.4 (54.0-60.3). Males (n=5) were characterized by a body length: 653.5 ± 64.3 (555.3-714.7) µm, a stylet length: 20.9 ± 1.0 (19.7-22.0) µm and a spicule length: 26.1 ± 2.5 (22.3-28.5) µm. Morphological measurements and characteristics (Fig. 1A-F) were compared to previous descriptions of P. leiocauda. As a result, the Korean population was larger than that of the originally described population from France, and was more similar to the Chinese population (Sher, 1970; Azizi et al., 2016; Li et al., 2020). In addition, PCR was performed for the COⅠ, LSU rRNA D2-D3 and ITS region using the primers (Mwesige et al., 2020). The sequenced COⅠ, LSU rRNA D2-D3 segments and ITS region are 447, 776 and 777 bp, respectively. The newly obtained sequences were submitted to GenBank database under accession numbers MZ418130, MZ414163 and MZ418133 of ITS region. A BLASTn search of the LSU rRNA D2-D3 sequence was most similar to P. leiocauda (MN539650), which is the species isolated from tomato in China (Li et al., 2020). The identities of these two sequences were 99.9% (775/776), with no insertions/deletions. The phylogenetic relationships strongly support P. leiocauda (Fig. 1G). Symptoms of perilla associated with P. leiocauda under field conditions included small and curled leaves, chlorosis of leaf edges, dark brown root epidermis and root necrosis (Fig. 2A, B). Koch's postulates were completed by inoculating 100 P. leiocauda into ten 45-cm-in-diameter pots filled with sterilized sandy loam soil and planted with perilla cultivar 'Ipdeulkkae 1-ho'. The potted plants were maintained for 50 days at 25℃ under greenhouse conditions. A P. leiocauda reproduction factor was 1.45 ± 0.20 was observed at the end of the trial, with 106 ± 21.6 recovered from soil and 39 ± 6.7 from root tissue. The root and shoot symptoms in the greenhouse trial were the same as those observed under field conditions (Fig. 2C, D). This, therefore, is the first record of P. leiocauda associated with perilla in Korea and management is warranted.

Estimating body weight and body condition score of mature beef cows using depth images.

Obtaining accurate body weight (BW) is crucial for management decisions yet can be a challenge for cow-calf producers. Fast-evolving technologies such as depth sensing have been identified as low-cost sensors for agricultural applications but have not been widely validated for U.S. beef cattle. This study aimed to (1) estimate the body volume of mature beef cows from depth images, (2) quantify BW and metabolic weight (MBW) from image-projected body volume, and (3) classify body condition scores (BCS) from image-obtained measurements using a machine-learning-based approach. Fifty-eight crossbred cows with a mean BW of 410.0 ± 60.3 kg and were between 4 and 6 yr of age were used for data collection between May and December 2021. A low-cost, commercially available depth sensor was used to collect top-view depth images. Images were processed to obtain cattle biometric measurements, including MBW, body length, average height, maximum body width, dorsal area, and projected body volume. The dataset was partitioned into training and testing datasets using an 80%:20% ratio. Using the training dataset, linear regression models were developed between image-projected body volume and BW measurements. Results were used to test BW predictions for the testing dataset. A machine-learning-based multivariate analysis was performed with 29 algorithms from eight classifiers to classify BCS using multiple inputs conveniently obtained from the cows and the depth images. A feature selection algorithm was performed to rank the relevance of each input to the BCS. Results demonstrated a strong positive correlation between the image-projected cow body volume and the measured BW (r = 0.9166). The regression between the cow body volume and the measured BW had a co-efficient of determination (R2) of 0.83 and a 19.2 ± 13.50 kg mean absolute error (MAE) of prediction. When applying the regression to the testing dataset, an increase in the MAE of the predicted BW (22.7 ± 13.44 kg) but a slightly improved R2 (0.8661) was noted. Among all algorithms, the Bagged Tree model in the Ensemble class had the best performance and was used to classify BCS. Classification results demonstrate the model failed to predict any BCS lower than 4.5, while it accurately classified the BCS with a true prediction rate of 60%, 63.6%, and 50% for BCS between 4.75 and 5, 5.25 and 5.5, and 5.75 and 6, respectively. This study validated using depth imaging to accurately predict BW and classify BCS of U.S. beef cow herds.

Improvements in water clarity and submersed aquatic vegetation cover after exclusion of invasive common carp from a large freshwater coastal wetland, Delta Marsh, Manitoba

Once introduced to shallow aquatic ecosystems common carp (Cyprinus carpio) often degrade habitat, negatively impacting the native organisms that rely on these systems. Detrimental effects often observed following the introduction of carp include a reduction in water clarity as bottom sediments become disturbed and resuspended and phytoplankton blooms become more severe and frequent. This results in a reduction of submersed aquatic vegetation (SAV), the effects of which are felt across multiple trophic levels. We sought to limit large carp (&amp;gt;70 mm maximum body width) access to a culturally and biologically significant 18,500 ha freshwater coastal wetland located in Manitoba, Canada to restore pre-carp conditions which were characterized by clear water and abundant SAV. In winter 2012–2013, exclusion structures were built to limit access by large carp to Delta Marsh during the spring and summer. A monitoring program (2009–2018) compared marsh conditions before and after carp exclusion. Water clarity improved following carp exclusion, largely driven by a reduction of inorganic suspended solids (ISS) rather than phytoplankton biomass, indicating that maintaining clear water conditions might be supplemented by reductions in nutrient export from agricultural areas adjacent to the marsh. The decrease in ISS and phytoplankton varied spatially, with the greatest change observed in the westernmost area of the marsh which is more sheltered compared to the large open bays characterizing eastern areas of the marsh. SAV doubled in percent cover through the 6 years of monitoring post-carp exclusion and SAV cover and species richness in the marsh was comparable to what was present in the early 1970s when there was also partial carp exclusion. Similar to water clarity, the increase in SAV cover was most significant in sheltered areas of the marsh. Our results suggest that excluding large carp can improve water clarity, SAV cover, and SAV species richness in large freshwater wetlands, benefiting waterfowl and other species.

First Report of Southern Root-Knot Nematode (Meloidogyne incognita) on Gynostemma pentaphyllum in China.

Gynostemma pentaphyllum, belonging to Cucurbitaceae, is a herbaceous climbing plant with multiple medicinal values (Li et al., 2019). It has been planted in Pingli County (109.35 E, 32.39 N), Ankang, Shaanxi province, China for a long history with more than 3000 ha per year. In April 2021, typical root-knot nematode disease symptoms, stunting and galled roots with massive egg masses, were observed on local G. pentaphyllum plants in several gardens. Meloidogyne females and egg masses were dissected from the infected roots. The female was spherical in body shape with a project neck; the excretory pore was at level of or posterior to stylet knobs, 10-20 annules behind head; the perineal pattern had a high dorsal arch, sometimes square or trapezoidal in shape, without obvious lateral lines. The male head was not offset with body, head cap was of stepped outline and concaved at center of top end in lateral view; stylet knobs were prominent, usually demarcated from shaft. Morphological measurements of females (n=20) were: body length (L)= 851.78 ± 83.55 µm (700.15 µm to 986.48 µm); maximum body width (W)= 633.11 ± 71.69 µm (453.09 µm to 746.31 µm); stylet length (ST)= 14.81 ± 0.69 µm (13.31 µm to 15.76 µm); stylet knob height (STKH)= 1.54 ± 0.09 µm (1.45 µm to 1.81 µm); stylet knob width (STKW)= 3.61 ± 0.11 µm (3.38 µm to 3.87 µm); and distance from dorsal esophageal gland opening to the stylet (DGO)= 3.56 ± 0.13 µm (3.28 µm to 4.90 µm). Measurements of males (n=20) were: L=1756.96 ± 67.81 µm (1643.58 µm to 1862.14 µm); W=55.37 ± 1.28 µm (53.46 µm to 57.66 µm); ST= 22.75 ± 1.05µm (19.14 µm to 24.88 µm); STKH= 2.59 ± 0.14 µm (2.45 µm to 2.72 µm); STKW= 3.66 ± 0.13 µm (3.27 µm to 3.91 µm); and DGO= 3.52 ± 0.18 µm (3.38 µm to 4.72 µm). Measurements of second-stage juveniles (J2) (n=20) were: L= 418.99 ± 22.04 µm (376.89 µm to 450.66 µm); W= 14.77 ± 1.15 µm (13.03 µm to 17.77 µm); ST= 12.84 ± 0.45µm (12.05 µm to 13.75 µm); STKH= 1.44 ± 0.13 µm (1.14 µm to 1.71 µm); STKW= 2.25 ± 0.23 µm (1.81 µm to 2.76 µm); and DGO= 1.81 ± 0.31 µm (0.38 µm to 2.56 µm). The morphological characteristics of this nematode were consistent with Meloidogyne incognita (Kofoid and White, 1919) Chitwood, 1949 (Williams, 1973; Eisenback and Hirschmann, 1981). Identification was further confirmed with DNA extracted from 20 individual females. Part of the rDNA spanning internal transcribed spacer (ITS) 1, 5.8S gene, and ITS2 was amplified with the pair of primers: rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al., 1992). A 768 bp fragment (GenBank Accession No. MZ613806) was obtained, showing 100% identical (768 bp to 768 bp) to the known sequences of M. incognita (GenBank Accession Nos. MH113856, KC464469, and MT921010). Species identification was also confirmed by amplifying part of the NADH dehydrogenase subunit 5 (nad5) from mitochondrial DNA with primers: NAD5-F/R (TATTTTTTGTTTGAGATATATTAG/CGTGAATCTTGATTTTCCATTTTT) (Janssen et al., 2016). The resulting 611 bp fragment was deposited in GenBank with Accession No. MZ613807. The fragment showed a highest identity of 99.67% (601 bp out of 611 bp) with sequences from other M. incognita isolates (GenBank Accession Nos. MW759707, MW759706, MW759705). Based on both morphological and molecular data, the root-knot nematode from G. pentaphyllum was identified as M. incognita. A pathogenicity test was carried out by inoculating 1500 J2 hatched from the egg masses dissected from the diseased roots to a 4-weeks-old healthy G. pentaphyllum seedling cultured in sterilized sandy soil in pot, 15 plants were inoculated and 5 non-inoculated plants served as controls. After maintained at 25°C for 6 weeks, all of the inoculated plant roots showed galling symptoms which were similar to those observed in the field. Nematodes were collected from root and soil, and an average reproduction factor value of 3.51 was obtained. While no galls were observed on the control plants. For further confirmation, all egg masses dissected from inoculated plants were identified to be M. incognita with its sequence specific primers Mi-F/Mi-R (GGGCAAGTAAGGATGCTCTGAC/CTTTCATAGCCACGTCGCGATC) (Ray et al., 1994). In this study, G. pentaphyllum has been identified as a new host of M. incognita, hence the occurrence status and control of root-knot disease on G. pentaphyllum caused by this pathogen would be new problems in production and need further study.

First record of Aphelenchoides besseyi on foxtail millet (Setaria italica) in Henan Province of China.

Aphelenchoides besseyi is one of the important plant-parasitic nematodes on rice, reducing approximate 10-20% of the rice yield annually (Jones et al. 2013). Foxtail millet (Setaria italica) has been a major cereal crop in Northern China, especially in the semi-arid areas of this region, for thousands of years. In August of 2019 and 2020, a survey of nematodes on autumn grain crops was performed each year. One foxtail millet field (N34° 58' 027″ and E113° 39' 059″) in Yuanyang County of Henan Province caught our attention. Some upper leaves showed chlorosis without or with necrotic tips, and flag leaves presented crinkling and distortion, stalks were colored, earheads were vertical, glumes were brown or light black and open, and grains became thin. A total of ten samples were collected, and the nematodes were isolated from the spike pieces by shallow plate method and counted under a stereomicroscope. The average number of nematodes per earhead of foxtail millet counted up to 1738.75 ± 107.72. Morphologically, females were slender with a short stylet, an oval metacorpus with a distinct valve, a labial region slightly wider than the first body annulus and a conoid tail with a terminus bearing a star-shaped mucro with four pointed processes. The females were characterized as follows (mean ± SD; n=20): body length (L) = 668.92 ± 12.73 µm (647.38 to 689.70 µm); maximum body width (W) = 14.35 ± 1.11 µm (12.12 to 16.88 µm); L/W = 46.83 ± 2.94 (40.44 to 50.03); tail length = 38.93 ± 3.48 µm (33.41 to 45.92 µm); L/tail length = 17.31 ± 1.44 (14.47 to 19.62); and stylet length (ST) = 11.57 ± 0.57 µm (10.77 to 12.34 µm). The males had three pairs of ventrosubmedian papillae with the first one adanal, spicula curved with a slight basal process, terminus bearing four mucrones arranged variably, and the whole worm was in 'J' shape. The males could be described as follows (mean ± SD, n = 20): L = 606.66 ± 10.70 µm (586.49 to 626.37 µm); W = 13.95 ± 0.60 µm (12.71 to 14.94 µm); L/W = 43.55 ± 1.69 (40.73 to 46.43); tail length = 35.54 ± 1.93 µm (31.41 to 38.18 µm); L/tail length = 17.07 ± 0.79 (16.05 to 18.67); ST = 11.53 ± 0.56 µm (1061 to 12.76 µm). All the key morphometrics were consistent with those of A. besseyi reported from Brazil (Favoreto et al. 2018) and China (Lin et al. 2004; Ou et al. 2014). The amplifications of rDNA internal transcribed spacer (ITS) fragments generated a PCR fragment of 830 bp from a single nematode, using the primers set TW81 (5'-GTTTCCGTAGGTGAACCTGC-3') and AB28 (5'-ATATGCTTAAGTTCAGCGGGT-3') (Joyce et al. 1994). Five independent PCR experiments were conducted, and all the PCR products were purified and sequenced. Nucleotide sequence of ITS-rDNA was deposited in GenBank with Accession Number OK090549.1. The obtained ITS region sequence was more than 99% identical to those of A. besseyi reported from China (MW216945.1) and India (JF826518.1, JF826519.1 and JF826517.1). These ITS sequence results further supported that the isolated nematodes were A. besseyi. Subsequently, the species-specific primers of A. besseyi (BSF, 5'-TCGATGAAGAACGCAGTGAATT-3' and BSR, 5'-AGATCAAAAGCCAATCGAATCAT-3') were used for confirmation by PCR (Cui et al. 2010). An expected PCR fragment of 312 bp was obtained, which was consistent with those of A. besseyi reported previously. The pathogenicity of identified A. besseyi was confirmed by infection of foxtail millet (Setaria italica cv. 'Yugu33'). Foxtail millet budding seeds were sown in the pots contained 150 mL of sterile soil mixture. In two weeks, 10 seedlings were inoculated with 100 A. besseyi each, and 4 plants were non-inoculated as the control. The foxtail millet seedlings were grown in a plant-growth chamber at 25/30°C under 12 h dark/12 h light. On the average, 73.3 and 138.2 of A. besseyi were isolated from each plant at 15 and 40 days post inoculation, respectively. Both the morphological and molecular characteristics were identical with those nematodes obtained from the original samples. All the upper leaves of the inoculated plants showed chlorosis and necrosis, symptoms that were similar to those observed in the field, and neither symptom developed on the non-inoculated control plants, nor were nematodes re-isolated from the control plants. To the best of our knowledge, this is the first record of A. besseyi on foxtail millet in Henan Province of North China. Henan is one of the most important grain-producing areas in China, and A. besseyi is an important domestic quarantine nematode, which may become a severe threat to cereal production in Henan Province. Our findings will be very beneficial for A. besseyi management and further research on foxtail millet in Henan Province of North China.

First Report of the Apple Root-Knot Nematode, Meloidogyne mali, on Maple Trees in the Republic of Korea.

Meloidogyne mali was originally described in Japan on roots of an apple rootstock (Malus prunifolia) (Itoh et al. 1969) and found on elm trees in Italy, Netherlands, Belgium, France and United Kingdom, and euonymus in the USA (EPPO 2018; Prior et al. 2019). In Italy, the nematode was initially described as a new species, Meloidogyne ulmi, but was later synonymized with M. mali (Ahmad et al., 2013). During the study of Meloidogyne species in Republic of Korea, galled roots were found on Acer palmatum collected in Naejangsan National Park, Republic of Korea located at 35°29'29.1"N, 126°55'42.7"E, altitude 147.8 m. Morphologically, the perineal patterns of the females was very similar to M. mali due to rounded dorsal arch and smooth, finely-spaced, indistinct striae. Lateral field shallow, narrow, and faint. Phasmids large, very distinct. Head region of second-stage juveniles flattened anteriorly to hemispherical, slightly set-off from body, without annulations, low head cap. Stylet slender, sharply pointed cone, cylindrical shaft with rounded knob sloping posteriorly. Tail conoid with irregular, and rounded end. Rectum undilated. Several micrographs were made from 25 J2s and females for mean, standard deviation and range. J2s were measured with a body length: 408.2 ± 25.1 (366-449) µm, maximum body width: 15.9 ± 1.0 (14.1-17.9) µm, stylet length: 14.1 ± 0.5 (13.1-15.3) µm, hyaline tail terminus: 10.0 ± 0.9 (8.3-11.0) µm and tail length: 31.7 ± 3.0 (26.0-36.1) µm. Females (n=25) were characterized by a body length: 656.7 ± 102.7 (516-947) µm, a stylet length: 16.4 ± 2.2 (13.9-19.0) µm, a vulval slit length: 22.2 ± 1.8 (19.8-25.7) µm, and a vulva-anal distance: 20.2 ± 2.4 (17.1-25.4) µm. Morphological measurements and configuration of perineal patterns (Fig. 1S) were comparable to M. mali (Itoh et al. 1969; Ahmed et al. 2013; Gu et al. 2020). To confirm pathogenicity, a modified version of Koch's postulates was conducted in the greenhouse by inoculating 300 eggs from a single egg mass onto each of three, two-year-old A. palmatum plants, grown in sterilized sandy soil. After about one year, symptoms developed on the maple tree roots, with numerous galls containing females and egg masses by visual inspection. In addition, PCR was performed for the 28S rDNA D2-D3 segment and ITS region using the primers D2A, D3B, TW81 and AB28. The resulting sequences (MW522548, MW522549, MW523004 and MW523005) were at least 99% identical to other 28S rDNA D2-D3 segment and ITS region sequences on Genbank (MT406757 and JX978229). The molecular phylogenetic relationships of this species strongly supports M. mali (Fig. 2S). To the best of our knowledge, this is the first report of M. mali in Republic of Korea. The host range of M. mali includes many species which are of economic importance in fruit trees (e.g. apple, chestnut, fig, mulberry), forestry trees (e.g. elm, maple, oak, Yew), and vegetable crops (e.g. cabbage, carrot, cucumber, eggplant, soybean, watermelon). The potential danger to these economically important plants caused M. mali to be added the EPPO Alert List and also the Quarantine List of the Korean Animal and Plant Quarantine Agency. Additionally, in our survey around the Naejangsan National Park, M. mali was not found on other economically important host crops, such as grapes. Although this nematode was not detected other crops, it requires regular monitoring because it poses a serious threat to the future production of these crops.

First Report of the Root-Knot Nematode Meloidogyne enterolobii on Sweet Potato in Guangxi Province, China.

Sweet potato (Ipomoea batatas Lam.) is the seventh most widely cultivated food crop in the world and the sixth most widely cultivated food crop in China. In June 2021, sweet potato plants were found to be displaying nutrient deficiencies with red leaves in a sweet potato field in Hepu County, Beihai City, Guangxi Province (21°37′43.41"N，109°10′58.74"E). Black irregular protuberant scars on tubers and nodular galls on roots were found. Thirty-five sweet potato ‘Variety Guiziweishu No. 1’ tubers were randomly collected and 97% were infected with root-knot nematodes. Females (n = 20) had perineal patterns that were oval, with moderate to high dorsal arches, the lateral field was not obvious or absent. Morphological measurement of females (n = 20) were made from micrographs taken with a microscope (Axio Imager, Z2, ZEISS). Measurements (mean + standard error) were: body length (BL) = 932.8 ± 18.4 μm; maximum body width (BW) = 588.8 ± 22.0 μm; vulval slit length = 19.6 ± 0.6 μm; and, vulval slit to anus distance = 22.3±0.8 μm. Morphological measurements of second-stage juveniles (J2; n = 20) were: BL =512.0± 5.9 μm; BW = 17.4 ± 0.6 μm; Stylet length = 13.4 ± 0.2 μm; dorsal pharyngeal gland orifice to stylet base (DGO) =3.4 ± 0.0 μm; and, hyaline tail length = 17.6 ± 0.5 μm. These morphological characteristics fit those of the original description for Meloidogyne enterolobii (Yang and Eisenback 1983). Molecular analyses were conducted to confirm species identification. Genomic DNA was extracted from 12 single J2 (Luo et al. 2020). The rDNA-internal transcribed spacer (ITS) region was sequenced using primers V5367/26S (5′-TTGATTACGTCCCTGCCCTTT-3′/5′-TTTCACTCGCCGTTACTAAGG-3′) (Vrain et al. 1992), and the D2–D3 fragment of the 28S rRNA genes using primers D2A/D3B (5′-GTACCGTGAGGGAAAGTTG-3′/5′-TCGGAAGGAACCAGCTACTA-3′) (De Ley et al. 1999). The target gene sequences were 733 bp (GenBank accession no. MZ413814) and 733 bp (MZ411468), respectively; they were all 99-100% similar to those of M. enterolobii sequences available in the GenBank. Species identification was also confirmed using PCR to amplify rDNA-IGS2 with M. enterolobii-specific primers Me-F/Me-R (5′-AACTTTTGTGAAAGTGCCGCTG-3′/5′-TCAGTTCAGGCAGGATCAACC-3′). The electrophoresis results showed a bright band (∼200 bp) only in the lane with the M. enterolobii-specific primers, similar in size to that previously reported for M. enterolobii (Long et al. 2006). Therefore, this Meloidogyne sp. population on sweet potato was identified as M. enterolobii based on its morphological and molecular characteristics. To verify the pathogenicity of nematodes, sweet potato ‘Variety Guiziweishu No. 1’ seedlings were individually planted in 18 cm diameter, 11 cm deep plastic pots containing 1000 cm3 autoclaved sandy soil (sand/soil = 3:1). A total of 15 seedlings were inoculated with 10,000 eggs (the population was same with nematode population in soil the field) and 5 seedlings without eggs were used as a control. Plants were maintained at 25-28°C in a greenhouse. After 2 months, root of inoculated plants exhibited elongated swellings similar to symptoms observed in the field. The noninoculated plants did not have any galls or swelling. A reproduction factor (nematode final population density/initial population density) value of 18.6 was obtained. These results confirmed the nematodes’ pathogenicity. To our knowledge, this is the first report of M. enterolobii on a member of the Convolvulaceae in Guangxi Province. In 2014, the nematode on sweet potato was reported in Guangdong Province (Gao et al. 2014). Guangxi Province is the largest producer of sweet potato in south China and is the third top producing region in the whole country. Meloidogyne enterolobii is a potential risk to the production of sweet potato in this region, and control measures are needed to prevent any further spread.