Major Immediate-early Gene Research Articles

All IEGs Are Not Created Equal-Molecular Sorting Within the Memory Engram.

When neurons are recruited to form the memory engram, they are driven to activate the expression of a series of immediate-early genes (IEGs). While these IEGs have been used relatively indiscriminately to identify the so-called engram neurons, recent research has demonstrated that different IEG ensembles can be physically and functionally distinct within the memory engram. This inherent heterogeneity of the memory engram is driven by the diversity in the functions and distributions of different IEGs. This process, which we call molecular sorting, is analogous to sorting the entire population of engram neurons into different sub-engrams molecularly defined by different IEGs. In this chapter, we will describe the molecular sorting process by systematically reviewing published work on engram ensemble cells defined by the following four major IEGs: Fos, Npas4, Arc, and Egr1. By comparing and contrasting these likely different components of the memory engram, we hope to gain a better understanding of the logic and significance behind the molecular sorting process for memory functions.

Repression of the major immediate early promoter of human cytomegalovirus allows transcription from an alternate promoter.

Following infection, the human cytomegalovirus (HCMV) genome becomes rapidly associated with host histones which can contribute to the regulation of viral gene expression. This can be seen clearly during HCMV latency where silencing of the major immediate early promoter (MIEP), normally responsible for expression of the key lytic proteins IE72 and IE86, is mediated by histone methylation and recruitment of heterochromatin protein 1. Crucially, reversal of these histone modifications coupled with histone acetylation drives viral reactivation which can be blocked with specific histone acetyltransferase inhibitors (HATi). In lytic infection, a role for HATi is less clear despite the well-established enhancement of viral replication observed with histone deacetylase inhibitors. Here we report that a number of different broad-acting HATi have a minor impact on viral infection and replication during lytic infection with the more overt phenotypes observed at lower multiplicities of infection. However, specific analyses of the regulation of major immediate early (MIE) gene expression reveal that the HATi C646, which targets p300/CBP, transiently repressed MIE gene expression via inhibition of the MIEP but by 24 h post-infection MIE gene expression was rescued due to compensatory activation of an alternative IE promoter, ip2. This suggested that silencing of the MIEP promoted alternative ip2 promoter activity in lytic infection and, consistent with this, ip2 transcription is impaired in cells infected with a recombinant HCMV that does not auto-repress the MIEP at late times of infection. Furthermore, inhibition of the histone methyltransferases known to be responsible for auto-repression is similarly inhibitory to ip2 transcription in wild-type infected cells. We also observe that these discrete transcriptional activities of the MIEP and ip2 promoter are also reflected in reactivation; essentially in cells where the MIEP is silenced, ip2 activity is easier to detect at very early times post-reactivation whereas in cells where robust activation of the MIEP is observed ip2 transcription is reduced or delayed. Finally, we observe that inhibition of pathways demonstrated to be important for reactivation of HCMV in dendritic cells, e.g. in response to IL-6, are preferentially important for activation of the MIEP and not the ip2 promoter. Together, these data add to the hypothesis that the existence of multiple promoters within the MIE region of HCMV can drive reactivation in a cell type- and ligand-specific manner and also suggest that inter-dependent regulatory activity between the two promoters exists.

351 Loop-mediated isothermal amplification for the detection of cytomegalovirus infection and drug resistance at the point of care

OBJECTIVES/GOALS: To develop a loop-mediated isothermal amplification (LAMP) assay for the detection of cytomegalovirus (CMV) infection and drug resistance. METHODS/STUDY POPULATION: We designed core and loop primers sets utilizing the NEB LAMP Primer Design Tool. Each set contained four or six primers targeting major-immediate early genes – essential for viral entry/replication – or regions known to confer resistance to the antiviral drug ganciclovir. Optimization of reactions conditions was achieved employing DNA reference materials. Reactions were visualized through a change in color as amplification reactions accumulated. Successful reaction conditions were selected based on specific amplification products in less than 60 minutes. Limits of detection were evaluated as the main performance outcome. RESULTS/ANTICIPATED RESULTS: Genomic data were extracted and used to design a series of LAMP primers (48 total) that aimed to detect specific genomic regions of CMV. Using this strategy, we successfully designed and identified eight primer sets that showed high 100% sensitivity and 100 % specificity, when detecting > 1.00 x 10^5 copies/mL of CMV gDNA. We are in the process of characterizing a new set of primers to determine the diagnostic utility of a LAMP assay in detecting selected single-nucleotide mutations at the UL97 loci. The expected outcomes at completion include: (1) the identification of LAMP primers to detect drug-resistance mutants, (2) defining optimal conditions for successful reactions, and (3) determining limits of detection for subsequent validation with clinical specimens. DISCUSSION/SIGNIFICANCE: CMV infection remains one of the most dangerous infectious agents for immunocompromised hosts, newborns, and unborn children. This study will describe a proof-of-concept LAMP assay for the genotypic detection of drug resistance in CMV-infected individuals and hence, create new avenues for selection of effective therapies to treat CMV disease.

Virus-induced FoxO factor facilitates replication of human cytomegalovirus.

Recently, it was reported that the forkhead box O (FoxO) transcription factor promotes human cytomegalovirus (HCMV) replication via direct binding to the promoters of the major immediate-early (MIE) genes, but how the FoxO factor impacts HCMV replication remains unknown. Here, it is reported that FoxO1 expression is strongly induced by HCMV infection in cells of fibroblast origin. Suppression of the FoxO1 gene by specific RNA interference significantly inhibited HCMV growth and replication, but viral DNA synthesis was not affected considerably. Interestingly, depletion or overexpression of FoxO1 had a significant effect on the expression of viral early/late transcripts. FoxO1 was found to colocalize with the pUL44 protein subunit of viral replication compartments without direct association with DNA. This study highlights how FoxO enhances HCMV gene transcription and viral replication to promote infection.

Control of Immediate Early Gene Expression for Human Cytomegalovirus Reactivation.

Human cytomegalovirus (HCMV) is a beta herpesvirus that persists for life in the majority of the world's population. The persistence of HCMV in the human population is due to the exquisite ability of herpesviruses to establish a latent infection that evades elimination by the host immune response. How the virus moves into and out of the latent state has been an intense area of research focus and debate. The prevailing paradigm is that the major immediate early promoter (MIEP), which drives robust expression of the major immediate early (MIE) transactivators, is epigenetically silenced during the establishment of latency, and must be reactivated for the virus to exit latency and re-enter productive replication. While it is clear that the MIEP is silenced by the association of repressive chromatin remodeling factors and histone marks, the mechanisms by which HCMV de-represses MIE gene expression for reactivation are less well understood. We have identified alternative promoter elements within the MIE locus that drive a second or delayed phase of MIE gene expression during productive infection. In the context of reactivation in THP-1 macrophages and primary CD34+ human progenitor cells, MIE transcripts are predominantly derived from initiation at these alternative promoters. Here we review the mechanisms by which alternative viral promoters might tailor the control of viral gene expression and the corresponding pattern of infection to specific cell types. Alternative promoter control of the HCMV MIE locus increases versatility in the system and allows the virus to tightly repress viral gene expression for latency but retain the ability to sense and respond to cell type-specific host cues for reactivation of replication.

Bright and Early: Inhibiting Human Cytomegalovirus by Targeting Major Immediate-Early Gene Expression or Protein Function.

The human cytomegalovirus (HCMV), one of eight human herpesviruses, establishes lifelong latent infections in most people worldwide. Primary or reactivated HCMV infections cause severe disease in immunosuppressed patients and congenital defects in children. There is no vaccine for HCMV, and the currently approved antivirals come with major limitations. Most approved HCMV antivirals target late molecular processes in the viral replication cycle including DNA replication and packaging. “Bright and early” events in HCMV infection have not been exploited for systemic prevention or treatment of disease. Initiation of HCMV replication depends on transcription from the viral major immediate-early (IE) gene. Alternative transcripts produced from this gene give rise to the IE1 and IE2 families of viral proteins, which localize to the host cell nucleus. The IE1 and IE2 proteins are believed to control all subsequent early and late events in HCMV replication, including reactivation from latency, in part by antagonizing intrinsic and innate immune responses. Here we provide an update on the regulation of major IE gene expression and the functions of IE1 and IE2 proteins. We will relate this insight to experimental approaches that target IE gene expression or protein function via molecular gene silencing and editing or small chemical inhibitors.

SAMHD1 Modulates Early Steps during Human Cytomegalovirus Infection by Limiting NF-κB Activation

Cellular SAMHD1 inhibits replication of many viruses by limiting intracellular deoxynucleoside triphosphate (dNTP) pools. We investigate the influence of SAMHD1 on human cytomegalovirus (HCMV). During HCMV infection, we observe SAMHD1 induction, accompanied by phosphorylation via viral kinase UL97. SAMHD1 depletion increases HCMV replication in permissive fibroblasts and conditionally permissive myeloid cells. We show this is due to enhanced gene expression from the major immediate-early (MIE) promoter and is independent of dNTP levels. SAMHD1 suppresses innate immune responses by inhibiting nuclear factor κB (NF-κB) activation. We show that SAMHD1 regulates the HCMV MIE promoter through NF-κB activation. Chromatin immunoprecipitation reveals increased RELA and RNA polymerase II on the HCMV MIE promoter in the absence of SAMHD1. Our studies reveal a mechanism of HCMV virus restriction by SAMHD1 and show how SAMHD1 deficiency activates an innate immune pathway that paradoxically results in increased viral replication through transcriptional activation of the HCMV MIE gene promoter.

Transcripts expressed in cytomegalovirus latency coding for an antigenic IE/E phase peptide that drives "memory inflation".

Roizman's definition of herpesviral latency, which applies also to cytomegaloviruses (CMVs), demands maintenance of reactivation-competent viral genomes after clearance of productive infection. It is more recent understanding that failure to complete the productive viral cycle for virus assembly and release does not imply viral gene silencing at all genetic loci and all the time. It rather appears that CMV latency is transcriptionally "noisy" in that silenced viral genes get desilenced from time to time in a stochastic manner, leading to "transcripts expressed in latency" (TELs). If a TEL happens to code for a protein that contains a CD8 T cell epitope, protein processing can lead to the presentation of the antigenic peptide and restimulation of cognate CD8 T cells during latency. This mechanism is discussed as a potential driver of epitope-selective accumulation of CD8 T cells over time, a phenomenon linked to CMV latency and known as "memory inflation" (MI). So far, expression of an epitope-encoding TEL was shown only for the major immediate-early (MIE) gene m123/ie1 of murine cytomegalovirus (mCMV), which codes for the prototypic MI-driving antigenic peptide YPHFMPTNL that is presented by the MHC class-I molecule Ld. The only known second MI-driving antigenic peptide of mCMV in the murine MHC haplotype H-2d is AGPPRYSRI presented by the MHC-I molecule Dd. This peptide is very special in that it is encoded by the early (E) phase gene m164 and by an overlapping immediate-early (IE) transcript governed by a promoter upstream of m164. If MI is driven by presentation of TEL-derived antigenic peptides, as the hypothesis says, one should find corresponding TELs. We show here that E-phase and IE-phase transcripts that code for the MI-driving antigenic peptide AGPPRYSRI are independently and stochastically expressed in latently infected lungs.

Two Polypyrimidine Tracts in Intron 4 of the Major Immediate Early Gene Are Critical for Gene Expression Switching from IE1 to IE2 and for Replication of Human Cytomegalovirus.

The human cytomegalovirus (HCMV) major immediate early (MIE) gene is essential for viral replication. The most abundant products encoded by the MIE gene include IE1 and IE2. Genes of IE1 and IE2 share the MIE promoter (MIEP), the first 3 exons, and the first 2 introns. IE1 is expressed earlier than IE2 after CMV infection or MIE gene transfection. In this study, we identified 2 polypyrimidine (Py) tracts in intron 4 (between exons 4 and 5) that are responsible for transcriptional switching from IE1 to IE2. The first Py is important and the second one is essential for the splicing and expression of IE2. In searching for the mechanisms of MIE gene switching from IE1 to IE2, we found that the second Py was required for the IE2's fourth intron to bind to a splicing factor such as U2AF65, as determined by an RNA electrophoretic mobility shift assay and a chromatin immunoprecipitation (ChIP) assay, while the first Py enhanced the binding of U2AF65 with the intron. An HCMV BACmid with the second Py mutated failed to produce any virus, while the HCMV with the first Py mutated replicated with a defective phenotype. Furthermore, we designed a small RNA (scRNAPy) that is complementary to the intron RNA covering the two Pys. The scRNAPy interfered with the interaction of U2AF65 with the intron and repressed the IE2 expression. Therefore, our studies implied that IE2 gene splicing might be an anti-CMV target. CMV is a ubiquitous herpesvirus and a significant cause of disease and death in the immunocompromised and elderly. Insights into its gene regulation will provide clues in designing anti-CMV strategies. The MIE gene is one of the earliest genes of CMV and is essential for CMV replication. It is known that the MIE gene needs to be spliced to produce more than two proteins; however, how MIE gene splicing is regulated remains elusive. In the present studies, we identified two Pys in intron 4 and found that the first Py is important and the second is required for the splicing and expression of IE2. We further investigated the mechanisms of gene switching from IE1 to IE2 and found that the two Pys are responsible for U2AF65's binding with intron 4. Therefore, the Pys in intron 4 are the cis elements that determine the fate of IE2 splicing. Furthermore, we found that a small RNA that is complementary to intron 4 repressed IE2 expression. Hence, we provide the first piece of evidence for a unique mechanism of MIE gene regulation at the splicing level.

Association of GATA2 Deficiency With Severe Primary Epstein-Barr Virus (EBV) Infection and EBV-associated Cancers.

Most patients infected with Epstein-Barr virus (EBV) are asymptomatic, have nonspecific symptoms, or have self-limiting infectious mononucleosis. EBV, however, may result in severe primary disease or cancer. We report EBV diseases associated with GATA2 deficiency at one institution and describe the hematology, virology, and cytokine findings. Seven patients with GATA2 deficiency developed severe EBV disease. Three presented with EBV infectious mononucleosis requiring hospitalization, 1 had chronic active EBV disease (B-cell type), 1 had EBV-associated hydroa vacciniforme-like lymphoma with hemophagocytic lymphohistiocytosis, and 2 had EBV-positive smooth muscle tumors. Four of the 7 patients had severe warts and 3 had disseminated nontuberculous mycobacterial infections. All of the patients had low numbers of monocytes, B cells, CD4 T cells, and natural killer cells. All had elevated levels of EBV in the blood; 2 of 3 patients tested had expression of the EBV major immediate-early gene in the blood indicative of active EBV lytic infection. Mean plasma levels of tumor necrosis factor α, interferon γ, and interferon gamma-induced protein 10 were higher in patients with GATA2 deficiency than in controls. GATA2 is the first gene associated with EBV hydroa vacciniforme-like lymphoma. GATA2 deficiency should be considered in patients with severe primary EBV infection or EBV-associated cancer, especially in those with disseminated nontuberculous mycobacterial disease and warts.

EBV reactivation as a target of luteolin to repress NPC tumorigenesis.

Nasopharyngeal carcinoma (NPC) is a malignancy derived from the epithelial cells of the nasopharynx. Although a combination of radiotherapy with chemotherapy is effective for therapy, relapse and metastasis after remission remain major causes of mortality. Epstein-Barr virus (EBV) is believed to be one of causes of NPC development. We demonstrated previously that EBV reactivation is important for the carcinogenesis of NPC. We sought, therefore, to determine whether EBV reactivation can be a target for retardation of relapse of NPC. After screening, we found luteolin is able to inhibit EBV reactivation. It inhibited EBV lytic protein expression and repressed the promoter activities of two major immediate-early genes, Zta and Rta. Furthermore, luteolin was shown to reduce genomic instability induced by recurrent EBV reactivation in NPC cells. EBV reactivation-induced NPC cell proliferation and migration, as well as matrigel invasiveness, were also repressed by luteolin treatment. Tumorigenicity in mice, induced by EBV reactivation, was decreased profoundly following luteolin administration. Together, these results suggest that inhibition of EBV reactivation is a novel approach to prevent the relapse of NPC.

Differentiation-Coupled Induction of Human Cytomegalovirus Replication by Union of the Major Enhancer Retinoic Acid, Cyclic AMP, and NF-κB Response Elements.

ABSTRACTTriggers and regulatory pathways that effectively link human cytomegalovirus (HCMV) major immediate early (MIE) latent-lytic switch activation with progeny production are incompletely understood. In the quiescently infected human NTera2 cell model of primitive neural stem cells, we found that costimulation with vasoactive intestinal peptide (V) and phorbol ester (P) synergistically activated viral infection, but this effect waned over time. Coupling retinoic acid (R), an inducer of neuronal differentiation, to VP pulse stimulation attenuated the decline in viral activity and promoted the spread of the active infection through concentric layers of neighboring cells as cellular differentiation progressed. R stimulation alone was unable to activate the infection. The MIE enhancer cis-regulatory mechanisms responsible for this result were characterized by a strategy of combinatorial mutagenesis of five cis-acting element types (retinoic acid receptor binding elements [RARE], cyclic AMP [cAMP] response elements [CRE], NF-κB binding sites [kB], serum response element, and ETS/ELK-1 binding site) and multiple methods of assessment. We found that the CRE and kB combination sets the preinduction enhancer tone, is the major initiator and amplifier of RVP-induced MIE gene expression, and cooperates with RARE during cellular differentiation to enhance viral spread. In predifferentiated NTera2, we also found that the CRE-kB combination functions as initiator and amplifier of unstimulated HCMV MIE gene expression and cooperatively interacts with RARE to enhance viral spread. We conclude that RVP-stimulated signaling cascades and cellular differentiation operate through the enhancer CRE-kB-RARE core in strengthening induction of HCMV MIE gene expression in linkage with viral propagation.IMPORTANCE Cytomegalovirus-seropositive persons commonly lack detectable levels of cytomegalovirus replication, even when profoundly immunocompromised. In a human NTera2 cell model of primitive neural stem cells carrying resting cytomegalovirus genomes, we show that costimulation of protein kinase A and C-delta signaling cascades in conjunction with retinoic acid-induced neuronal differentiation brings about progeny virus propagation. Iterated DNA binding sites for retinoic acid receptor, CREB, and NF-κB family members in the cytomegalovirus major enhancer are at the crux in the pathway to HCMV activation. The stimulated CREB and NF-κB binding site combination vigorously initiates and amplifies the active cytomegalovirus infection and cooperates with activated retinoic acid receptor binding sites to further promote viral proliferation and spread between differentiated cells. These results support a paradigm in which a specific combination of stimuli coupled with cellular differentiation satisfies a core cis-activating code that unlocks enhancer silence to repower the cycle of cytomegalovirus propagation.

Glucocorticoids facilitate the transcription from the human cytomegalovirus major immediate early promoter in glucocorticoid receptor- and nuclear factor-I-like protein-dependent manner

Human cytomegalovirus (HCMV) is a common and usually asymptomatic virus agent in healthy individuals. Initiation of HCMV productive infection depends on expression of the major immediate early (MIE) genes. The transcription of HCMV MIE genes is regulated by a diverse set of transcription factors. It was previously reported that productive HCMV infection is triggered probably by elevation of the plasma hydroxycorticoid level. However, it is poorly understood whether the transcription of MIE genes is directly regulated by glucocorticoid. Here, we found that the dexamethasone (DEX), a synthetic glucocorticoid, facilitates the transcription of HCMV MIE genes through the MIE promoter and enhancer in a glucocorticoid receptor (GR)-dependent manner. By competitive EMSA and reporter assays, we revealed that an NF-I like protein is involved in DEX-mediated transcriptional activation of the MIE promoter. Thus, this study supports a notion that the increased level of hydroxycorticoid in the third trimester of pregnancy reactivates HCMV virus production from the latent state.

Molecular biology of KSHV lytic reactivation.

Kaposi’s sarcoma-associated herpesvirus (KSHV) primarily persists as a latent episome in infected cells. During latent infection, only a limited number of viral genes are expressed that help to maintain the viral episome and prevent lytic reactivation. The latent KSHV genome persists as a highly ordered chromatin structure with bivalent chromatin marks at the promoter-regulatory region of the major immediate-early gene promoter. Various stimuli can induce chromatin modifications to an active euchromatic epigenetic mark, leading to the expression of genes required for the transition from the latent to the lytic phase of KSHV life cycle. Enhanced replication and transcription activator (RTA) gene expression triggers a cascade of events, resulting in the modulation of various cellular pathways to support viral DNA synthesis. RTA also binds to the origin of lytic DNA replication to recruit viral, as well as cellular, proteins for the initiation of the lytic DNA replication of KSHV. In this review we will discuss some of the pivotal genetic and epigenetic factors that control KSHV reactivation from the transcriptionally restricted latent program.

Development of a high-content screen for the identification of inhibitors directed against the early steps of the cytomegalovirus infectious cycle

Human cytomegalovirus (CMV) is a latent and persistent virus whose proliferation increases morbidity and mortality of immune-compromised individuals. The current anti-CMV therapeutics targeting the viral DNA polymerase or the major immediate-early (MIE) gene locus are somewhat effective at limiting CMV-associated disease. However, due to low bioavailability, severe toxicity, and the development of drug resistant CMV strains following prolonged treatment, current anti-CMV therapeutics are insufficient. To help address this shortfall, we established a high-content assay to identify inhibitors targeting CMV entry and the early steps of infection. The infection of primary human fibroblasts with a variant of the CMV laboratory strain AD169 expressing a chimeric IE2-yellow fluorescence protein (YFP) (AD169IE2-YFP) provided the basis for the high-content assay. The localization of IE2-YFP to the nucleus shortly following an AD169IE2-YFP infection induced a robust fluorescent signal that was quantified using confocal microscopy. The assay was optimized to achieve outstanding assay fitness and high Z’ scores. We then screened a bioactive chemical library consisting of 2080 compounds and identified hit compounds based on the decrease of fluorescence signal from IE2-YFP nuclear expression. The hit compounds likely target various cellular processes involved in the early steps of infection including capsid transport, chromatin remodeling, and viral gene expression. Extensive secondary assays confirmed the ability of a hit compound, convallatoxin, to inhibit infection of both laboratory and clinical CMV strains and limit virus proliferation. Collectively, the data demonstrate that we have established a robust high-content screen to identify compounds that limit the early steps of the CMV life cycle, and that novel inhibitors of early infection events may serve as viable CMV therapeutics.

CTCF binding to the first intron of the major immediate early (MIE) gene of human cytomegalovirus (HCMV) negatively regulates MIE gene expression and HCMV replication.

Human cytomegalovirus (HCMV) gene expression during infection is highly regulated, with sequential expression of immediate-early (IE), early (E), and late (L) gene transcripts. To explore the potential role of chromatin regulatory factors that may regulate HCMV gene expression and DNA replication, we investigated the interaction of HCMV with the cellular chromatin-organizing factor CTCF. Here, we show that HCMV-infected cells produce higher levels of CTCF mRNA and protein at early stages of infection. We also show that CTCF depletion by short hairpin RNA results in an increase in major IE (MIE) and E gene expression and an about 50-fold increase in HCMV particle production. We identified a DNA sequence (TTAACGGTGGAGGGCAGTGT) in the first intron (intron A) of the MIE gene that interacts directly with CTCF. Deletion of this CTCF-binding site led to an increase in MIE gene expression in both transient-transfection and infection assays. Deletion of the CTCF-binding site in the HCMV bacterial artificial chromosome plasmid genome resulted in an about 10-fold increase in the rate of viral replication relative to either wild-type or revertant HCMV. The CTCF-binding site deletion had no detectable effect on MIE gene-splicing regulation, nor did CTCF knockdown or overexpression of CTCF alter the ratio of IE1 to IE2. Therefore, CTCF binds to DNA within the MIE gene at the position of the first intron to affect RNA polymerase II function during the early stages of viral transcription. Finally, the CTCF-binding sequence in CMV is evolutionarily conserved, as a similar sequence in murine CMV (MCMV) intron A was found to interact with CTCF and similarly function in the repression of MCMV MIE gene expression mediated by CTCF. Our findings that CTCF binds to intron A of the cytomegalovirus (CMV) major immediate-early (MIE) gene and functions to repress MIE gene expression and viral replication are highly significant. For the first time, a chromatin-organizing factor, CTCF, has been found to facilitate human CMV gene expression, which affects viral replication. We also identified a CTCF-binding motif in the first intron (also called intron A) that directly binds to CTCF and is required for CTCF to repress MIE gene expression. Finally, we show that the CTCF-binding motif is conserved in CMV because a similar DNA sequence was found in murine CMV (MCMV) that is required for CTCF to bind to MCMV MIE gene to repress MCMV MIE gene expression.

Inhibition of human cytomegalovirus replication by overexpression of CREB1

Expression of the human cytomegalovirus (HCMV) major immediate-early (MIE) genes is regulated by a strong enhancer-containing promoter with multiple binding sites for various transcription factors, including cyclic AMP response element binding protein 1 (CREB1). Here we show that overexpression of CREB1 potently blocked MIE transcription and HCMV replication. Surprisingly, CREB1 still exhibited strong inhibition of the MIE promoter when all five CREB binding sites within the enhancer were mutated, suggesting that CREB1 regulated the MIE gene expression indirectly. Promoter deletion analysis and site-directed mutagenesis identified the region between −130 and −50 upstream of the transcription start site of the MIE gene as the “CREB1 responsive region”. Mutations of SP1/3 and NF-κB binding sites within this region interrupted the inhibitory effect induced by CREB1 overexpression. Our findings suggest that overexpression of CREB1 can cause repression of HCMV replication and may contribute to the development of new anti-HCMV strategies.

Human Cytomegalovirus pp71 Stimulates Major Histocompatibility Complex Class I Presentation of IE1-Derived Peptides at Immediate Early Times of Infection

Suppression of major histocompatibility complex (MHC) class I-mediated presentation of human cytomegalovirus (HCMV) peptides is an important mechanism to avoid CD8 T lymphocyte recognition and killing of infected cells. Of particular interest is how MHC class I presentation of essential regulatory immediate early (IE) proteins of HCMV can be effectively compromised at times when known viral immunoevasins are not abundantly expressed. The tegument protein pp71 had been suggested to be involved in MHC class I downregulation. Intriguingly, this polypeptide is also critically engaged in the initial derepression of the major IE gene locus, leading to enhanced expression of IE proteins IE1-pp72 and IE2-pp86. Using a set of viral mutants, we addressed the role of pp71 in MHC class I presentation of IE1-pp72-derived peptides. We show that the amount of "incoming" pp71 positively correlates with IE1-pp72 protein levels and with the presentation of IE1-derived peptides. This indicates that the amount of the IE1 protein, induced by pp71, rather than a putative immunoevasive function of the tegument protein, determines MHC class I antigen presentation of IE1-derived peptides. This process proved to be independent of the presence of pp65, which had been reported to interfere with IE1 presentation. It may thus be beneficial for the success of HCMV replication to limit the level of pp71 delivered from infecting particles in order to avoid critical levels of MHC class I presentation of IE protein-derived peptides.

Inhibition of Inflammatory Interleukin-6 Activity via Extracellular Signal-Regulated Kinase–Mitogen-Activated Protein Kinase Signaling Antagonizes Human Cytomegalovirus Reactivation from Dendritic Cells

Human cytomegalovirus (HCMV) remains a major cause of viral disease in immunosuppressed transplant patients. The ability of HCMV to establish lifelong infection in humans and reactivate with devastating clinical consequences underscores the importance of understanding the triggers of HCMV reactivation in mature myeloid cells. Dendritic cell (DC) differentiation is concomitant with the activation of cellular signaling pathways and inflammatory gene expression and also HCMV reactivation. Here, we show a major role for interleukin-6 (IL-6) through extracellular signal-regulated kinase-mitogen-activated protein kinase (ERK-MAPK) signaling upon DC differentiation to promote HCMV reactivation. IL-6 drives reactivation by transcriptional upregulation of the major immediate-early (IE) genes, resulting in efficient progression of the virus life cycle and, ultimately, higher titers of infectious virus. Furthermore, the interception of IL-6 signaling with biological inhibitors significantly abrogated HCMV reactivation from experimental latency. Crucially, using cells derived from healthy seropositive donors, we observed a key role for IL-6 during reactivation from natural latency ex vivo in interstitial DCs. Clinically, HCMV reactivation occurs in highly inflammatory environments (i.e., transplantation); thus, the implications of this study could potentially provide novel approaches for therapeutic intervention.

Human cytomegalovirus infection causes degradation of Sp100 proteins that suppress viral gene expression.

The interferon-inducible Sp100 proteins are thought to play roles in the chromatin pathway and in transcriptional regulation. Sp100A, the smallest isoform, is one of the major components of PML nuclear bodies (NBs) that exhibit intrinsic antiviral activity against several viruses. Since PML NBs are disrupted by the immediate-early 1 (IE1) protein during human cytomegalovirus (HCMV) infection, the modulation of Sp100 protein expression or activity during infection has been suggested. Here, we show that Sp100 proteins are lost largely in the late stages of HCMV infection. This event required viral gene expression and involved posttranscriptional control. The mutant virus with deletion of the sequence for IE1 (CR208) did not have Sp100 loss. In CR208 infection, PML depletion by RNA interference abrogated the accumulation of SUMO-modified Sp100A and of certain high-molecular-weight Sp100 isoforms but did not significantly affect unmodified Sp100A, suggesting that the IE1-induced disruption of PML NBs is not sufficient for the complete loss of Sp100 proteins. Sp100A loss was found to require proteasome activity. Depletion of all Sp100 proteins by RNA silencing enhanced HCMV replication and major IE (MIE) gene expression. Sp100 knockdown enhanced the acetylation level of histones associated with the MIE promoter, demonstrating that the repressive effect of Sp100 proteins may involve, at least in part, the epigenetic control of the MIE promoter. Sp100A was found to interact directly with IE1 through the N-terminal dimerization domain. These findings indicate that the IE1-dependent loss of Sp100 proteins during HCMV infection may represent an important requirement for efficient viral growth.