Macrophage Inflammatory Protein Research Articles

The disrupted molecular circadian clock of monocytes and macrophages in allergic inflammation

IntroductionMacrophage dysfunction is a common feature of inflammatory disorders such as asthma, which is characterized by a strong circadian rhythm.Methods and resultsWe monitored the protein expression pattern of the molecular circadian clock in human peripheral blood monocytes from healthy, allergic, and asthmatic donors during a whole day. Monocytes cultured of these donors allowed us to examine circadian protein expression in human monocyte-derived macrophages, M1- and M2- polarized macrophages. In monocytes, particularly from allergic asthmatics, the oscillating expression of circadian proteins CLOCK, BMAL, REV ERBs, and RORs was significantly altered. Similar changes in BMAL1 were observed in polarized macrophages from allergic donors and in tissue-resident macrophages from activated precision cut lung slices. We confirmed clock modulating, anti-inflammatory, and lung-protective properties of the inverse ROR agonist SR1001 by reduced secretion of macrophage inflammatory protein and increase in phagocytosis. Using a house dust mite model, we verified the therapeutic effect of SR1001 in vivo.DiscussionOverall, our data suggest an interaction between the molecular circadian clock and monocytes/macrophages effector function in inflammatory lung diseases. The use of SR1001 leads to inflammatory resolution in vitro and in vivo and represents a promising clock-based therapeutic approach for chronic pulmonary diseases such as asthma.

Recent advances in stem cells therapy: efficacy, ethics, safety concerns and future directions focusing on neurodegenerative disorders- a review

Neurodegeneration refers to the gradual loss of neurons and extensive changes occur in glial cells like tau inclusions in astrocytes and oligodendrocytes, α-synuclein inclusions in oligodendrocytes and SOD1 aggregates in astrocytes along with deterioration in the motor, cognition, learning, and behaviour. Common neurodegenerative disorders are Alzheimer’s Disease (AD), Parkinson’s Disease (PD), Amyotrophic Lateral Sclerosis (ALS), Huntington’s disease (HD), Spinocerebellar Ataxia (SCAs), and Supranuclear palsy are some common one. There is a lack of effective treatment for neurodegenerative diseases, and scientists are putting their efforts into developing therapies against them. Stem cell therapy has emerged as a hope for neurodegenerative disorders since it is not only the damaged neurons that might be replaced, but other neuromodulators and neuroprotectors are secreted. Stem cell terminal differentiation before implantation ensures the implantation of correct cells and molecular markers like carbonic anhydrase II, CNPase (2′,3′-cyclic nucleotide 3′-phosphohydrolase), myelin basic protein (MBP), and myelin oligodendrocyte glycoprotein ​(MOG) elucidate the differentiation. Secretion of various growth factors like epidermal growth factor (EGF), keratinocyte growth factor (KGF), vascular endothelial growth factor-α (VEGF-α), transforming growth factor (TGF) and macrophage inflammatory protein (MIP) supports cell survival, cell proliferation, blood vessel formation, axon regeneration, and neuroglial functional connection formation at the site of degeneration. Adverse effects of stem cell therapy, like teratogenicity and differentiation in different cells other than the desired one under the influence of microenvironment, are a few key concerns. Post-transplantation improved synaptic plasticity, apoptosis inhibition, and reduction in tau-phosphorylation and Amyloid beta (Aβ) production has been observed in Alzheimer’s patients.A large number of experimental, preclinical, and clinical studies have been conducted, and encouraging results have been obtained. The present review exhaustively discusses various kinds of stem cells, their usage in treating neurodegenerative disorders, limitations and challenges, and ethical issues related to stem cell therapy.

Modulation of cytokine response in post-cardiac arrest syndrome through prehospital high-dose glucocorticoid treatment

Abstract Funding Acknowledgements Type of funding sources: Foundation. Main funding source(s): Novo Nordisk Foundation Research Foundation of Rigshospitalet. Background Post-cardiac arrest syndrome (PCAS) following out-of-hospital cardiac arrest (OHCA) is a life-threatening condition, characterized by a cascade of pathological events, including the development of a severe cytokine response. This inflammatory response may be associated with secondary brain injury and multi-organ dysfunction. In the randomized STEROHCA trial, high-dose glucocorticoid was administered immediately following resuscitation in the prehospital setting. The intervention exhibited a significant decrease in interleukin (IL) 6 levels, but its effect on other cytokines has yet to be assessed. Purpose We aimed to investigate the effects of high-dose glucocorticoid treatment in mitigating the cytokine response observed in PCAS after OHCA. Methods The modified intention-to-treat population of the double-blind, randomized STEROHCA trial consisted of 137 OHCA patients, who were randomized to a single prehospital injection of methylprednisolone 250 mg or placebo. Of these, this sub-study included 112 patients who were comatose and admitted to an ICU. Cytokine profiling was performed with a 17-plex assay, including pro- and anti-inflammatory cytokines, which were measured at 0, 24, 48, and 72h after admission. We applied mixed-model analyses to assess the effect of the intervention over time with log-transformed data. To maintain an exploratory approach, we chose not to correct for multiple testing. Results The intervention induced a reduction in the levels of several cytokines, with a significant treatment over time effect for IL-4, IL-8, IL-10, Monocyte Chemoattractant Protein-1 (MCP-1), Macrophage Inflammatory Protein-1 Beta (MIP-1β), and Tumor Necrosis Factor Alpha (TNF-α), all p<0.01. These cytokines, except for IL-10, exhibited lower values in the glucocorticoid group after 24h, Figure 1. Higher levels of IL-10 were observed in the glucocorticoid group at 0h. We found no differences in cytokine levels after 48-, and 72h between the two groups. Conclusion High-dose glucocorticoid treatment administered promptly after resuscitation from OHCA reduced several pro-inflammatory cytokines after 24h. TNF-α has previously been associated with poor outcomes following OHCA, whereas the exact role of the other cytokines following OHCA is unclear.Cytokines at 0-, 24-, 48-, and 72 hours

Causal association between circulating inflammatory cytokines and intracranial aneurysm and subarachnoid hemorrhage.

The causal association between inflammatory cytokines and the development of intracranial aneurysm (IA), unruptured IA (uIA) and subarachnoid hemorrhage (SAH) lacks clarity. The summary-level datasets for inflammatory cytokines were extracted from a genome-wide association study of the Finnish Cardiovascular Risk in Young Adults Study and the FINRISK survey. The summary statistics datasets related to IA, uIA and SAH were obtained from the genome-wide association study meta-analysis of the International Stroke Genetics Consortium and FinnGen Consortium. The primary method employed for analysis was inverse variance weighting (false discovery rate), supplemented by sensitivity analyses to address pleiotropy and enhance robustness. In the International Stroke Genetics Consortium, 10, six and eight inflammatory cytokines exhibited a causal association with IA, uIA and SAH, respectively (false discovery rate, p < 0.05). In FinnGen datasets, macrophage Inflammatory Protein-1 Alpha (MIP_1A), MIP_1A and interferon γ-induced protein 10 (IP_10) were verified for IA, uIA and SAH, respectively. In the reverse Mendelian randomization analysis, the common cytokines altered by uIA and SAH were vascular endothelial growth factor (VEGF), MIP_1A, IL_9, IL_10 and IL_17, respectively. The meta-analysis results show that MIP_1A and IP_10 could be associated with the decreased risk of IA, and MIP_1A and IP_10 were associated with the decreased risk of uIA and SAH, respectively. Notably, the levels of VEGF, MIP_1A, IL_9, IL_10 and TNF_A were increased with uIA. Comprehensive heterogeneity and pleiotropy analyses confirmed the robustness of these results. Our study unveils a bidirectional association between inflammatory cytokines and IA, uIA and SAH. Further investigations are essential to validate their relationship and elucidate the underlying mechanisms.

Cognitive inflexibility and immunome biomarkers in children with autism spectrum disorder

Cognitive inflexibility is a transdiagnostic endophenotype that presents across a range of disorders, including autism spectrum disorder (ASD), which is maintained through adulthood, and encompasses both cognitive and behavioral rigidity. There is evidence for immune dysfunction in a subgroup of ASD, including systemic inflammation, cytokine dysregulation and anti-brain autoantibodies. Although immunome pathways are involved in ASD pathophysiology, there is little known about how they relate to symptom domains or symptom severity, and whether such biomarkers may be useful in optimizing future clinical trials. We correlated baseline clinical measures of cognitive inflexibility and resultant irritability with immunome biomarker levels in children with ASD, aged 5–18 years with ABC-I scores ≥18, CGI-S scores ≥4 and SRS-2 scores ≥66T, at Albert Einstein College of Medicine (AECOM). Non-parametric Spearman correlations and estimated multivariable regression analyses adjusting for potential confounders, including other clinical variables, race, sex, and age were completed. Strong positive correlations (rs > .70) were found between the Montefiore Einstein Rigidity Scale – Revised (MERS-R) Total Score and the pro-inflammatory cytokines IL-6 (rs=.80), granulocyte-colony stimulating factor (GCSF; rs =.72), macrophage inflammatory protein-1 alpha (MIP-1a; rs =.71). The MERS-R subscales also had moderate and strong correlations with the immunome biomarkers. The MERS-R Total Rigidity Subscale Score had a strong positive relationship with IL-6 (rs = 0.7856). Using multivariable regression analyses significant relationships were found between the MERS-R Total Rigidity Subscale Score and proinflammatory cytokine IL-18 (p = 0.02), and a nonsignificant trend was found between it and IFN-alpha2 (β = −4.982, p = 0.058). The ABC-I was significantly correlated with pro-inflammatory cytokine IL-18 (p = .013), IFN-alpha2 (p = 0.039), the anti-inflammatory cytokine IL-10 (p = 0.02), and adaptive immunity cytokine IL-2 (p = 0.041). This preliminary data is the first to examine the relationship of clinical measures of cognitive inflexibility and immunome biomarkers in children with ASD, and may provide a framework for better understanding the relationship between immunome mechanisms, cognitive inflexibility, and ASD symptomatology. Clinicaltrials.gov: NCT03202303.

Relation of cytokine profile and antibody values to post-translational protein modifications in patients with rheumatoid arthritis (preliminary data)

The aim of the study was to investigate the relationship between cytokine levels and values of antibodies to cyclic citrullinated peptide (anti-CCP) and antibodies to carbamylated proteins (anti-CarP) in patients with rheumatoid arthritis (RA). Materials and methods. 106 patients with a reliable diagnosis of rheumatoid arthritis were included in the study. Determination of anti-CarP and anti-CCP was performed by enzyme immunoassay. Patients were divided into subgroups depending on the values of anti-CCP and anti-CarP. The concentration of 27 cytokines in serum was determined using multiplex xMAR technology. Results and discussion. When comparing immunological subgroups, anti-CCP(+) patients had higher concentrations of interleukin (IL) 1β, IL-1Ra, IL-2, IL-6, IL-8, IL-10, IL-12, IL-13, IL-15, IL-17, fibroblast growth factor, granulocyte colony-stimulating factor (CSF), granulocyte-macrophage CSF, interferon (IFN) γ, IFN0γ-induced protein 10, monocyte chemoattractant protein 1, macrophage inflammatory protein 1α (MIP-1α), transforming growth factor bb, tumor necrosis factor α and vascular endothelial growth factor. IL-5, IL-9, eotaxin, MIP-1β and RANTES (regulated on activation, normal T cell expressed and secreted) values were higher in anti-CCP(–) patients. In the subgroup of anti-CCP(–) patients, an inverse correlation was found between IL-5 and total Sharpe score, between IL-9 and DAS28-CRP (Disease Activity Score with C-reactive protein calculation). In anti-Carp(–) patients (n=73) higher values of IL-17 were recorded. Conclusion. Our data support the concept of RA heterogeneity, characterised by the existence of different clinical and immunological subtypes, which may have implications for improving personalised therapy.

Plasma IGFBP-3 and IGFBP-5 levels are decreased during acute manic episodes in bipolar disorder patients.

Introduction: Bipolar disorder (BD) is a recurrent and disabling psychiatric disorder related to low-grade peripheral inflammation and altered levels of the members of the insulin-like growth factor (IGF) family. The aim of this study was to evaluate the plasma levels of IGF-2, insulin-like growth factor-binding protein 1 (IGFBP-1), IGFBP-3, IGFBP-5, IGFBP-7, and inflammatory markers such as tumor necrosis factor α (TNF-α), monocyte chemoattractant protein 1 (MCP-1), and macrophage inflammatory protein 1β (MIP-1β). Methods: We used the Young Mania Rating Scale (YMRS) to determine the severity of the symptomatology, while proteins were measured by enzyme-linked immunosorbent assay (ELISA). We included 20 patients with BD who suffered a manic episode and 20 controls. Some BD patients (n = 10) were evaluated after a period (17 ± 8days) of pharmacological treatment. Results: No statistical difference was found in IGF-2, IGFBP-1, IGFBP-7, TNF-α, and MIP-1β levels. However, IGFBP-3 and IGFBP-5 levels were found to be statistically decreased in BD patients. Conversely, the MCP-1 level was significantly increased in BD patients, but their levels were normalized after treatment. Intriguingly, only IGFBP-1 levels were significantly decreased after treatment. No significant correlation was found between the YMRS and any of the proteins studied either before or after treatment or between IGF proteins and inflammatory markers. Discussion: To some extent, IGFBP-3 and IGFBP-5 might be further explored as potential indicators of treatment responsiveness or diagnosis biomarkers in BD.

TSPO deficiency exacerbates acute lung injury via NLRP3 inflammasome-mediated pyroptosis.

Acute respiratory distress syndrome (ARDS) is a common cause of respiratory failure in many critically disease patients. Although inflammasome activation plays an important role in the induction of acute lung injury (ALI) and ARDS, the regulatory mechanism of this process is still unclear. When cells are stimulated by inflammation, the integrity and physiological function of mitochondria play a crucial part in pyroptosis. However, the underlying mechanisms and function of mitochondrial proteins in the process of pyroptosis are largely not yet known. Here, we identified the 18-kDa translocator protein (TSPO), a mitochondrial outer membrane protein, as an important mediator regulating nucleotide-binding domain, leucine-rich repeat, and pyrin domain-containing protein 3 (NLRP3) inflammasome activation in macrophages during ALI. TSPO gene knockout (KO) and lipopolysaccharide (LPS)-induced ALI/ARDS mouse models were employed to investigate the biological role of TSPO in the pathogenesis of ARDS. Murine macrophages were used to further characterize the effect of TSPO on the NLRP3 inflammasome pathway. Activation of NLRP3 inflammasome through LPS+adenosine triphosphate (ATP) co-stimulation, followed by detection of mitochondrial membrane potential, reactive oxygen species (ROS) production, and cell death was preformed to evaluate the potential biological function of TSPO. Comparisons between two groups were performed with a two-sided unpaired t-test. TSPO-KO mice exhibited more severe pulmonary inflammation in response to LPS-induced ALI. TSPO deficiency resulted in enhanced activation of the NLRP3 inflammasome pathway, promoting more proinflammatory cytokine production of macrophages in LPS-injured lung tissue, including interleukin (IL)-1β, IL-18, and macrophage inflammatory protein (MIP)-2. Mitochondria in TSPO-KO macrophages tended to depolarize in response to cellular stress. The increased production of mitochondrial damage-associated molecular pattern (mtDAMP) led to enhanced mitochondrial membrane depolarization and pyroptosis in TSPO-KO cells. TSPO may be the key regulatory of cellular pyroptosis, it plays a vital protective role in ARDS occurrence and development.

Exosomes derived from vMIP-II-Lamp2b gene-modified M2 cells provide neuroprotection by targeting the injured spinal cord, inhibiting chemokine signals and modulating microglia/macrophage polarization in mice

Inflammation is one of the key injury factors for spinal cord injury (SCI). Exosomes (Exos) derived from M2 macrophages have been shown to inhibit inflammation and be beneficial in SCI animal models. However, lacking targetability restricts their application prospects. Considering that chemokine receptors increase dramatically after SCI, viral macrophage inflammatory protein II (vMIP-II) is a broad-spectrum chemokine receptor binding peptide, and lysosomal associated membrane protein 2b (Lamp2b) is the key membrane component of Exos, we speculated that vMIP-II-Lamp2b gene-modified M2 macrophage-derived Exos (vMIP-II-Lamp2b-M2-Exo) not only have anti-inflammatory properties, but also can target the injured area by vMIP-II. In this study, using a murine contusive SCI model, we revealed that vMIP-II-Lamp2b-M2-Exo could target the chemokine receptors which highly expressed in the injured spinal cords, inhibit some key chemokine receptor signaling pathways (such as MAPK and Akt), further inhibit proinflammatory factors (such as IL-1β, IL-6, IL-17, IL-18, TNF-α, and iNOS), and promote anti-inflammatory factors (such as IL-4 and Arg1) productions, and the transformation of microglia/macrophages from M1 into M2. Moreover, the improved histological and functional recoveries were also found. Collectively, our results suggest that vMIP-II-Lamp2b-M2-Exo may provide neuroprotection by targeting the injured spinal cord, inhibiting some chemokine signals, reducing proinflammatory factor production and modulating microglia/macrophage polarization.

Exploring causal correlations between inflammatory cytokines and knee osteoarthritis: a two-sample Mendelian randomization.

Knee osteoarthritis (KOA) and certain inflammatory cytokines (such as interleukin 1 [IL-1] and tumor necrosis factor alpha [TNF-a]) are related; however, the causal relationship remains unclear. Here, we aimed to assess the causal relationship between 41 inflammatory cytokines and KOA using Mendelian randomization (MR). Two-sample bidirectional MR was performed using genetic variation data for 41 inflammatory cytokines that were obtained from European Genome-Wide Association Study (GWAS) data (n=8293). KOA-related genetic association data were also obtained from European GWAS data (n=40,3124). Inverse variance weighting (IVW), MR, heterogeneity, sensitivity, and multiple validation analyses were performed. Granulocyte colony-stimulating factor (G-CSF) or colony-stimulating factor 3 (CSF-3) levels were negatively associated with the risk of developing KOA (OR: 0.93, 95%CI:0.89-0.99, P=0.015). Additionally, macrophage inflammatory protein-1 alpha (MIP-1A/CCL3) was a consequence of KOA (OR: 0.72, 95%CI:0.54-0.97, P=0.032). No causal relationship was evident between other inflammatory cytokines and KOA development. This study suggests that certain inflammatory cytokines may be associated with KOA etiology. G-CSF exerts an upstream influence on KOA development, whereas MIP-1A (CCL-3) acts as a downstream factor.

Optimizing a five-factor cocktail to prepare reparative macrophages for wound healing.

The treatment of non-healing wounds, such as diabetic ulcers, remains a critical clinical challenge. Recent breakthroughs in cell therapy have shown great promise, with one primary focus on preparing cells with comprehensive reparative functions and foreseeable safety. In our previous study, we recapitulated the pro-regenerative and immunosuppressive functions of tumor-associated macrophages (TAMs) in non-tumor-derived macrophages, endowing the latter with characteristics for promoting diabetic wound healing - termed TAMs-educated macrophages (TAMEMs). To eliminate the use of tumor-derived sources and devise a more controllable method to prepare TAMEM-like cells, in this study, we identify a cocktail comprising five recombinant proteins as an essential condition to induce non-polarized macrophages (termed TAMEMs5) into therapeutic cells with pro-healing functions. The screened five factors are osteopontin (OPN), macrophage inflammatory protein (MIP)-2, chemokine (C-C motif) ligand 8 (CCL8), vascular endothelial growth factor (VEGF)-B, and macrophage colony-stimulating factor (M-CSF). We demonstrate the rationale for screening these factors and the phenotype of TAMEMs5 prepared from murine bone marrow-derived macrophages, which exhibit angiogenic and immunomodulatory effects in vitro. Then, we induce primary human monocytes from periphery blood into TAMEMs5, which show pro-healing effects in a human primary cell-based ex vivo model (T-SkinTM). Our study demonstrates a simple, effective, and controllable approach to induce primary macrophages to possess repairing activities, which may provide insights for developing cell-based therapeutics for non-healing wounds clinically.

Comparative analysis of patients with new onset refractory status epilepticus preceded by fever (febrile infection-related epilepsy syndrome) versus without prior fever: An interim analysis.

Febrile infection-related epilepsy syndrome (FIRES) is a subset of new onset refractory status epilepticus (NORSE) that involves a febrile infection prior to the onset of the refractory status epilepticus. It is unclear whether FIRES and non-FIRES NORSE are distinct conditions. Here, we compare 34 patients with FIRES to 30 patients with non-FIRES NORSE for demographics, clinical features, neuroimaging, and outcomes. Because patients with FIRES were younger than patients with non-FIRES NORSE (median = 28 vs. 48 years old, p = .048) and more likely cryptogenic (odds ratio = 6.89), we next ran a regression analysis using age or etiology as a covariate. Respiratory and gastrointestinal prodromes occurred more frequently in FIRES patients, but no difference was found for non-infection-related prodromes. Status epilepticus subtype, cerebrospinal fluid (CSF) and magnetic resonance imaging findings, and outcomes were similar. However, FIRES cases were more frequently cryptogenic; had higher CSF interleukin 6, CSF macrophage inflammatory protein-1 alpha (MIP-1a), and serum chemokine ligand 2 (CCL2) levels; and received more antiseizure medications and immunotherapy. After controlling for age or etiology, no differences were observed in presenting symptoms and signs or inflammatory biomarkers, suggesting that FIRES and non-FIRES NORSE are very similar conditions.

Clinical Effect Observation of Apatinib Combined with 131I for Radioiodine-Refractory Differentiated Thyroid Cancer and Prognostic Significance Analysis of Macrophage Inflammatory Protein-1&amp;#945; After Treatment: A Cell Regulation Study

Clinical Effect Observation of Apatinib Combined with 131I for Radioiodine-Refractory Differentiated Thyroid Cancer and Prognostic Significance Analysis of Macrophage Inflammatory Protein-1&amp;#945; After Treatment: A Cell Regulation Study

Retrospective Case Study on the Evaluation of Inflammatory Markers, Macrophage Inhibitory Protein-1α and Interferon-γ in Sleep Deprivation Condition

ABSTRACT Background and Aim: Sleep is an important physiological process that is necessary for the normal functioning of the body. Sleep greatly affects all aspects of our body, including the immune pathways or immune response system of our body, which plays a determinant role in the development and progression of chronic inflammatory diseases. In this study, we worked to find the relation between sleep deprivation and levels of pro-inflammatory markers macrophage inflammatory protein 1-alpha (MIP-1α) and interferon gamma (IFN-γ). To find the relation between sleep deprivation and levels of pro-inflammatory markers MIP-1α and IFN-γ. Objective: To find the relation between sleep deprivation and levels of pro-inflammatory markers MIP-1α and IFN-γ. Materials and Methods: The study was conducted with 40 individuals as participants, of which 20 were sleep-deprived (SD), and 20 had adequate amounts of sleep. The sleep duration details of the individuals were obtained by questionnaire. Blood was withdrawn from all the subjects after due consent from them. Plasma was separated and was used to evaluate their MIP-1α levels and IFN-γ levels. Results: The MIP-1α levels and levels of IFN-γ were found to be significantly elevated in the SD individuals than that of individuals who had adequate sleep. Conclusion: Sleep loss and sleep deprivation are associated with altered expressions of key regulatory factors and upregulation of pro-inflammatory cytokines production. Thus, sleep deprivation can be considered to be one of the major contributors to the development and progression of various chronic inflammatory diseases.

Mapping the causal associations of cytokines with sarcopenia and aging traits: Evidence from bidirectional Mendelian randomization.

Cytokines and growth factors may serve as a bridge in studying the causal relationships between inflammaging and sarcopenia due to their roles in inflammaging. In this study, we aim to explore the causal association of cytokines with sarcopenia and aging traits and further identify the significant inflammation factors. Bidirectional Mendelian randomization (MR) analysis was used to identify the causality. Forty-one kinds of circulation cytokines and growth factors were set as exposures, and the data were from a summary genome-wide association study (GWAS) containing three cohorts with 8293 healthy participants of European ancestry from 1983 to 2011. Hand grip strength, adjusted appendicular lean mass (AALM), usual walking pace, moderate-to-vigorous physical activity (MVPA) levels, able to walk or cycle unaided for 10min (AWCU10) and telomere length were selected as outcomes. Data for outcomes were obtained from meta-GWAS and the UK Biobank, and sample sizes ranged from 69537 to 472174. Low hand grip strength was defined by the European Working Group on Sarcopenia in Older People (EWGSOP) and Foundation for the National Institutes of Health (FNIH) cut-off points, respectively. Other outcome traits were defined and measured according to the UK Biobank and raw cohorts' criteria. We set two significance thresholds for single nucleotide polymorphisms (SNPs) associated with exposures to obtain adequate SNPs (5×10-6 and 5×10-8). Inverse-variance weighted, MR-Egger and weighted median were employed to estimate the causality. Twenty-seven factors were identified to relate to sarcopenia and aging traits causally, and most were associated with only one outcome trait. IL16 (interleukin-16), CTACK (cutaneous T-cell attracting chemokine), MIP1b (macrophage inflammatory protein 1b) and PDGFbb (platelet-derived growth factor BB) were proven to relate causally to at least one sarcopenia and aging trait in both analyses with two significance thresholds. IL16 was causally associated with hand grip strength (0.977 [0.956-0.998] for EWGSOP and 0.933 [0.874-0.996] for FNIH), AALM (0.991 [0.984, 0.998]), MVPA (0.997 [0.995-1.000]) and AWCU10 (1.008 [1.003-1.013]). CTACK was proven to relate causally to hand grip strength (1.013 [1.007-1.019] for EWGSOP and 1.090 [1.041-1.142] for FNIH), AWCU10 (0.990 [0.986-0.994]) and telomere length (0.998 [0.983-0.994]). The results indicated that MIP1b has a causal effect on hand grip strength (1.032 [1.001-1.063] for EWGSOP), AWCU10 (0.994 [0.988-1.000] and 0.993 [0.988-0.998]) and telomere length (1.006 [1.000-1.012]). PDGFbb may causally relate to AALM (1.016 [1.001-1.030]) and telomere length (1.011 [1.007-1.015]). Reserve MR analyses also proved their unidirectional causal effects. Twenty-seven factors were causally related to sarcopenia and aging traits, and the causal effects of IL16, CTACK, MIP1b and PDGFbb were proven in both analyses with two significance thresholds.

The Influence of Neodymium-Doped Yttrium Aluminum Garnet Laser Pulse Repetition Rate on Cytokine Secretion from Peripheral Blood Mononuclear Cells in Vitro

Objective: Biological effects of infrared laser energy at various exposure parameters have been characterized in previous in vitro and animal studies. However, the impact of pulse repetition rate (PRR) has not been evaluated in this context. The purpose of this investigation was to assess the influence of PRR on cytokine secretion from peripheral blood mononuclear cells (PBMCs) subjected to pulsed neodymium-doped yttrium aluminum garnet (Nd:YAG) laser energy. Materials and Methods: Rat PBMCs were cultured in vitro then stimulated using a lipopolysaccharide concentration of 0 or 100 ng/ml. Cultures received Nd:YAG laser radiation (1064 nm, 5 W, 30 s) at PRR of 0 (untreated controls), 20, 30, 40, or 60 Hz. Concentrations of tumor necrosis factor-α (TNF-α), macrophage inflammatory protein (MIP)-1α, macrophage inflammatory protein (MIP)-2, monocyte chemoattractant protein-1 (MCP-1), interferon-gamma-induced protein (IP)-10, interleukin (IL)-6, and IL-10 were recorded using a magnetic microsphere immunoassay. The main effects of PRR and LPS stimulation on cytokine concentrations, and the interaction between PRR and LPS stimulation, were assessed using two-way analysis of variance. Bonferroni post hoc tests were used to identify pairwise differences between groups. Results: The main effect of PRR was statistically significant for MIP-1α (P = 0.018), TNF-α (P = 0.025), MCP-1 (P &lt; 0.001), MIP-2 (P = 0.013), and IL-6 (P = 0.031). Five of six pro-inflammatory cytokines exhibited significantly lower mean concentrations in laser-exposed compared with control cultures at one or more PRR. However, no statistically significant differences were found between PRR groups. Conclusions: Under the described conditions, statistically significant differences in cytokine secretion were observed between laser-exposed and control cultures, consistent with prior reports. However, PRR appears to be an irrelevant factor in immunomodulation of PBMCs.

Systemic Inflammatory Regulators Associated with Osteoporosis: A Bidirectional Mendelian Randomization Study.

To elucidate the precise upstream and downstream regulatory mechanisms of inflammatory factors in osteoporosis (OP) progression and to establish a causal relationship between inflammatory factors and OP. We conducted bidirectional Mendelian randomization (MR) analyses using data for 41 cytokines obtained from three independent cohorts comprising 8293 Finnish individuals. Estimated bone mineral density (eBMD) data were derived from 426,824 UK Biobank White British individuals (55% female) and fracture data from 416,795 UK Biobank participants of European ancestry. The inverse variance-weighted method was the primary MR analysis approach. We employed other methods as complementary approaches for mutual corroboration. To test for pleiotropy and heterogeneity, we used the MR-Egger regression, MR-pleiotropy residual sum and outlier global test, and the Cochrane Q test. Macrophage inflammatory protein (MIP)-1α and interleukin (IL)-12p70 expression associated negatively and causally with eBMD (β = -0.017 [MIP-1α], β = -0.011 [IL-12p70]). Conversely, tumor necrosis factor-related apoptosis-inducing ligand was associated with a decreased risk of fractures (Odds Ratio: 0.980). Additionally, OP influenced the expression of multiple inflammatory factors, including growth-regulated oncogene-α, interferon-gamma, IL-6, beta nerve growth factor, and IL-2. Finally, we discovered complex bidirectional causal relationships between IL-8, IL-10, and OP. Specific inflammatory factors may contribute to OP development or may be causally affected by OP. We identified a bidirectional causal relationship between certain inflammatory factors and OP. These findings provide new perspectives for early prediction and targeted treatment of OP. Larger cohort studies are necessary in the future to further validate these findings.

Abatacept decreases renal T-cell infiltration and renal inflammation and ameliorates progressive renal injury in obese Dahl salt-sensitive rats before puberty.

Prepubertal obesity (PPO) is growing at an alarming rate and is now considered a risk factor for renal injury. Recently, we reported that the early development of renal injury in obese Dahl salt-sensitive leptin receptor mutant (SSLepRmutant) rats was associated with increased T-cell infiltration and activation prior to puberty. Therefore, the current study investigated the effect of inhibiting T-cell activation with abatacept on the progression of renal injury in young obese SSLepRmutant rats before puberty. Four-week-old SS and SSLepRmutant rats were treated with IgG or abatacept (1 mg/kg; ip, every other day) for 4 weeks. Abatacept reduced the renal infiltration of T-cells by almost 50% in SSLepRmutant rats. Treatment with abatacept decreased the renal expression of macrophage inflammatory protein-3 alpha (MIP-3α) while increasing IL-4 in SSLepRmutant rats without affecting SS rats. While not having an impact on blood glucose, abatacept reduced hyperinsulinemia and plasma triglycerides in SSLepRmutant rats without affecting SS rats. We did not observe any differences in MAP among the groups. Proteinuria was markedly higher in SSLepRmutant rats versus SS rats throughout the study, and treatment with abatacept decreased proteinuria by about 40% in SSLepRmutant rats without affecting SS rats. We observed significant increases in glomerular and tubular injury and renal fibrosis in SSLepRmutant rats vs SS rats, and chronic treatment with abatacept significantly reduced these renal abnormalities in SSLepRmutant rats. These data suggest that renal T-cell activation contributes to the early progression of renal injury associated with PPO.

Abstract 7478: Unveiling the role of two-pore channel 2 (TPC2) in cancer immunity from monocyte differentiation to cytokine production

Abstract Background: The study of TPC2 is of great interest in the field of cancer and immune diseases, as it plays a crucial role in various cellular processes, and there is substantial evidence that TPC2 sustains several cancer hallmarks (angiogenesis, autophagy, and metastasis). The expression and role of TPC2 and its relevance to cancer in the innate immune system remain unknown. Methods: U937 TPCN2 knockdown (KD) cells were developed by nucleofection-based transfection of CRISPR-Cas9 gene editing tools. sgRNA (single guide RNA): CGUGCUGGUGAGUGAGGAUG was designed to target the fourth exon of the TPCN2 gene (Transcript ID: ENST00000294309). The model was used in tandem with pharmacological modulators of TPC2 channel activity to underpin its function in monocyte differentiation, macrophage development, and IL-8 production. Molecular biology techniques, including Sanger sequencing, qPCR, ELISA, and WB, were utilized. Proteins of murine TPC2 WT and TPC2 KO cells were extracted and sent to the Discovery Proteomics Facility of the Target Discovery Institute for label-free quantification and proteomics analysis using mass spectrometry. Results: We developed TPC2-deficient human monocytes (U937 cells) with a 75% reduction in TPCN2 expression levels, and we demonstrated that TPCN2 genetically modified U937 monocytes were resistant to monocyte differentiation after treatment with increasing concentrations of PMA ranging from 100 ng/mL to 400 ng/mL. TPC2-deficient U937 monocytes were not differentiated into Mϕ. TPC2 acts as a major regulator of monocyte differentiation by modulating PKC-alpha via calpain. In addition, the levels of IL-8 were significantly reduced after treating U937 cells with Ned 19 (an NAADP antagonist) or TPC2 KD. Keratinocyte-derived chemokine (KC) and Macrophage inflammatory protein-2 (MIP-2) are the murine IL-8 homologues. Notably, the levels of MIP-2, but not KC, were significantly reduced in the TPC2 KO murine cells compared to the WT controls. Thus, TPC2 appears to be involved in IL-8 secretion in both humans and mice. In contrast to KC at the protein level, the KC expression level was significantly reduced in TPC2-deficient murine cells. TPC2 in EE/RE is involved in lipopolysaccharide (LPS)-mediated IL-8 production in U937 cells. TPC2 modulates immune targets involving CD38, PKC-alpha, and AKT.We found that 28 different proteins that play roles in cancer immunity showed significant changes in expression in TPC2-deficient murine cells (three overexpressed proteins and 25 down-expressed proteins), compared to WT. Conclusion: Our data provide the first preclinical proof of concept for TPC2 as a potential target for blocking macrophage development and modulating CD38/IL8 levels as therapeutic strategies for cancer patients, raising questions regarding the clinical utility of TPC2 as a biomarker or immunotherapy target to modulate immune responses. Citation Format: Abeer Alharbi, John Parrington. Unveiling the role of two-pore channel 2 (TPC2) in cancer immunity from monocyte differentiation to cytokine production [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 7478.

Abstract 7304: Modulation of cytokine and chemokine profiles in pancreatic tumors and plasma via stage-specific intervention with Momordica Charantia juice in the LSL-KrasG12D/+, p48Cre/+ mouse model

Abstract According to the American Cancer Society ≈64,050 people will be newly diagnosed with pancreatic cancer in the United States, while ≈55, 550 (men and women numbers combined) will die of this malignancy in 2023 alone. Epidemiological studies have indicated that a diet rich in natural agents might reduce pancreatic ductal adenocarcinoma (PDAC) risk, prompting investigations into a natural agent with health benefits in pancreatic diseases [such as the fruits of Momordica Charantia (Bitter Melon)] as a potential natural and non-toxic anti-cancer approach against PDAC. Previously we have reported the protective effects of oral Bitter Melon Juice (BMJ-standardized-lyophilized powder) against growth and progression of PDAC in preclinical animal models (xenograft and patient-derived tumor models). In a recent study we reported the efficacy of BMJ against pancreatic cancer in the LSL-KrasG12D/+, p48Cre/+ transgenic mouse model [this model mimics the stage-specific progression of intraepithelial neoplasms to PDAC as it occurs in humans]. Both male and female LSL-KrasG12D/+, p48Cre/+ transgenic mice were subjected to BMJ intervention (daily oral gavage, dose: 200mg/kg body wt.) during different stages in disease progression. Intervention was started at 4 or 15 weeks of mice age and continued till study end (10 and 30 weeks of mice age respectively). Additionally, in one group of mice, intervention was initiated at 6 weeks of mice age and continued till 41 weeks of mice age (study end). Outcomes were compared with wild-type and disease-positive untreated control groups. Pancreatic tissue/tumors were harvested at study end and blood plasma was also collected. In the present study, we performed a stage specific evaluation of tissue and plasma cytokine/chemokine profiling after BMJ intervention to gain detailed mechanistic insights into the potential of BMJ to mediate it is anti-pancreatic cancer effect via modulation of inflammatory pathways associated with PDAC growth and progression. BMJ (15 weeks of treatment) demonstrated a significant response in modulating cytokine/chemokine profiles in LSL KrasG12D/+, p48Cre/+ mice pancreatic cancerous tissues (30 weeks old mice). BMJ intervention specifically downregulated the levels of monocyte chemoattractant protein (MCP-1), macrophage inflammatory protein-1 (MIP-1-gamma), tumor necrosis factor (TNF) receptor (TNFR1), Vascular cell adhesion molecule 1 (VCAM-1/CD106) and L-selectin (CD62L). Furthermore, Ingenuity Pathway Analysis indicated significant inhibitory predictions on TNF-α, NF-κB and MCP-1 (CCL-2) associated inflammatory pathways. Overall, these outcomes signify that the anti- cancer effects of BMJ in KRAS harboring PDAC tumors is associated with down-regulation of inflammatory pathways associated with growth and progression of pancreatic cancer. Citation Format: Lakshmi Sai Pratyusha Bugata, Robin Kumar, Md. Imtiazul Kabir, Rama Kant, Chapla Agarwal, Rajesh Agarwal, Komal Raina. Modulation of cytokine and chemokine profiles in pancreatic tumors and plasma via stage-specific intervention with Momordica Charantia juice in the LSL-KrasG12D/+, p48Cre/+ mouse model [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 7304.