Marrow Progenitor Cells Research Articles

Disruption of hematopoiesis attenuates the osteogenic differentiation capacity of bone marrow stromal cells

BackgroundThe homeostasis of mesenchymal stem cells (MSCs) is modulated by both their own intracellular molecules and extracellular milieu signals. Hematopoiesis in the bone marrow is maintained by niche cells, including MSCs, and it is indispensable for life. The role of MSCs in maintaining hematopoietic homeostasis has been fully elucidated. However, little is known about the mechanism by which hematopoietic cells reciprocally regulate niche cells. The present study aimed to explore the close relationship between MSCs and hematopoietic cells, which may be exploited for the development of new therapeutic strategies for related diseases.MethodsIn this study, we isolated cells from the offspring of Tie2Cre + and Ptenflox/flox mice. After cell isolation and culture, we investigated the effect of hematopoietic cells on MSCs using various methods, including flow cytometry, adipogenic and osteogenic differentiation analyses, quantitative PCR, western bloting, and microCT analysis.ResultsOur results showed that when the phosphatase and tensin homolog deleted on chromosome 10 (Pten) gene was half-deleted in hematopoietic cells, hematopoiesis and osteogenesis were normal in young mice; the frequency of erythroid progenitor cells in the bone marrow gradually decreased and osteogenesis in the femoral epiphysis weakened as the mice grew. The heterozygous loss of Pten in hematopoietic cells leads to the attenuation of osteogenic differentiation and enhanced adipogenic differentiation of MSCs in vitro. Co-culture with normal hematopoietic cells rescued the abnormal differentiation of MSCs, and in contrast, MSCs co-cultured with heterozygous null Pten hematopoietic cells showed abnormal differentiation activity. Co-culture with erythroid progenitor cells also revealed them to play an important role in MSC differentiation.ConclusionOur data suggest that hematopoietic cells function as niche cells of MSCs to balance the differentiation activity of MSCs and may ultimately affect bone development.

High Prevalence of Anemia among Human Immunodeficiency Virus-Infected Patients: A Cross-sectional Study in Bali-Indonesia

Anemia is a common condition found among Human Immunodeficiency Virus (HIV)-infected patients. T-cells that are infected with HIV virus can directly suppress the growth of progenitor cells in the bone marrow so that affecting the hemopoiesis resulted in anemia. These hematological abnormalities could potentially cause serious clinical implications. This study was conducted to determine the prevalence of anemia in HIV-infected patients in Bali. It was ahospital based cross-sectional studyconducted at two public hospital in Bali-Indonesia. A total of 243 medical record data from HIV-infected patients atWangaya Hospital Denpasar Bali and Sanjiwani Hospital Gianyar Bali between 2009 -2017 were included in analysis. Prevalence of anemia in antiretroviral (ART)-naïve patients and in patients on ART were 60.8% and 40.3%, respectively. Leucopenia and thrombocytopenia were found 8.2% and 9.4%, respectively, in ART-naïve group. While in patients with ART group leucopenia and thrombocytopenia were accounted for 6.9% and 4.3%, respectively. There was a significant difference in prevalence of anemia between ART-naïve patients and patients on ART (60.8% vs. 40.3%; p < 0.05). Although the prevalence of anemia was lower in patients on ART, but anemia continues to be common in a substantial portion of HIV-infected persons. Another studies are still needed to addressing the impact of anemia on HIV-infected individuals, as well as treatment strategies and future research directions.

The effects of bone marrow stem and progenitor cell seeding on urinary bladder tissue regeneration

Complications associated with urinary bladder augmentation provide the motivation to delineate alternative bladder tissue regenerative engineering strategies. We describe the results of varying the proportion of bone marrow (BM) mesenchymal stem cells (MSCs) to CD34 + hematopoietic stem/progenitor cells (HSPCs) co-seeded onto synthetic POC [poly(1,8 octamethylene citrate)] or small intestinal submucosa (SIS) scaffolds and their contribution to bladder tissue regeneration. Human BM MSCs and CD34 + HSPCs were co-seeded onto POC or SIS scaffolds at cell ratios of 50 K CD34 + HSPCs/15 K MSCs (CD34-50/MSC15); 50 K CD34 + HSPCs/30 K MSCs (CD34-50/MSC30); 100 K CD34 + HSPCs/15 K MSCs (CD34-100/MSC15); and 100 K CD34 + HSPCs/30 K MSCs (CD34-100/MSC30), in male (M/POC; M/SIS; n = 6/cell seeded scaffold) and female (F/POC; F/SIS; n = 6/cell seeded scaffold) nude rats (n = 96 total animals). Explanted scaffold/composite augmented bladder tissue underwent quantitative morphometrics following histological staining taking into account the presence (S+) or absence (S−) of bladder stones. Urodynamic studies were also performed. Regarding regenerated tissue vascularization, an upward shift was detected for some higher seeded density groups including the CD34-100/MSC30 groups [F/POC S− CD34-100/MSC30 230.5 ± 12.4; F/POC S+ CD34-100/MSC30 245.6 ± 23.4; F/SIS S+ CD34-100/MSC30 278.1; F/SIS S− CD34-100/MSC30 187.4 ± 8.1; (vessels/mm2)]. Similarly, a potential trend toward increased levels of percent muscle (≥ 45% muscle) with higher seeding densities was observed for F/POC S− [CD34-50/MSC30 48.8 ± 2.2; CD34-100/MSC15 53.9 ± 2.8; CD34-100/MSC30 50.7 ± 1.7] and for F/SIS S− [CD34-100/MSC15 47.1 ± 1.6; CD34-100/MSC30 51.2 ± 2.3]. As a potential trend, higher MSC/CD34 + HSPCs cell seeding densities generally tended to increase levels of tissue vascularization and aided with bladder muscle growth. Data suggest that increasing cell seeding density has the potential to enhance bladder tissue regeneration in our model.

Central Nervous System Infiltration in Acute Lymphoblastic Leukemia in a Dog

Background: Acute lymphoblastic leukemia (ALL) is a malignant neoplasia in which there is proliferation of lymphoid progenitor cells in the bone marrow, blood, and extramedullary sites. This disorder has a fast and progressive development; in dogs, cases of infiltration of ALL cells in the central nervous system (CNS) are uncommon and rare. Diagnosis can be achieved with the help of the clinical history and physical, radiographic, hematological, myelographic, and cerebrospinal fluid (CSF) tests in patients with or without neurological clinical signs. The present report aims to describe a case of ALL and the presence of lymphoblasts in the CSF of a dog with neurological clinical signs.Case: An 8-year-old Lhasa Apso dog was examined at the Veterinary Hospital of Universidade Federal do Paraná, Curitiba campus. At the physical examination, the animal exhibited apathy and paralysis of pelvic limbs, which progressed to tetraplegia. Abdominal palpation revealed presence of hepatosplenomegaly and absence of lymphadenomegaly. No alterations were observed in radiographs of the cervical, thoracic or lumbar spine. A complete blood count revealed presence of non-regenerative anemia (hematocrit = 22%), extreme lymphocytosis (185,229 cells/µL), lymphoblasts at a level of 72% (133,364 cells/µL), and thrombocytopenia (66,000 platelets/µL). The biochemical tests revealed increased alkaline phosphatase (859 IU/L). The levels of alanine aminotransferase, creatinine, urea, total protein, albumin, and globulin were normal. The diagnosis of ALL was achieved with the help of a myelogram. The myelogram findings included 39% of mature lymphocytes and 59% of lymphoblasts exhibiting large size, spherical shape, poorly delimited borders, with a high nucleus/cytoplasm ratio, marked cytoplasmic basophilia, and 2 to 3 evident nucleoli; metarubricytes (1%) and promyelocytes (0.6%) were also observed. The CSF contained an increased number of nucleated cells (27 cells/µL) comprising lymphocytes (43%), macrophages (33%), and segmented neutrophils (24%). Of the 11.6 lymphocytes per µL of CSF, 8.1 were lymphoblasts, which indicates infiltration of ALL cells in the CNS. The animal died one day after collection of bone barrow and CSF. Discussion: Relevant alterations observed in this case included the neurological signs caused by the infiltration of neoplastic cells in the CNS, severe leukocytosis and lymphocytosis, with large amounts of lymphoblasts in the blood and predominance of lymphoblasts in the bone marrow, which are alterations typically found in ALL. The animal also exhibited non-regenerative anemia and thrombocytopenia, which were secondary to infiltration of leukemic cells in the bone marrow. The CSF exhibited pleocytosis (27 cells/ µL), and 30% of the cells observed were lymphoblasts. Lymphoblast infiltration in the CNS of leukemic dogs is rare, and other studies have reported absence of neurological signs or neurological signs different from those observed in the present study. CSF analysis in indicated in cases of leukemia to assess leukemic cell infiltration in the CNS. In the case reported here, the plasma level of alkaline phosphatase was increased (859 IU/L) as a consequence of hepatomegaly and hepatic cholestasis. ALL is a very aggressive, proliferative neoplasia, and the resulting lymphoblasts infiltrated the CNS of the animal. In cases of ALL, performing complete blood count, myelogram, and CSF analysis is indicated whether the patients exhibit neurological signs or not.

Genetically determined hypercholesterolaemia results into premature leucocyte telomere length shortening and reduced haematopoietic precursors

Leucocyte telomere length (LTL) shortening is a marker of cellular senescence and associates with increased risk of cardiovascular disease (CVD). A number of cardiovascular risk factors affect LTL, but the correlation between elevated LDL cholesterol (LDL-C) and shorter LTL is debated: in small cohorts including subjects with a clinical diagnosis of familial hypercholesterolaemia (FH). We assessed the relationship between LDL-C and LTL in subjects with genetic familial hypercholesterolaemia (HeFH) compared to those with clinically diagnosed, but not genetically confirmed FH (CD-FH), and normocholesterolaemic subjects. LTL was measured in mononuclear cells-derived genomic DNA from 206 hypercholesterolaemic subjects (135 HeFH and 71 CD-FH) and 272 controls. HeFH presented shorter LTL vs. controls (1.27 ± 0.07 vs. 1.59 ± 0.04, P = 0.045). In particular, we found shorter LTL in young HeFH as compared to young controls (<35 y) (1.34 ± 0.08 vs. 1.64 ± 0.08, P = 0.019); moreover, LTL was shorter in statin-naïve HeFH subjects as compared to controls (1.23 ± 0.08 vs. 1.58 ± 0.04, P = 0.001). HeFH subjects presented shorter LTL compared to LDL-C matched CD-FH (1.33 ± 0.05 vs. 1.55 ± 0.08, P = 0.029). Shorter LTL was confirmed in leucocytes of LDLR-KO vs. wild-type mice and associated with lower abundance of long-term haematopoietic stem and progenitor cells (LT-HSPCs) in the bone marrow. Accordingly, HeFH subjects presented lower circulating haematopoietic precursors (CD34 + CD45dim cells) vs. CD-FH and controls. We found (i) shorter LTL in genetically determined hypercholesterolaemia, (ii) lower circulating haematopoietic precursors in HeFH subjects, and reduced bone marrow resident LT-HSPCs in LDLR-KO mice. We support early cellular senescence and haematopoietic alterations in subjects with FH.

Abstract 16007: Myeloid-specific Deletion in Lipid Phosphate Phosphatase3 (plpp3) Increases Cardiac Inflammation

Introduction and Hypothesis: Acute myocardial infarction (AMI) is the leading cause of morbidity and mortality worldwide. The innate immune response plays a major role in cardiac remodeling after AMI. Lysophosphatidic acid (LPA), produced by autotaxin (ATX) and degraded by Lipid phosphate phosphatase 3 (LPP3), regulates monocytosis and promotes inflammation. However, the role of LPP3 in post-AMI inflammation is not understood. Here, we investigated the possible role of Myeloid-specific Plpp3 KO mice in cardiac and systemic inflammation and resulting in adverse cardiac remodeling post-MI. Methods and Results: To generate mice with Myeloid-specific Plpp3 deletion , female Plpp3 fl/fl mice were crossed to male Plpp3 mice expressing Cre recombinase under the control of the LysM promoter to generate lysm-plpp3. mice. These mice and their littermate control underwent MI or sham surgery. Inflammatory cell content was assessed using flow cytometry and immunohistochemistry. Cardiac function and scar size were assessed by echocardiography and Mason Trichrome staining, respectively. Increased number of Ly6C hi monocytes (CD45 + /Ly6C/G hi /CD115 hi ) and pro-inflammatory macrophages (CD45 + /F4-80 + /CD11b + ) (CD45 + /F4-80 + /CD86 + ), in cardiac tissue of Cre+LysM mice was observed compared to Cre-fl/fl littermate controls during peak post-MI inflammation, as assessed by flow cytometry ( Fig.1A-C ). This increase in inflammatory cells and inflammation may be the consequence of the significant increase in bone marrow and spleen progenitor cell count and proliferation. Moreover, Cre+LysM mice cardiac functional recovery was also reduced significantly ( Fig. 1D-F ) as assessed by echocardiography. Conclusion: Myeloid-specific Plpp3 deletion increases the deleterious effects of inflammation on the ischemic myocardium and ATX/ LPA signaling could represent a novel therapeutic target for future clinical studies of coronary heart diseases.

Abstract A68: A casein kinase 2 inhibitor disorders myeloid cell differentiation by blocking CCAAT/enhancer-binding protein-alpha signaling pathway in tumor microenvironment

Abstract Myeloid cells are major components of the tumor microenvironment, which are known to suppress antitumor immunity. Casein kinase 2 (CK2), a serine/threonine protein kinase with diverse intracellular protein substrates, regulates several signaling pathways involved in tumor progression and cell differentiation. We examined the efficacy of a novel CK2 inhibitor on modulating the myeloid cells in the tumor microenvironment. Although CK2 inhibitors BMS-595 and BMS-211 moderately inhibited the tumor growth in LLC, 4T1, MC38 and CT26 tumor-bearing mice, these inhibitors drastically enhanced the antitumor efficacy of anti-CTLA4 antibody with 60% to 90% of complete rejection. Polymorphonuclear myeloid-derived suppressor cells (PMN-MDSC) and macrophages in spleens, and tumor-associated macrophages (TAM) were found to be decreased in LLC tumor-bearing mice treated with BMS-595 for 2 weeks. Murine hematopoietic progenitor cells (HPC) from bone marrow and human progenitor cells from cord blood were cultured with BMS-595 to evaluate the differentiation. BMS-595 treatment dramatically decreased the proportion of granulocytic cells, and this decrease was not caused by the direct killing nor apoptosis. Therefore, the genes regulated by transcription factors, IRF8, C/EBPα and C/EBPβ, which are involved in PMN-MDSC differentiation, were evaluated. Many genes controlled by C/EBPα were downregulated by the BMS-595 treatment in HPCs. Active p42 subunit of C/EBPα was revealed to be reduced by the BMS-595 treatment in HPCs, which are inversely correlated with the increased level of dominant negative p30 subunit of C/EBPα, in both the cytoplasm and nucleus of HPCs. Our results suggest that CK2 inhibition leads to a reduction of immune-suppressive PMN-MDSC and TAM by inhibiting C/EBPα activity, resulting in an enormous augmentation of antitumor efficacy of immunotherapy. Citation Format: Ayumi Hashimoto, Chan Gao, Jerome Mastio, Andrew Kossenkov, Scott I. Abrams, Ashok V. Purandare, Heshani Desilva, Susan Wee, John Hunt, Maria Jure-Kunkel, Dmitry I. Gabrilovich. A casein kinase 2 inhibitor disorders myeloid cell differentiation by blocking CCAAT/enhancer-binding protein-alpha signaling pathway in tumor microenvironment [abstract]. In: Proceedings of the AACR Special Conference on Tumor Immunology and Immunotherapy; 2018 Nov 27-30; Miami Beach, FL. Philadelphia (PA): AACR; Cancer Immunol Res 2020;8(4 Suppl):Abstract nr A68.

Trabecular Bone Deficit and Enhanced Anabolic Response to Re-Ambulation after Disuse in Perlecan-Deficient Skeleton.

Perlecan/Hspg2, a large monomeric heparan sulfate proteoglycan, is found in the basement membrane and extracellular matrix, where it acts as a matrix scaffold, growth factor depot, and tissue barrier. Perlecan deficiency leads to skeletal dysplasia in Schwartz-Jampel Syndrome (SJS) and is a risk factor for osteoporosis. In the SJS-mimicking murine model (Hypo), inferior cortical bone quality and impaired mechanotransduction in osteocytes were reported. This study focused on trabecular bone, where perlecan deficiency was hypothesized to result in structural deficit and altered response to disuse and re-loading. We compared the Hypo versus WT trabecular bone in both axial and appendicular skeletons of 8-38-week-old male mice, and observed severe trabecular deficit in Hypo mice, approximately 50% reduction of Tb.BV/TV regardless of skeletal site and animal age. Defects in endochondral ossification (e.g., accelerated mineralization), increases in osteoclast activity, and altered differentiation of bone progenitor cells in marrow contributed to the Hypo phenotype. The Hypo trabecular bone deteriorated further under three-week hindlimb suspension as did the WT. Re-ambulation partially recovered the lost trabecular bone in Hypo, but not in WT mice. The novel finding that low-impact loading could counter detrimental disuse effects in the perlecan-deficient skeleton suggests a strategy to maintain skeletal health in SJS patients.

Modeling NOTCH1 driven T-cell Acute Lymphoblastic Leukemia in Mice.

T-cell acute lymphoblastic leukemia (T-ALL) is an aggressive hematological malignancy that arises from transformation of T-cell primed hematopoietic progenitors. Although T-ALL is a heterogenous and molecularly complex disease, more than 65% of T-ALL patients carry activating mutations in the NOTCH1 gene. The majority of T-ALL-associated NOTCH1 mutations either disrupt the negative regulatory region, allowing signal activation in the absence of ligand binding, or result in truncation of the C-terminal PEST domain involved in the termination of NOTCH1 signaling by proteasomal degradation. To date, retroviral transduction models have relied heavily on the overexpression of aggressively truncated variants of NOTCH1 (such as ICN1 or ΔE-NOTCH1), which result in supraphysiological levels of signaling activity and are rarely found in human T-ALL. The current protocol describes the method for mouse bone marrow isolation, hematopoietic stem and progenitor cell (HSC) enrichment, followed by retroviral transduction with an oncogenic mutant form of the NOTCH1 receptor (NOTCH1-L1601P-ΔP) that closely resembles the gain-of-function mutations most commonly found in patient samples. A hallmark of this forced expression of constitutively active NOTCH1 is a transient wave of extrathymic immature T-cell development, which precedes oncogenic transformation to T-ALL. Furthermore, this approach models leukemic transformation and progression in vivo by allowing for crosstalk between leukemia cells and the microenvironment, an aspect unaccounted for in cell-line based in vitro studies. Thus, the HSC transduction and transplantation model more faithfully recapitulates development of the human disease, providing a highly comprehensive and versatile tool for further in vivo and ex vivo functional studies.

Using Circ-ANAPC7 As a Novel Type of Biomarker in the Monitoring of Acute Myeloid Leukemia

Introduction: Acute myeloid leukemia (AML) is a heterogeneous disease characterized by the clonal proliferation of immature myeloid progenitor cells in the bone marrow, compressing normal blood cell production and leading to bone marrow failure ultimately. Overwhelming evidence has established that non-coding RNAs (ncRNAs), such as long non-coding RNAs (lncRNAs) and circular RNAs (circRNAs) have great role in AML pathogenesis. Circular RNAs (circRNAs) that occupy gene expression at the transcriptional or post-transcriptional level have great potential to be biomarker for types of cancers. We have screened one altered circRNA named circ-ANAPC7 in AML before. In this study, we aimed to validate its expression by enlarging sample size and illuminating the diagnostic and monitoring value of circ-ANAPC7 in AML. Methods: Real-time quantitative reverse transcription-polymerase chain reaction (qRT-PCR) was supposed to confirm the expression of circ-ANAPC7 of AML patients. The sequences of circ-ANAPC7 primers were as follows: 5′- GGGAGCAGCACTTAGGAACAT -3′ (sense) and 5′-AAAGCTGGTACTTCTGAGGTGG-3′ (antisense). Receiver operating characteristic (ROC) curve was carried out to evaluate the diagnostic value. Overall survival rate and event-free survival rate were estimated by the Kplan-Meier analysis and compared using the log-rank test. All tests were two-sided, and P &lt; 0.05 was defined as a significant difference. Results: The expression level of circ-ANAPC7 in newly diagnosed AML was significantly higher than CR patients and iron deficiency anemia (IDA) control group (P &lt; 0.001) (Figure 1A). Furthermore, we chose 24 AML patients who undergo the condition of newly diagnosed AML, CR and relapse to dynamical monitor the expression of circ-ANAPC7. We discovered that circ-ANAPC7 expression level changed accompanied with the disease condition transformation. It was high expressed in newly diagnosed and relapsed AML patients. When patients got CR, the expression level of circ-ANAPC7 decreased (P &lt; 0.05). In the continuous CR patients, it remained in a minimal level (Figure 1C). ROC curve analysis revealed that circ-ANAPC7 has significant value of AML diagnosis (AUC = 0.915, P &lt; 0.001) (Figure 1B). Moreover, we conducted survival analysis to explore long-term effect of circ-ANAPC7 expression in AML patients. The result revealed that circ-ANAPC7 expression was not related to overall survival (OS) and disease-free survival (DFS) of AML patients (P &gt; 0.05) (Figure 1D). Conclusions: We validated that circ-ANAPC7 was upregulated in AML patients. The clinical analysis revealed that circ-ANAPC7 may be a predictive index for diagnosing and supervising early recurrence of AML. What's more, additional molecular mechanisms and biological functions of circ-ANAPC7 merit deeper investigation. Figure 1 Disclosures No relevant conflicts of interest to declare.

Chromatin Remodeling Subunit Brm Regulates Hematopoietic Stem Cell Self-Renewal By Limiting Intracellular Valine Levels

Chromatin remodeling complexes facilitate gene expression and control cell fate decisions. The ATPase subunit of chromatin remodeling complex BRG1 is essential for stem cell function, but the role of its paralog Brm remains essentially unknown. To assess a role(s) for Brm in hematopoietic cell regulation in vivo, we studied hematopoietic stem (HSCs) and progenitor cells (HPCs) in bone marrow (BM) of Brm -/- vs. wildtype (WT) control mice. While BM from Brm -/- mice contain increased numbers of rigorously-defined phenotypic populations of long- and short-term repopulating HSCs and granulocyte macrophage progenitors (GMPs) and increased numbers and cycling status of functional HPC (assessed by CFU-GM, BFU-E, and CFU-GEMM colony assays), they were defective in self-renewal capacity upon in vivo serial transplantation using congenic mice (CD45.2+ donor cells, CD45.1+ competitor cells, and F1 (CD45.2+/CD45.1+) recipient mice). Increased numbers of HSCs from Brm-/- BM failed to show competitive advantage over wild type (WT) control BM cells in primary (1°) transplantation in lethally irradiated mice (based on month 4 donor cell chimerism and phenotypically defined HSC numbers). Moreover, 2° and 3° engraftment at 4 months post transplantation each, a measure of HSC self-renewal capacity, revealed much reduced engraftment of donor Brm -/- BM cell chimerism and HSC numbers compared to the extensive 2° and 3° engraftment of control WT BM. No significant differences in myeloid/lymphoid ratios were noted in 1° or 2° engrafted mice, suggesting no differentiation lineage bias of donor Brm -/- BM cells. This demonstrates a critical role for Brm in controlling in vivo self-renewal of mouse BM HSCs. Valine [(2S)-2 amino-3 methylbutanoic acid (C5H11N02)] is implicated in hematopoietic regulation, since depleting dietary valine permitted non-myeloablative mouse HSC transplantation (Taya et. al. Science 354:1152-1155, 2016). Metabolic analysis of lineage negative (lin-) cells demonstrated that valine, but not leucine, levels were very highly elevated in Brm -/- BM cells, thus linking intracellular valine levels with Brm expression. Exogenously added valine significantly increased basal oxygen consumption rates of both total WT BM and WT lin- cells, but not of total or lin-Brm -/- BM cells in vitro (via Seahorse machine analysis). To study effects of valine on HPCs, we assessed the addition of exogenously added valine on mouse BM and human cord blood (CB) cells cultured in the presence of cytokines with either non-dialyzed or dialyzed fetal bovine serum (FBS). Valine, but not leucine, dose-dependently enhanced HPC (CFU-GM, BFU-E, and CFU-GEMM) colony formation and secondary replating capacity of cytokine stimulated CFU-GM and CFU-GEMM derived colonies of normal mouse BM cells in vitro in presence of non-dialyzed FBS; additional enhanced valine effects were noted when dialyzed FBS (lacking valine and other amino acids) was used. Valine also enhanced mouse BM HPC survival in vitro in context of delayed addition of growth factors, and cytokine stimulated (SCF, FL, TPO) ex-vivo expansion of normal mouse BM HSCs and HPCs. Valine enhancement of the above noted functional mouse BM HPC assays in the presence of dialyzed FBS was also apparent with low density and CD34+ purified CB cells, demonstrating that valine effects are not species specific. Our results suggest that valine is an enhancing factor for HSC maintenance of self-renewal capacity and HPC proliferation, and that Brm gene expression limits intracellular valine levels, thereby controlling HSC self-renewal and HPC proliferation. This information is of potential use for future translation to modulate self-renewal of HSCs and survival and proliferation of HPCs for clinical advantage. Disclosures No relevant conflicts of interest to declare.

Characterization of a Novel JAK1 Pseudokinase Mutation in the First Case of Trisomy 21-Independent GATA1-Mutated Transient Abnormal Myelopoiesis

Clonal proliferation of megakaryoblasts, called transient abnormal myelopoiesis (TAM), is a rare disease of newborns triggered by trisomy 21 (constitutional or somatic) together with acquired mutations of GATA1 resulting in the exclusive production of its short variant - GATA1s. No other TAM drivers have been described so far. We have diagnosed a unique TAM case with a typical clinical and laboratory manifestation but without the gain (or any other aberration) of chromosome 21. Thorough genomic profiling revealed 4 somatic mutations: GATA1 D65_C228del, JAK1 F636del, FN1 R2420C and SPIRE2 R471W. With respect to the generally accepted 2-hit theory, we hypothesized that this TAM arose from a collaboration of the atypical GATA1 mutation (not inducing GATA1s) with (at least) one of the other identified mutations. Unlike SPIRE2 and FN1 aberrations, various mutations of the JAK1 kinase have been previously described as leukemia drivers, suggesting JAK1 F636del as a top candidate for the second hit. Moreover, JAK1 mutations have been associated with the transformation of TAM into acute megakaryoblastic leukemia (Nikolaev et al., Blood, 2013). The aim of our project was to functionally characterize this novel JAK1 mutation. Phenylalanine 636 belongs to a phylogenetically conserved triad of amino acids suggested to control catalytic activity of JAK1 via mediating a switch between the supposedly active and inactive conformations (Toms et al., Nat Struct Mol Biol, 2013). Hence, F636 seems to be essential for JAK1 function. Surprisingly, homology modeling showed that loss of F636 is compatible with both functionally opposite conformations. Indeed, Western blot analysis of JAK/STAT signaling in transiently transformed HEK293T cells showed that catalytic activity is preserved in JAK1 F636del. However, we observed lower levels of auto- and STATs- phosphorylation compared to wild-type (wt) JAK1 suggesting decreased kinase activity of JAK1 F636del. Subsequently, we tested the oncogenic potential of JAK1 F636del in the Ba/F3 cell assay; unlike the known oncogenic JAK1 variant (JAK1 V658I), JAK1 F636del did not induce IL3-independent growth. To further assess phenotypic impact of F636del, we introduced JAK1 F636del into murine bone marrow and fetal liver hematopoietic stem and progenitor cells (HSPCs) using lentiviruses and performed colony forming assays. The number and morphology of colonies did not differ in JAK1 F636del compared to wt JAK1. Furthermore, we assessed the impact of JAK1 F636del in the context of mutated GATA1. We utilized the in-vitro model recently described by Labuhn et al. (Cancer Cell, 2019), in which the CRISPR/Cas9-mediated induction of Gata1s expression leads to the expansion and sustained proliferation of fetal liver HSPCs from embryonic day 13.5 ROSA26:Cas9-EGFPki/wt mice. Similar to wt JAK1, lentivirally introduced JAK1 F636del had no impact on the proliferation and maturation status of such Gata1-edited HPSCs irrespective of the timing of its introduction (simultaneously with Gata1 editing versus into fully established Gata1-edited culture) or of culturing conditions (fully cytokine-supplemented growth-supportive versus cytokine-depleted growth-restrictive medium). Altogether, we show that unlike known oncogenic variants, F636del identified in the first case of trisomy 21-independent TAM attenuates JAK1 kinase activity. The results of our phenotypic studies question the potential contribution of this mutation to TAM development. Interestingly, Labuhn et al. (2019) recently showed that non-activating JAK mutations occur at higher than random frequency in trisomy 21-dependent TAM. This tempts us to speculate that JAK1 mutations may still play a role in TAM. Yet, this role may significantly differ from that of known oncogenic mutations; it may result from attenuation/modulation instead of activation of downstream signaling and it may remain unrevealed utilizing the currently available sophisticated, yet still imperfect experimental models. Support: GAUK 86218, EHA Research Mobility Grant Disclosures No relevant conflicts of interest to declare.

Abstract A106: Higher numbers of cancer stem cells in the peripheral blood of children with B-ALL after chemotherapy

Abstract Background: Acute lymphocytic leukemia (ALL) is biologically and clinically considered as a heterogeneous neoplasm of lymphoid progenitor cells in the bone marrow (BM). 15- 20 % of children with ALL who achieve an initial remission, will show relapse. One potential mechanism behind this relapse could be the emergence of cancer stem cells (CSCs), which are considered the driving force of tumorigenesis due to their ability of self-renewal as well as the emergence of immune regulatory cells including myeloid-derived suppressor cells (MDSCs) and regulatory T-cells (Treg). Aim: The main aim of this study was to analyze the numbers of CSCs and correlate these numbers with the numbers of blasT-cells, MDSCs and Treg cells in children with B-ALL before and after induction of chemotherapy. Materials and Methods: CSCs were defined as CD45dimCD19+CD10+CD34+CD38-, MDSCs were defined as Lin-HLA-DR-CD33+CD11b+ and Treg cells were defined as CD4+CD25+CD127-. The frequencies of these cells were analyzed in the peripheral blood of B-ALL patients before (n= 10) and after (n= 10) induction of chemotherapy using flow cytometry. Results: Significant increases in the numbers of CSCs were shown in B-ALL patients after induction of chemotherapy as compared to newly diagnosed patients (7.6± 8.3 vs. 2.7± 2.4, P&amp;lt;0.05). The numbers of CSCs in ALL patents before and after induction of chemotherapy inversely correlated with the numbers of the blasT-cells. Additionally, the numbers of MDSCs and Treg cells were higher and lower, respectively, in patients after induction of chemotherapy as compared to before chemotherapy. Conclusion: Our results indicate that chemotherapy of B-ALL patients results in emergence of high numbers of CSCs and MDSCs, which might be contributing, respectively, to tumor relapse and creation of systemic immune suppression. This pilot study opens a new avenue to investigate the mechanism mediating the emergence of these cells on larger population of B-ALL patients at different treatment stages. Citation Format: Mohamed Labib Salem, Mohamed Attia, Said Abdou, Abdel-Aziz A. Zidan, Mona F. Zidan. Higher numbers of cancer stem cells in the peripheral blood of children with B-ALL after chemotherapy [abstract]. In: Proceedings of the Fourth CRI-CIMT-EATI-AACR International Cancer Immunotherapy Conference: Translating Science into Survival; Sept 30-Oct 3, 2018; New York, NY. Philadelphia (PA): AACR; Cancer Immunol Res 2019;7(2 Suppl):Abstract nr A106.

Recent advances in mechanisms of megakaryopoiesis and platelet formation

Platelets are specialized cells, which are functioned to prevent bleeding and minimize blood vessel injury, and are also the predominating factor in the processes of hemostasis and thrombosis, while implicate in other processes including inflammation, innate immunity, angiogenesis and tumor metastasis. Among current mechanisms of platelet formation, platelets are produced by megakaryocytes, which are themselves generated by a process of controlled differentiation and maturation of bone marrow hematopoietic stem cells (HSC) and progenitor cells. Megakaryocytes release platelets by extending long, branching proplatelets, into sinusoidal blood vessels. Bone marrow cavity and extracellular matrix composition together with cytokines as thrombopoietin (TPO) are key regulators of megakaryopoiesis by supporting cell differentiation and platelet formation. Understanding the mechanisms of megakaryocyte differentiation and platelet formation can provide a solid theoretical basis for the treatment of platelet-related diseases. This review summarizes the current scientific research progress in the mechanisms of megakaryopoiesis and thrombopoiesis. Key words: Megakaryocytes; Cell differentiation; Thrombopoiesis; Transcription factors; Apoptosis; Megakaryopoiesis

The androgen receptor in bone marrow progenitor cells negatively regulates fat mass.

It is well established that testosterone negatively regulates fat mass in humans and mice; however, the mechanism by which testosterone exerts these effects is poorly understood. We and others have shown that deletion of the androgen receptor (AR) in male mice results in a phenotype that mimics the three key clinical aspects of hypogonadism in human males; increased fat mass and decreased bone and muscle mass. We now show that replacement of the Ar gene specifically in mesenchymal progenitor cells (PCs) residing in the bone marrow of Global-ARKO mice, in the absence of the AR in all other tissues (PC-AR Gene Replacements), completely attenuates their increased fat accumulation. Inguinal subcutaneous white adipose tissue and intra-abdominal retroperitoneal visceral adipose tissue depots in PC-AR Gene Replacement mice were 50-80% lower than wild-type (WT) and 75-90% lower than Global-ARKO controls at 12 weeks of age. The marked decrease in subcutaneous and visceral fat mass in PC-AR Gene Replacements was associated with an increase in the number of small adipocytes and a healthier metabolic profile compared to WT controls, characterised by normal serum leptin and elevated serum adiponectin levels. Euglycaemic/hyperinsulinaemic clamp studies reveal that the PC-AR Gene Replacement mice have improved whole-body insulin sensitivity with higher glucose infusion rates compared to WT mice and increased glucose uptake into subcutaneous and intra-abdominal fat. In conclusion, these data provide the first evidence for an action of androgens via the AR in mesenchymal bone marrow PCs to negatively regulate fat mass and improve metabolic function.

Prognostic Features of BCR-ABL Genetic Variations in Acute Lymphoblastic Leukemia

Background: Acute lymphoblastic leukemia (ALL) is a hematologic malignancy which results from accumulation of lymphoid progenitor cells in the bone marrow and/or extramedullary sites. Philadelphia chromosome (Ph1) positive ALL, a high-risk cytogenetic subset, accounts for 25% - 30% of adult ALL cases but occurs in less than 5% of children. We aimed with this study to detect BCR-ABL genes fusion, amplification and deletion in ALL patients, using extrasignal-fluorescence in situ hybridization (ES-FISH), and to assess their relation with other standard prognostic factors and therapeutic response. Patients and Methods: This study was carried out on 39 newly diagnosed ALL patients. All patients were subjected to: history, clinical examination and laboratory investigations, which included complete blood count (CBC), peripheral blood (PB), bone marrow (BM) examination, immunophenotyping and fluorescence in situ hybridization using extra-signal probe to detect BCR-ABL genes fusion. Results: This study showed statistical analysis of patients’ t(9; 22) with other factors revealed, significant association (p 35 years, hepatosplenomegaly, absence of lymphadenopathy, TLC ≥ 50 × 109/L, absolute PB blasts ≥ 4.4 × 109/L, immunophenotyping and other aberrations. Conclusion: BCR/ABL fusion gene analysis by ES-FISH may serve as a prognostic marker in adulthood ALL. The age, TLC and t(9; 22) represent the significant standard prognostic factors in relation to patients’ outcome.

Abstract B111: Characterization of APVO436, a bispecific anti-CD123 x anti-CD3 ADAPTIR™ molecule for redirected T-cell cytotoxicity, in preclinical models of AML and nonhuman primates

Abstract Introduction: CD123 has emerged as a promising target for T-cell directed immunotherapy in acute myeloid leukemia due to its high level of expression on leukemic blasts and stem cells and low frequency of expression on normal cell types. CD123 is expressed by rare normal leukocyte populations, including basophils and plasmacytoid dendritic cells in circulation and hematopoietic progenitor cells in the bone marrow. We have developed APVO436, a bispecific anti-CD123 x anti-CD3 ADAPTIR molecule for redirecting T-cell cytotoxicity to CD123-expressing tumor cells. Results are presented that examine the in vitro and in vivo activity of APVO436 in preclinical models of AML, as well as pharmacokinetics and tolerability in nonhuman primates. Methods: CHO-produced APVO436 protein was used for in vitro functional studies with CD123+ AML tumor cell lines and primary human T-cell populations. Cytotoxic activity was determined using chromium release assays. On-cell binding, T-cell activation and proliferation were assessed using multicolor flow cytometry. Cytokine levels were measured using multiplex assay kits. In vivo studies to examine tumor growth inhibition activity were performed using NSG mice with established AML tumors followed by treatment with APVO436 coadministered with T cells. Tumor growth was assessed by bioluminescent imaging. In vivo studies to determine pharmacokinetics of APVO436 following single intravenous injections were performed in healthy BALB/c mice and cynomolgus monkeys. Results: APVO436 bound to CD123 and CD3 expressing cells with high affinity. APVO436 induced concentration-dependent lysis of CD123+ AML cell lines with primary human T cells at low effector-to-target ratios, accompanied by T-cell activation and proliferation. These activities were dependent on the expression of CD123 by the tumor target cells. Treatment of established disseminated tumors in mice with APVO436 resulted in a significant reduction in tumor burden. A single 10 mg/kg IV injection of APVO436 in normal BALB/c mice demonstrated an extended elimination serum half-life of approximately 300 hours. Single IV injections of APVO436 ranging from 0.25 mg/kg to 1 mg/kg were well tolerated in cynomolgus monkeys. The observed elimination half-life in cynomolgus serum was up to 84 hours with normal clearance and volume distribution. Conclusions: These data demonstrate APVO436 has potent in vitro activity against a number of CD123-expressing tumor cell lines and in vivo significantly reduces established tumor burden in xenograft models. APVO436 demonstrates an extended serum half-life in normal mice and cynomolgus monkeys. These data are supportive of further investigation of APVO436 as a potential treatment option for AML and other hematologic malignancies. Citation Format: Michael R. Comeau, Robert E. Miller, Jeannette Bannink, Starrla Johnson, Robert Bader, Rebecca Gottschalk, Lynda Misher, Danielle Mitchell, Lara Parr, Melissa DeFrancesco, David Bienvenue, Catherine J. McMahan, Gabriela H. Hoyos, Jane A. Gross. Characterization of APVO436, a bispecific anti-CD123 x anti-CD3 ADAPTIR™ molecule for redirected T-cell cytotoxicity, in preclinical models of AML and nonhuman primates [abstract]. In: Proceedings of the AACR-NCI-EORTC International Conference: Molecular Targets and Cancer Therapeutics; 2017 Oct 26-30; Philadelphia, PA. Philadelphia (PA): AACR; Mol Cancer Ther 2018;17(1 Suppl):Abstract nr B111.

Abstract 27: Loss of GATA4 in Kit Lineage-derived Endothelium Leads to Vascular Permeability and Increased Heterotypic Fusion

The treatment of cardiac ischemic injury using heart-derived c-Kit stem cells showed promising results in clinical trials with scar reduction and improved ejection fraction following coronary infusion. We previously developed a c-Kit lineage tracing mouse model showing that these cells very rarely convert into de novo cardiomyocytes and most lineage-derived cardiomyocytes are due to fusion. To potentially reduce this de novo rate to zero, and unequivocally evaluate the cellular fusion process in vivo , we deleted the essential cardiomyogenic transcription factor Gata4 in c-Kit cells using a Cre-loxP approach (Kit-Gata4 KO). Mice with the tamoxifen inducible Kit-MerCreMer allele crossed into a Gata4 homozygous LoxP targeted background with the Rosa26-eGFP reporter were fed tamoxifen at weaning to delete Gata4 in all c-Kit expressing cells and show them and their progeny as eGFP + . Unexpectedly, we observed a greater than 10-fold increase in Kit lineage-traced cardiomyocytes in Kit-Gata4 KO mice compared to Kit only controls with up to 4 months of tamoxifen treatment (90% v. 81% fusion in Kit-Gata4 KO v. controls). A 6-fold increase in leukocyte (CD45 + ) infiltration was observed suggesting the possibility for greater rates of fusion in the heart. However, bone marrow transplant studies revealed that Kit-Gata4 KO bone marrow does not exhibit increased cardiac infiltration or heterotypic fusion with cardiomyocytes. The reciprocal experiment, donating control bone marrow to recipient mice with Kit-Gata4 KO hearts, showed a 4-fold increase in fusion of control bone marrow showing that increases in fusion was intrinsic to the cells within the heart. Analysis of cardiac endothelial cells in Kit-Gata4 KO mice revealed that total CD31 + cells were increased by 30% with 2 months of tamoxifen treatment with a parallel increase in endothelial progenitor cells (CD133 + ) in the bone marrow. This endothelial phenotype was corroborated using endothelial-specific deletion of Gata4 in a Tie2-CreER mouse which showed a 5-fold increase in both CD31 + cells and vascular permeability after 1 month of tamoxifen. Currently, studies are underway to assess the mechanism of altered endothelial integrity and expansion in the absence of Gata4 in c-kit hemoangioblast progenitors.

Abstract 5595: HDAC inhibitor Entinostat disrupts function of PMN-MDSC

Abstract Myeloid-derived suppressor cells (MDSCs), consisting of subpopulations of polymorphonuclear (PMN; CD11b+Ly6G+Ly6Clo) and monocytic (M; CD11b+Ly6G-Ly6Chi) MDSCs play a major role as immune suppressors in cancer. MDSC-targeted therapy has not been developed yet. Histone deacetylases (HDAC) are critically involved in epigenetic regulation of multiple genes and may regulate MDSC number and function. The purpose of this study was to evaluate the effect of the class I HDAC inhibitor, entinostat on differentiation and function of MDSCs in mouse tumor models of lung cancer (Lewis Lung Carcinoma, LLC) and colon cancer (CT26). LLC and CT26 tumor-bearing mice were treated with entinostat (10 mg/kg, p.o. daily for two weeks). Entinostat caused significant increase in the presence of CD45+ CD11b+ myeloid cells in bone marrow, spleen and tumors. This increase was largely due to accumulation of Ly6ClowLy6G+ PMN. Unexpectedly, this was associated with a small decrease in the presence of common myeloid progenitor (CMP) and granulocyte-macrophage progenitor (GMP) cells in bone marrow. This suggests that entinostat affects differentiation of PMN downstream of GMP. Experiments in vitro demonstrated that entinostat increased differentiation of enriched hematopoietic progenitor cells (HPC) to PMN in the presence of tumor explant supernatant (TES), which supported the in vivo result. To assess the effect of entinostat on the function of PMN-MDSCs, Ly6G+ cells were purified from spleen and tumor of LLC tumor-bearing mice treated with entinostat or vehicle alone and tested for their ability to suppress antigen-specific T cell. As expected Ly6G+ PMN-MDSC from tumor-bearing mice treated with vehicle alone had strong suppressive activity. In contrast, Ly6G+ cells from spleen and tumor of entinostat-treated LLC tumor-bearing mice show significantly reduced suppressive activity. This result was confirmed in experiments with Ly6G+ cells differentiated from HPC culture with/without entinostat treatment. To determine whether entinostat inhibition of PMN-MDSC immunosuppressive function could enhance immune checkpoint activity, entinostat combined with an anti-PD-1 antibody was evaluated using the LLC tumor-bearing mice. These mice were treated with entinostat (10 mg/kg, p.o., daily) and anti-mouse PD-1 rat antibody (10 mg/kg, i.p., twice a week). Entinostat or PD-1 antibody alone did not significantly inhibit the tumor growth. In striking contrast, the combination treatment blocked tumor progression. Our data demonstrate that entinostat increases a population of PMN-MDSCs that are no longer immunosuppressive leading to enhanced anti-tumor activity when combined with an immune checkpoint inhibitor. This novel phenomenon provides further rationale for combination therapy of entinostat with anti-PD-1 antibody or other checkpoint inhibitors in clinical settings. Citation Format: Ayumi Hashimoto, Vinit Kumar, Peter Ordentlich, Dmitry I. Gabrilovich. HDAC inhibitor Entinostat disrupts function of PMN-MDSC [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2017; 2017 Apr 1-5; Washington, DC. Philadelphia (PA): AACR; Cancer Res 2017;77(13 Suppl):Abstract nr 5595. doi:10.1158/1538-7445.AM2017-5595

Abstract 3713: Higher numbers of cancer stem cells in the peripheral blood of children with B-ALL upon conventional chemotherapy

Abstract Background: Acute lymphocytic leukemia (ALL) is biologically and clinically considered as a heterogeneous neoplasm of lymphoid progenitor cells in the bone marrow (BM). 15- 20 % of children with ALL who achieve an initial remission, will show relapse. One potential mechanism behind this relapse could be the emergence of cancer stem cells (CSCs) which are considered the driving force of tumourigenesis due to their ability of self-renewal as well as the emergence of immune regulatory cells including myeloid-derived suppressor cells (MDSCs) and regulatory T cells (Treg). Aim: the main aim of this study was to analyze the numbers of CSCs and correlate these numbers with the numbers of blast cells, MDSCs and Treg cells in children with B-ALL before and after induction of chemotherapy. Materials and Methods: CSCs were defined as CD45dimCD19+CD10+CD34+CD38-, MDSCs were defined as Lin-HLA-DR-CD33+CD11b+ and Treg cells were defined as CD4+CD25+CD127-. The frequencies of these cells were analyzed in the peripheral blood of B-ALL patients before (n= 10) and after (n= 10) induction of chemotherapy using flow cytometry. Results: Significant increases in the numbers of CSCs were shown in B-ALL patients after induction of chemotherapy as compared to newly diagnosed patients (7.6± 8.3 vs. 2.7± 2.4, P&amp;lt;0.05). The numbers of CSCs in ALL patents before and after induction of chemotherapy inversely correlated with the numbers of the blast cells. Additionally, the numbers of MDSCs and Treg cells were higher and lower, respectively, in patients after induction of chemotherapy as compared to before chemotherapy. Conclusion: Our results indicate that chemotherapy of B-ALL patients results in emergence of high numbers of CSCs and MDSCs which might be contributing, respectively, to tumor relapse and creation of systemic immune suppression. This pilot study opens a new avenue to investigate the mechanism mediating the emergence of these cells on larger population of B-ALL patients at different treatment stages. Note: This abstract was not presented at the meeting. Citation Format: Mohamed L. Salem. Higher numbers of cancer stem cells in the peripheral blood of children with B-ALL upon conventional chemotherapy [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2017; 2017 Apr 1-5; Washington, DC. Philadelphia (PA): AACR; Cancer Res 2017;77(13 Suppl):Abstract nr 3713. doi:10.1158/1538-7445.AM2017-3713