Manufacturer's Directions Research Articles

Evaluating the physical properties of microwave-cured and heat-cured acrylic denture base materials after the addition of ZrO2 nanoparticles.

Background: The structural, physical, and mechanical properties of denture-based acrylic resin are still compromised by water sorption, water solubility, and porosity. These issues have long called for improved techniques, and the use of nanoparticles is one of them. The main objective of the current investigation was to evaluate and contrast some physical parameters (water sorption, water solubility, and porosity) after the incorporation of ZrO2 nanoparticles (0%, 3% and 5%) into heat-cured acrylic denture base materials (Ivoclare, Major) and microwave-cured acrylic (Acron MC). Materials and methods: A total of 60 resin specimens were manufactured, including 5 specimens for each concentration of ZrO2 NP (30 for porosity and 30 for water sorption and solubility). Followed the manufacturer's directions for preparing the sample of each material. Results: The results were analysed with descriptive statistics, Analysis of Variance(ANOVA) test, Duncan multiple range test, and independent T test demonstrated that the addition of nanoparticles (3% and 5%) decreased water sorption, water solubility, and porosity of PMMA(polymethyl methacrylate) for both types(microwave-cured and heat-cured acrylic denture base materials). Where, at 3%, the ZrO2 nanoparticles showed the best values for all tests compared to the control group. Conclusions: ZrO2 (3% and 5%) nanoparticle reinforcement of acrylic resin can be a useful tactic for lowering water sorption, solubility and porosity, thereby enhancing the performance of the material in various applications for microwave-cured and heat-cured acrylic denture base materials.

Experimental study on transpiration cooling through additively manufactured porous structures

Film cooling and thermal barrier coating are the most common external cooling techniques used for gas turbine components. In film cooling, coolant air is brought to the external surface via rows of discrete holes. This study investigates an alternative geometry, referred to as transpiration cooling. Here, the coolant air is brought to the external surface through an additively manufactured porous structure. An experimental study was performed to characterize the downstream cooling performance by obtaining film cooling effectiveness and heat transfer coefficient using thermochromic liquid crystals. The experimental setup was first validated using a cylindrical film cooling sample and the results were compared to results obtained from previously published film cooling studies. After validation, transpiration cooling samples were investigated. A total of three porous structure samples with different thicknesses were subjected to testing. The thickness of the porous structure had insignificant effect on both the heat transfer coefficient and the film cooling effectiveness. The samples were tested at blowing ratios ranging from 0.5 to 2.0. Results showed an increase in laterally averaged heat transfer coefficient with increasing blowing ratio and compared to cylindrical film cooling, transpiration cooling yielded significantly higher distributions. The spanwise averaged film cooling effectiveness displayed a similar trend with higher values for transpiration cooling, mainly due to a more even mixing in the lateral direction. Values of the heat flux ratio showed that the high heat transfer coefficient penalizes the porous cooling method and only for low blowing ratios may transpiration cooling be the beneficial choice. From visualizations with water and carbon dioxide, it could be concluded that the inclination angle is close to 90° which yields a chaotic flow field and, in turn, high values of the heat transfer coefficient. By changing the additive manufacturing's build direction, a more favorable inclination angle should be achievable and, thereby, an opportunity to utilize the porous structure's excellent mixing in the spanwise direction.

Comparative evaluation of shear bond strength of three different glass ionomer cement (conventional, zirconium-reinforced and advanced glass hybrid) in primary molars: an in vitro study.

The success of restorative materials is largely dependent on their capacity to adhere to the tooth structure and withstand the various forces present in the oral cavity. So, the aim of present study was to evaluate and compare the shear bond strength (SBS) of Type IX Glass Ionomer Cement (GIC), Zirconomer, and Gold Label Hybrid GIC in primary molars. Thirty primary molars were selected based on inclusion and exclusion criteria. The molars were polished to provide a flat dentin surface after being inserted in auto polymerizing acrylic resin. The samples were randomly divided into three groups, equally and were bonded to GIC. On the dentin surface, restoration cylinders were made using a plastic mould that had an internal diameter and height of 5mm and 3mm, respectively. The cement was manipulated according to the manufacturer's directions through the plastic mould. Then, the samples were stored at room temperature for 10days to mimic oral conditions. The Universal Testing Machine was used to test SBS. One-way ANOVA and the post hoc Tukey test were used to statistically assess the collected data. A statistically significant difference was found in all three groups (p < 0.01), with Zirconomer demonstrating highest SBS, followed by Type IX GIC and Gold Label Hybrid GIC. The SBS value of Zirconomer was better when compared to Type IX GIC and Gold Label Hybrid GIC.

First report of apple latent spherical virus infecting Angelica sinensis.

Angelica sinensis (Oliv.) Diels is a perennial herb of the genus Angelica in the family Umbelliferae. The dried root of A. sinensis has have long been used medicinally (Zhang et al., 2016). Several plant viruses have been reported to infect A. sinensis: tomato mosaic virus, Japanese hornwort mosaic virus, and konjak mosaic virus (Zhang et al., 2020). In July 2019, we collected A. sinensis samples exhibiting symptoms of yellowing, mottling, and wrinkling from fields in Gansu Province. Seven plants were mixed in a composite sample and were commissioned to Biotech Bioengineering (Shanghai) Co., Ltd. for small RNA sequencing. Total RNA of A. sinensis was extracted according to the manufacturer's directions using the total RNA extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.). The library was constructed using the TruSeq™ Small RNA Sample Prep Kits (Illumina, San Diego, USA) kit and was sequenced using the Illumina Hiseq2000/2500 with a single-end read length of 1X50bp. Samples were sequenced to obtain 1199561625 raw reads and 281093971 clean reads by removing low quality reads. Quality-controlled qualified reads were assembled using SPAdes (Bankevich et al., 2012) with a k-mer value of 17 and the obtained results were compared with NCBI's nucleotide database. Eight contigs were annotated as homologous to apple latent spherical virus (ALSV, AB030940.1 and AB030941.1). The similarity between the eight contigs and the reference genome ranged from 84% to 90%. The sequencing coverage of RNA1 and RNA2 of ALSV were 23.00% and 32.36%, respectively.The specific primers F 5`-CAGGGCCCAGATTTCACTAGAATTA-3` and R 5`- CTAAGTGTAGCCAGCCTTGAGCAATC -3` were designed based on acquired contigs to validate the sequencing results in the individual samples. One of the original composite samples was ALSV positive. Polymerase chain reaction products were detected in 1.5% agarose geland 1761 bp target band was obtained. The obtained sequence (OP038546) was searched against the NCBI nucleotide database using the BLASTn algorithm. Results showed that it shared 81.53% nucleotide sequence identities with the genome of ALSV ((AB030941.1) and this is the first time that ALSV was found to naturally infect A. sinensis. ALSV belongs to the genus Cheravirus in the family Secoviridae that was first identified in apple leaves (Li et al., 2000). To analyze the phylogenetic relationships of ALSV, all the coat protein genes of genus Cheravirus were downloaded from NCBI and a phylogenetic tree was constructed using the Construct/Test Maximum Likelihood Tree method using MEGA7.0 software. The self-extension value was 1000, and the branches with evolutionary numbers below 50% were removed. The ALSV isolate obtained from Gansu A. sinensis in this experiment aggregated in the same branch as the ALSV infested apple, again proving that the virus is ALSV (Fig.1A). Additionally, a total of 111 A. sinensis samples were collected and validated by RT-PCR with primers ALSV-F and ALSV-R. Among these samples, 15 were positive for ALSV. The overall infection rate of ALSV on A. sinensis was 13.51%. The detection rates of Weiyuan, Zhangxian, Tanchang, Minxian and Yuzhong were 15.38%, 40.00%, 23.08%, 7.84% and 8.33%, respectively (Table.1). A. sinensis infested with ALSV may produce symptoms of chlorotic and mottle (Fig.1C and D), which is similar to that in quinoa. Accordingly, larger scale A. sinensis investigations must be conducted to determine the distribution and prevalence of ALSV in China.

Seroprevalence of IgM and IgG Against SARS-CoV-2 after Two Doses of Pfizer-BioNTech COVID-19 Vaccine in Women with Breast Cancer.

This study evaluates the seroprevalence of immunoglobulin M (IgM) and G (IgG) antibodies against SARS-CoV-2 after two doses of Pfizer-BioNTech COVID-19 vaccination from women with breast cancer in Jazan city Kingdom of Saudi Arabia, antibody detections were performed one month and three months after the administration of the second dose. Overall, 103 breast cancer patients were included. Individuals who had had two doses of Pfizer-BioNTech vaccine, patients who were earlier diagnosed with COVID-19 infection, had not finalized immunization plan, or who received the second dose recently were excluded from the study. The antibodies detection test was run according to the manufacturer's directions of Viva Diag™ SARS-CoV-2 IgM/IgG Rapid Test (COVID-19 IgM/IgG Rapid Test). This study included 62 (60.2%) and 41 (39.8%) patients with invasive ductal carcinoma and invasive lobular carcinoma, respectively. The age, median and interquartile range (IQR) was 54.0 (26) years. Regarding reactivity of antibodies, after one month IgM antibody showed 64 (62.1%) positive and 39 (37.9%) negative while IgG antibody showed positive results in all patients. After three months IgM antibody showed 44 (42.7%) positive and 59 (57.3%) negative, while IgG showed 87 (84.5%) positive and 16 (15.5%) negative. There were significant differences in the IgM and IgG seropositivity. There were 19.3% patients with ductal carcinoma who were positive and then turned negative versus 17.7% who were positive and then turned negative, respectively (p < 0.001). There were significant differences in IgM antibody positivity among different age groups. Our results recommend the importance of screening for an antibody response for breast cancer patient after immunization in order to reveal persons who need early and late extra enhancing vaccine dose. Upcoming studies recommended to estimate different methods that raise cancer patients' immune response.

Screening of blood donors for sickle cell trait using a DNA-based approach: Frequency in a multiethnic donor population.

Minority RBC donors are important to support the transfusion needs of patients with sickle cell disease. Testing of donors for sickle cell trait (SCT) is performed to avoid transfusion of hemoglobin S+ (HbS+) RBCs to specific patient groups and to investigate leukoreduction failures. A screening assay based on hemoglobin solubility is commonly used. The purpose of this study was to validate a DNA approach for HbS screening. Hemoglobin solubility screening (Pacific Hemostasis or SICKLEDEX) and PreciseType human erythrocyte antigen (HEA)-HbS (Immucor) targeting c.20A>T in the β-globin gene were performed according to manufacturer's directions. Resolution of differences in results included gene sequencing and high-performance liquid chromatography (HPLC). Initial validation of HEA-HbS performed by testing 60 known samples, 20 HbS/A, A/A, and S/S, gave expected results. However, in the subsequent parallel testing phase, 4/58 samples HbS+ by solubility assay tested negative by HEA-HbS; the negative results were confirmed by β-globin gene sequencing. Samples from donors self-identifying as White testing HbS+ by solubility assay (n=60) were retested by HEA-HbS and HPLC. The HEA-HbS assay was concordant with HPLC which is recognized as the gold standard for hemoglobin variation. A DNA-based approach is an alternative to screen donors for SCT, found in approximately 7% of Black and 1.7% of our random donors. HEA-HbS correlated with HPLC results in all samples tested, supporting the use of HEA-HbS as the test of record. The method allows higher throughput screening and testing at the donor center allows association of the screening result with the donor record to avoid repeat testing.

Investigation of the Change in Color Caused by the Contact of Calcium Silicate-Based Materials with Endodontic Irrigation Solutions

Introduction: Although calcium silicate-based cements are very successful in healing, they cause esthetic problems and dissatisfaction, especially in anterior teeth because they cause discoloration in the teeth. This study aimed to detect the color changes that occur as a result of contact of BIOfactor mineral trioxide aggregate (MTA) and biodentin with three different irrigation agents. Methods: The materials to be tested (G1: BIOfactor MTA and G2: Biodentin) were prepared as per the manufacturer's directions. The prepared materials were placed in cylindrical molds of 8 mm diameter and 3 mm height and kept in a 37°C oven for 24 h to complete their hardening. Subsequently, the samples were immersed in one of three different irrigation solutions (5% sodium hypochlorite, 17% ethylenediaminetetraacetic acid [EDTA] or saline) for 24 h. After drying, spectrophotometer was utilized to quantify color under consistent laboratory light by the same administrator. Results: Significantly, more color changes were observed in the G1 group compared to the G2 group (P = 0.05). Although color changes were detected in all subgroups of G1 and G2 groups as a result of contact with different irrigation materials, it was determined that these changes were not statistically significant (P &gt; 0.05). The irrigation agent that caused the most discoloration was saline (12.33 ± 6.87) in G1 group and EDTA (7.05 ± 3.48) in G2 group. Conclusion: As a result of this study, significantly more color changes were found in BIOfactor MTA than biodentin. It was found that different irrigation agents did not cause statistically significant color changes.

Effect of a wear-resistant resin coat on the color stability of a resin-modified glass ionomer restorative material.

The purpose of this in vitro study was to evaluate the effect of the Equia Forte Coat on the color stability of Equia Forte Fil. Sixty discs of Equia Forte Fil were randomly divided into two groups. One group of 30 samples was treated with Equia Forte Coat according to the manufacturer's directions. The other 30 discs were not coated. All discs were continuously soaked in cola for 7 consecutive days. The color changes in the Equia Forte Fil samples were determined using a colorimeter. The color difference (△E) was calculated using the Commission Internationale de l'Eclairage L*a*b* coordinates. There was a significant difference in ΔE between the two groups (P < 0.0001). The group with Equia Forte Coat had significantly less color change than the group without the Equia Forte Coat. The application of the Equia Forte Coat significantly improved the color stability of Equia Forte Fil.

Clinical Effects of Desensitizing Prefilled Disposable Trays in In-office Bleaching: A Randomized Single-blind Clinical Trial.

This study aimed to evaluate the desensitizing effect of a prefilled disposable tray containing potassium nitrate and fluoride on the self-reported tooth sensitivity (TS) and the bleaching efficacy of 40% hydrogen peroxide bleaching agent used for in-office bleaching in comparison with potassium nitrate and fluoride gel applied in a conventional-delivered tray system in an equivalence clinical trial. Seventy-eight patients, with a right maxillary canine darker than A3, were selected for this single-blind (evaluators), randomized clinical trial. Teeth were bleached in two sessions with a one-week interval in between. Before in-office bleaching, the prefilled disposable tray or conventional tray containing potassium nitrate and fluoride was used for 15 minutes. Subsequently, the bleaching agent was applied in two 20-minute applications (per the manufacturer's directions) in each session. The color change was evaluated by subjective (Vita Classical and Vita Bleachedguide) and objective (Easyshade Advance Spectrophotometer) methods at baseline and 30 days after the first bleaching session. TS was recorded for up to 48 hours using a 0-10 visual analog scale. The absolute risk was evaluated by chi-square test, while the intensity of TS was evaluated by McNemar test (α=0.05). Color change in shade guide units and ΔE was analyzed by Student t-test for independent samples (α=0.05). Significant whitening was observed in both groups after 30 days of clinical evaluation. The use of different methods of desensitizer in a tray did not influence the absolute risk and intensity of TS (p>0.05), although a tendency of lower risk of TS with the prefilled disposable tray containing potassium nitrate and fluoride was observed. The use of a prefilled disposable tray containing potassium nitrate and fluoride before the application of the in-office bleaching product did not affect the whitening degree and decreased self-reported TS when compared with a conventional-delivered tray system.

Clinical application of Aspergillus lateral flow device in bronchoalveolar lavage fluid of patients with classic risk factors for invasive pulmonary aspergillosis.

The diagnosis of invasive pulmonary aspergillosis (IPA) remains challenging. We evaluated the performance characteristics of a newly formatted Aspergillus lateral flow test, AspLFD, in bronchoalveolar lavage (BAL) fluid from patients with classic risk factors for IPA. Prospectively banked BAL samples from 14 patients with proven or probable IPA defined by EORTC/MSG criteria and 28 BAL samples from age-matched high-risk patients without IPA were tested with AspLFD according to manufacturer's directions. Results were read by two independent observers, and test performance was calculated. Age, gender and underlying risk factors, except for neutropenia and haematological malignancy, were similar between IPA cases and controls. Seven patients (50%) in the IPA group received a mould-active agent within 5days prior to bronchoscopy compared with only three patients (11%) in the control group, P=.004. Of 14 patients with proven/probable IPA, AspLFD was positive in 3 and negative in 9; two tests yielded invalid results. All 28 control patients had a negative AspLFD test. AspLFD showed low sensitivity (25%, 95% CI: 5.5% to 57.2%), but high specificity (100%. (95% CI: 87.7% to 100%). A positive AspLFD test in BAL fluid of patients with classic risk factors for IPA could be useful to support the diagnosis of proven/probable IPA because of its high specificity. However, as a stand-alone test for IPA, the use of AspLFD is limited by low sensitivity.

PF813 PROFILE OF BLOOD DONORS WITH SEROLOGIC TESTS REACTIVE IN HOSPITAL METROPOLITANO IN QUITO‐ ECUADOR FROM JANUARY 2016 TO DECEMBER 2018

Background:A complete infectious disease screening is a transfusion practice that is mandatory. The safest blood donors are from low‐risk populations who donate voluntarily and without compensation. The Ecuadorian government requires blood product screening for Syphilis, Hepatitis B (HBV), Hepatitis C (HBC), immunodeficiency virus (HIV) and Chagas by Roche (Cobas®). Currently, the detection of human T cell lymphotropic virus (HTLV I / II) is excluded due to its low incidence in our country. These tests are carried out by chemiluminescent immunoassay.According to last year's data from the national blood product program (2014), in Ecuador there are approximately 232,137 blood donations per year. The blood bank of the “Hospital Metropolitano” provides approximately 1.4% of the national donations.Aims:To evaluate the demographic characteristics of blood donors with reactive serology in a private hospital in Quito‐Ecuador from January 2016 to December 2018.Methods:This is a descriptive retrospective study. The data was collected from interviews performed prior to the blood donation.A total of 6648 units of blood were collected from voluntaries over the two year period. Donations were made either directly to the hospital's blood bank or through mobile teams. The positive cut off value was calculated as per the manufacturer's directions. Reactive samples were retested before permanent dismissal.Results:During the study period we had 6648 blood donors 26% (1730) were temporary dismissed, and 1.7% (113) were permanently dismissed. The most important reasons for temporary dismissal were high risk sexual behavior (15%) and low hemoglobin (18%). The main motive for permanent dismissal was reactive markers for transfusion transmitted infections (1.3%).Donors with positive serology are mostly men (66%), ranging between ages of 30 to 50 (47%), married (42%) and with high education level (34%). (Table.1) The overall prevalence of HIV reactive tests was 0.17%, 0.06% for HBsAg, 0.36% for Anti‐HCV, 0.35% for Syphilis and 0.41% for Chagas.Summary/Conclusion:The most prevalent reactive marker of transfusion transmitted infections is Chagas. A recent study by Eric Dumonteil et al., reported that Chagas Disease caused by the parasite Trypanosoma cruzi has not been controlled in Ecuador. The most recent estimates from the World Health Organization suggest the presence of nearly 200,000 seropositive patients and a current incidence of 14 per 100,000 per year in Latin America. We found similar reactive serology prevalence of HIV, HBV, HCV and Shyphilis when comparing with worldwide data. The demographic characteristics of donors with reactive serology are also similar when comparing with other available studies. Despite all efforts to guarantee the safety of blood transfusions, transfusion‐transmitted infections remains an important risk. The national blood program of Ecuador is constantly working on improving the selection of blood donors mainly by promoting voluntary donation. In cases of permanent dismissed donors, counseling could improve their willingness to find appropriate medical care.Donor approval or dismissal policies for the prevention of transfusion‐transmitted infections should be based on up‐to‐date information of the local infectious disease epidemiology. Therefore we can conclude that testing for Chagas antibodies remains a priority for blood banks across Ecuador.image

DOZ047.53: Esophageal balloon dilatation for strictures developing after esophageal atresia surgery

Abstract Aim The aim of this study is to evaluate the results of esophageal balloon dilatation (BD) for strictures after esophageal atresia (EA) surgery. Methods Flexible endoscopic BD was done under fluoroscopic and manometric control. The balloon placed in the stricture was inflated by contrast. The target pressure and the diameter were decided in compliance with the manufacturer's directions as well as fluoroscopic guidance. The balloon was kept inflated for 3 minutes. Prospectively collected data over 10 years were retrospectively evaluated. Cure was defined as no need for dilatation during the last 12 months. Results A total of 79 patients with variable diagnoses underwent 481 BD. Forty (51%) had strictures which developed after EA surgery. They underwent 175 (36%) BD (P &lt; 0.05). There were 21 males and 19 females. The atresia was distal fistula type in 31 (77.5%) patients and isolated EA in nine (22.5%). The BD was done for primary esophago-esophageal anastomosis site in 37 patients. The remaining three patients with long gap EA had undergone previous replacement surgery and the BD was done for the proximal esophago-colonic anastomosis. The median age at the time of the first BD was 14 months with 17 (43%) patients below the age of 1 year. The maximal inflation diameter varied between 5–20 mm. Esophageal BD catheters were used in all except two occasions where 5 mm ureteral balloons were used. The median number of BD was four (n = 1–15). Thirty-four (85%) patients underwent more than one BD. A transmural perforation was encountered in one occasion (0.6%) and the patient eventually underwent esophageal replacement surgery with an uneventful outcome. There was no mortality. Fundoplication was done in nine patients. Thirty-three patients (82.5%) were regarded as ‘cure’. Conclusion Esophageal BD is employed for strictures caused by a variety of reasons. Patients with EA comprise a substantial number of cases needing BD and have strictures less resistant to dilatation. The technique employed in this study is advantageous because it enables direct endoscopic visualization of the stricture and both gradual and controlled increase of the dilatation pressure. BD is safe and efficient yet there is a risk of esophageal perforation as in the other dilatation techniques.

Universal Adhesives Benefit from an Extra Hydrophobic Adhesive Layer When Light Cured Beforehand.

To measure microtensile bond strength (μTBS) of universal adhesives immediately and after 6-month aging, with or without an additional adhesive layer applied on a separately light-cured or non-light-cured universal adhesive. Eighty human third molars were randomly assigned to 8 experimental groups. The universal adhesives Clearfil Universal Bond (Kuraray Noritake) and Single Bond Universal (3M Oral Care) were used in self-etch mode (following the manufacturer's directions), and either light cured or not before application of an extra hydrophobic adhesive layer (Clearfil SE Bond bond, Kuraray Noritake). The two-step self-etch adhesives Clearfil SE Bond (Kuraray Noritake) and OptiBond XTR (Kerr) were used as references. After composite buildups were bonded to mid-coronal occlusal dentin surfaces, the specimens were stored in water (37°C/24 h) and sectioned into microspecimens (0.96 ± 0.04 mm2). Half of the specimens were immediately subjected to μTBS testing (1.0 mm/min), while the other half was stored in water (37°C) for 6 months prior to testing. Failure analysis was performed using stereomicroscopy and SEM. Data were analyzed with two-way repeated measures ANOVA, Tukey's and paired t-tests (p = 0.05). The immediate μTBS was similar for the universal adhesives when applied following the different application strategies (p > 0.05). Application of an extra layer of hydrophobic adhesive improved the aged μTBS of the universal adhesives, which was statistically significant when the universal adhesives were first light cured (p < 0.05). The reference adhesives Clearfil SE Bond and OptiBond XTR exhibited a significantly higher immediate and aged μTBS to dentin than did the universal adhesives (p < 0.05). The bond durability of universal adhesives, applied in self-etch mode, was found to benefit from the application of an extra hydrophobic adhesive layer when the universal adhesives were first light cured.

Effects of Polishing Bur Application Force and Reuse on Sintered Zirconia Surface Topography.

Limited information is available on how to polish and finish zirconia surfaces following computer-aided design/computer-aided manufacturing (CAD/CAM), specifically, how differing application forces and reuse of zirconia polishing systems affect zirconia topography. To determine the effect of differing, clinically relevant, polishing application forces and multiple usages of polishing burs on the surface topography of CAD/CAM zirconia. One hundred twenty 220-grit carbide finished zirconia disks were sintered according to manufacturer's directions and divided into two groups for the study of two coarse polishing bur types. Each group was divided into subgroups for polishing (15,000 rpm) at 15 seconds for 1.0 N, 4.5 N, or 11 N of force using a purpose-built fixture. Subgroups were further divided to study the effects of polishing for the first, fifth, 15th, and 30th bur use, simulating clinical procedures. Unpolished surfaces served as a control group. Surfaces were imaged with noncontact optical profilometry (OP) and atomic force microscopy (AFM) to measure average roughness values (Ra). Polishing burs were optically examined for wear. Scanning electron microscopy (SEM) was performed on burs and zirconia surfaces. One-way ANOVA with post hoc Tukey HSD (honest significant difference) tests (α=0.05) were used for statistical analyses. AFM and OP Ra values of all polished surfaces were significantly lower than those of the unpolished control. Different polishing forces and bur reuse showed no significant differences in AFM Ra. However, significant differences in OP Ra were found due to differing application forces and bur reuse between the first and subsequent uses. SEM and optical micrographs revealed notable bur wear, increasing with increasing reuse. SEM and AFM micrographs clearly showed polished, periodic zirconia surfaces. Nanoscale topography, as analyzed with kurtosis and average groove depth, was found dependent on the specific polishing bur type. These in vitro results suggest changes in OP Ra due to bur reuse and polishing application force. Within the parameters of this study, the resultant topography of zirconia polishing is force-dependent and the reuse of coarse polishing burs is possible without statistically significant differences in Ra values after initial use. Nanoscale and microscale topography were shown to depend on specific polishing bur type.

Correlation of IKr Block with Action Potential Changes in Human Stem Cell Derived Cardiomyocytes

Drugs that prolong the cardiac action potential (AP) often act through block of IKr, the native current mediated by HERG. HERG block in heterologous expression systems (e.g., HEK cells) is a primary assay for determining FDA safety screening. However, the relationship between IKr block and AP prolongation is complex and may vary from cell to cell depending on ion channel expression. Additionally, use dependence may differ significantly in heterologous expression systems. We used cardiomyocytes derived from human pluripotent stem cells (hiPSCDCMs) (Cellular Dynamics, WI) to measure drug effects on IKr and the cardiac AP in the same cell. Cells were cultured according to the manufacturer's directions and used 7-25 days after plating. Standard electrophysiology voltage clamp (whole-cell rupture or Amphotericin B perforated patch), was used. hiPSCDCMs lack endogenous IK1, so virtual IK1 was added via a Cybercyte System (Cytocybernetics, NY) to obtain stable electrical behavior. IKr was recorded using a 4 s voltage step from a holding potential of −80 mV to +30 mV (P1) followed by a single voltage step to −50 mV (P2) for 6 s (30 s inter-sweep interval). Following IKr measurements, cardiac APs were triggered by a 1.5-2.0 nA stimulus for 1.5 ms at 0.5 Hz. These IKr and AP measurement protocols were then repeated with dofetilide or loratadine. Dofetilide (300 nM) completely blocked IKr and loratidine (6 μM) blocked IKr 36±1%. After observing IKr block, both dofetilide and loratadine prolonged the cardiac AP. These results demonstrate a direct correlation between IKr block and effects on the cardiac AP. In accordance with CiPA, this approach may provide a more robust and comprehensive cardiac safety screen as compared to the standard HERG assay.

Clinical evaluation of three adhesive systems in class V carious lesions

Purpose The purpose of this study was to evaluate the clinical performance of three types of adhesive systems (Futurabond universal adhesive in a self-etch mode, Tetric N-bond self-etch adhesive, and Single bond universal adhesive in a total etch mode) in class V carious lesions over 1 year. Materials and methods A total of 20 patients with three carious cervical lesions were participated in this study after obtaining informed consent. A total of 60 restorations were placed. The distributions of adhesive materials and the teeth locations were randomized. Cavities were prepared limited to just removal of carious lesions with incisal and gingival margins in enamel and beveling of incisal cavosurface margin. All adhesives were applied following manufacturer's directions. All cavities were restored with Grandio SO composite resin following manufacturer's directions. Finishing and polishing was performed using finishing burs and polishing discs. Each restoration was clinically evaluated at baseline (24 h), 6 months and 1 year for retention, margin integrity, margin discoloration, secondary caries, and postoperative sensitivity using modified United state public health service (USPHS) criteria. Results The recall rate was 100% after 1 year. Also the retention rate for all restorations was 100% after 1 year. Using χ2-test, there was no statistically significant differences between the tested groups at all evaluation periods regarding marginal adaptation, marginal discoloration, and postoperative sensitivity (P > 0.05). None of restoration had secondary caries at any evaluation period. Conclusion Within the limitation of this short-term evaluation, there was no significant clinical difference between adhesives. Clinical significances All tested adhesive systems achieved excellent results after 1 year of clinical service.

Clinical evaluation of two bleaching regimens

Objectives Evaluate the color regression, postoperative sensitivity, and patient's satisfaction after bleaching with different regimens over a period of 1 year clinical service. Participants and methods Twenty highly educated adolescents (age range: 18–25 years) seeking for better esthetics were enrolled into the study. Their teeth shade was A3 or darker. Participants were enrolled in a split mouth study design divided into four groups according to bleaching materials and/or desensitizer used. Groupgroup I: right mandibular anterior teeth will receive over-the-counter (OTC) bleaching material followed by desensitizer application. Group II: left mandibular anterior teeth will receive OTC bleaching material. Group III: right maxillary anterior teeth will receive in-office bleaching material followed by desensitizer usage. Group IV: left maxillary anterior teeth will receive in-office bleaching material. The color change, teeth sensitivity and patient's satisfaction were recorded along the evaluation periods at baseline, before any treatment, directly after bleaching, and in 3 months intervals for a year postoperatively. Results One-way repeated measure analysis of variance test was performed to investigate the effect of time on the color change for each tested group. A highly significant difference was recorded regarding the color change for all tested groups with P value equals 0.000. Considerable postoperative sensitivity was recorded in 13.3, 36.7, 1.7, and 30% for group I, II, III, IV, respectively. Treatments were generally well-tolerated, a percentage of zero (n = 0) patient terminated the treatment prematurely. There was no postoperative hypersensitivity at any tooth after 3, 6, 9, and 12 months evaluation periods. Additionally, after 1 year evaluation periods, five (25%) patients recorded moderately satisfaction, nine (45%) patients were satisfied, and six (30%) patients were extremely satisfied with their teeth color. Conclusion and recommendations The degree of whitening is superior in the power bleaching compared with the OTC bleaching technique. The higher incidence of tooth sensitivity was found in teeth bleached using OTC technique. It is recommended that over-the-counter products should be used under strict manufacturer's directions.

Effect of home bleaching on surface of zinc phosphate cement: A scanning electron microscopic study.

The effect of home bleaching on surfaces of dental cements is controversial. The aim of this study was to microscopically evaluate and compare the effect of different concentrations of carbamide peroxide (CP) home bleaching agents on the surface of zinc phosphate cement. Forty 10 mm × 2 mm specimens of zinc phosphate cement were prepared following the manufacturer's directions. All specimens were immersed in artificial saliva at 37°C for 24 h. The specimens were equally divided into four groups (n = 10). One control group received no CP bleaching. Three experimental groups were exposed to 10%, 16%, and 22% of CP home bleaching agents. The bleaching agents were applied daily for 4 h for 14 days. Specimens were stored in artificial saliva at 37°C for 24 h and then examined under a scanning electron microscope. The surface micromorphology of the specimens was carefully evaluated and compared. The zinc oxide particles in the specimens of the control group were tightly packed with well-defined plate-like crystals. When specimens were exposed to 10% CP gels, the particles became flat and irregular with few areas of eroded matrix. When 16% CP gel was used, the crystals became flatter and irregular with rounded edges. Bleaching with 22% CP gel showed little more erosion of the surface of the matrix of the cement. Fewer flat and irregular crystals were observed on the surface of the cement. At-home bleaching using 10%, 16%, and 22% CP may be safely used in the presence of zinc phosphate-luted crown restorations without adverse effects.

Influence of curing protocol and ceramic composition on the degree of conversion of resin cement.

Due to increasing of aesthetic demand, ceramic crowns are widely used in different situations. However, to obtain long-term prognosis of restorations, a good conversion of resin cement is necessary.Objective:To evaluate the degree of conversion (DC) of one light-cure and two dual-cure resin cements under a simulated clinical cementation of ceramic crowns.Material and Methods:Prepared teeth were randomly split according to the ceramic's material, resin cement and curing protocol. The crowns were cemented as per manufacturer's directions and photoactivated either from occlusal suface only for 60 s; or from the buccal, occlusal and lingual surfaces, with an exposure time of 20 s on each aspect. After cementation, the specimens were stored in deionized water at 37°C for 7 days. Specimens were transversally sectioned from occlusal to cervical surfaces and the DC was determined along the cement line with three measurements taken and averaged from the buccal, lingual and approximal aspects using micro-Raman spectroscopy (Alpha 300R/WITec®). Data were analyzed by 3-way ANOVA and Tukey test at =5%.Results:Statistical analysis showed significant differences among cements, curing protocols and ceramic type (p<0.001). The curing protocol 3x20 resulted in higher DC for all tested conditions; lower DC was observed for Zr ceramic crowns; Duolink resin cement culminated in higher DC regardless ceramic composition and curing protocol.Conclusion:The DC of resin cement layers was dependent on the curing protocol and type of ceramic.

Forced-Air Warmers and Surgical Site Infections in Patients Undergoing Knee or Hip Arthroplasty.

The majority of the evidence indicates preventing inadvertent perioperative hypothermia reduces the incidence of many perioperative complications. Among the results of inadvertent perioperative hypothermia are increased bleeding, myocardial events, impaired wound healing, and diminished renal function. Most researchers agree there is an increased incidence of surgical site infections in patients who experience inadvertent perioperative hypothermia. Forced-air warming is effective in preventing inadvertent perioperative hypothermia. Paradoxically, forced-air warmers have been implicated in causing surgical site infections in patients undergoing total knee or hip arthroplasty. The results of investigations suggest these devices harbor pathogens and cause unwanted airflow disturbances. However, no significant increases in bacterial counts were found when forced-air warmers were used according to the manufacturer's directions. The results of one study suggested the incidence of surgical site infections in patients undergoing total joint arthroplasty was increased when using a forced-air warmer. However these researchers did not control for other factors affecting the incidence of surgical site infections in these patients. Current evidence does not support forced-air warmers causing surgical site infections in patients undergoing total knee or hip arthroplasty. Clinicians must use and maintain these devices as per the manufacturer's directions. They may consider using alternative warming methods. Well-conducted studies are needed to help determine the role of forced-air warmers in causing infections in these patients.