Lycopene Beta-cyclase Research Articles

Nostoxanthin Biosynthesis by Sphingomonas Species (COS14-R2): Isolation, Identification, and Optimization of Culture Conditions.

Nostoxanthin, a yellow pigment, belongs to the xanthophyll group of carotenoids found in various species of bacteria and cyanobacteria. Several species of Sphingomonas can produce appropriate carotenoids for survive in various environments. This comprise nostoxanthin, a significant carotenoid. The study isolated the Sphingomonas species strain COS14-R2 from the Cosmos bipinnatus and identified it through the whole-genome sequence. The strain consists of a circular chromosome with a length of 3,677,457 base pairs.s ecThe genome consists of three carotenoid biosynthesis genes, specifically crtB (phytoene synthase), crtI (phytoene desaturase), and crtY (Lycopene beta-cyclase), which are involved in the synthesis of nostoxanthin. The strain has a circular, undulated colony morphology with a deep yellow color. It demonstrates optimal growth in liquid media at 25 to 35°C and exhibits a high tolerance for pH levels between 5 and 11 and requires adequate quantities of carbon and nitrogen. We observed the highest concentration of nostoxanthin was recorded at 35°C, pH of 7.5, glucose concentration of 40g L-1, and a yeast extract concentration of 5g L-1 during dark incubation. The fed-batch fermentation process produced nostoxanthin at a concentration of 217.22 ± 9.60mg L-1, with a selectivity of 72.32% and a productivity of 2.59g/L/h. The dry biomass extract was purified using column chromatography. The LC-MS/MS analysis of the purified fraction indicated that the molecular weight of nostoxanthin is 600.5098m/z. The DPPH assay result of 75.5 ± 0.33% indicates nostoxanthin is highly effective in scavenging free radicals.

Characterization of Two Lycopene Beta-cyclases Reveal Their Essential Roles in Photoprotection in Nicotiana Tabacum

Carotenoids are essential isoprenoids with vital roles in photoprotection and antioxidative processes in photosynthetic organisms. Lycopene Beta-cyclase (β-LCY) is a key enzyme in carotenoid biosynthesis; however, the role of β-LCY in photoprotection is still unclear. In this study, we characterized two β-LCY genes in an allotetraploid tobacco cultivar K326, that are primarily expressed in leaves. Reduction of β-LCY expression by RNA interfercnce (RNAi) resulted in decreased carotenoid content, leaf variegation, impaired photosynthetic efficiency, and abnormal chloroplast morphology. β-LCY RNAi plants exhibited hypersensitivity to high light and lower non-photochemical quenching (NPQ) values under both normal and high light conditions. The stability of D1, a core subunit of photosystem II reaction center, was dramatically impaired β-LCY RNAi plants upon exposure to high light, suggesting severe photodamage of photosystem. Furthermore, reactive oxygen species (ROS) content was increased in β-LCY RNAi plants compared to WT plants under both normal and high light conditions. These results indicate that β-LCY is crucial for NPQ, D1 stability and ROS homeostasis, thus protecting photosystem from photooxidative damage. These findings contribute to our understanding on the function of plant β-LCY and its potential implications for plant growth, development, and photoprotection.

A novel mutation in non-constitutive lycopene beta cyclase (CstLcyB2a) from Crocus sativus modulates carotenoid/apocarotenoid content, biomass and stress tolerance in plants.

Mutation at A126 in lycopene-β-cyclase of Crocus (CstLcyB2a) sterically hinders its binding of δ-carotene without affecting lycopene binding, thereby diverting metabolic flux towards β-carotene and apocarotenoid biosynthesis. Crocus sativus, commonly known as saffron, has emerged as an important crop for research because of its ability to synthesize unique apocarotenoids such as crocin, picrocrocin and safranal. Metabolic engineering of the carotenoid pathway can prove a beneficial strategy for enhancing the quality of saffron and making it resilient to changing climatic conditions. Here, we demonstrate that introducing a novel mutation at A126 in stigma-specific lycopene-β-cyclase of Crocus (CstLcyB2a) sterically hinders its binding of δ-carotene, but does not affect lycopene binding, thereby diverting metabolic flux towards β-carotene formation. Thus, A126L-CstLcyB2a expression in lycopene-accumulating bacterial strains resulted in enhanced production of β-carotene. Transient expression of A126L-CstLcyB2a in C. sativus stigmas enhanced biosynthesis of crocin. Its stable expression in Nicotiana tabacum enhanced β-branch carotenoids and phyto-hormones such as abscisic acid (ABA) and gibberellic acids (GA's). N. tabacum transgenic lines showed better growth performance and photosynthetic parameters including maximum quantum efficiency (Fv/Fm) and light-saturated capacity of linear electron transport. Exogenous application of hormones and their inhibitors demonstrated that a higher ratio of GA4/ABA has positive effects on biomass of wild-type and transgenic plants. Thus, these findings provide a platform for the development of new-generation crops with improved productivity, quality and stress tolerance.

In-silico Gene Editing of LCYB in Musa acuminata and Its Functional Analysis Related to Lycopene Beta-Cyclase Pathway

Banana (Musa acuminata) has high biodiversity and belongs to the important commodities after rice, particularly in Indonesia. for effective biofortification of bananas, a thorough understanding of the fruit’s genetic makeup, nutritional composition, and bioavailability of nutrients is necessary. If the study of bananas is incomplete or lacking, it can impede the development of biofortified varieties. The gene-regulated vitamin A pathway in a banana is LCYB. Therefore, this study aimed to design activating LCYB gene using CRISPR/Cas 9 and predict its gene and protein functional analysis related to the lycopene beta-cyclase pathway. We performed sequence analysis of LCYB (GeneBank: KP406755.1) to construct sgRNA to activate the expression of LCYB by in-silico approaches. We also successfully amplified the LCYB gene in various accession collections. Based on in-silico predicting sgRNA activity, we found a total of 192 putative sgRNA both in the positive or negative strand in the M.acuminata LCYB gene sequence. We investigated three sgRNA targets sequence-related MaLCYB activation, i.e., CTTTAGATGAGTCATACAAGGGG, ACGAGAGTTCACTACCCAAGAGG, and AGAATTGAGTTGCTCCACCGAGG with an efficiency score of 73.23, 71.00, and 70.21%, respectively. The mutation of the gene could change the functional protein and influence the lycopene beta-cyclase pathway. In silico analysis was an important tool to predict genome editing in M.acuminata to minimize technical sgRNA construction in vivo.

In Silico Characterization of Lycopene Beta Cyclase (LCYB) and Lycopene Epsilon Cyclase (LCYE) Genes from DH-Pahang (Musa acuminata, A Genome) and DH-PKW (Musa balbisiana, B Genome)

Alpha (α) and beta (β)-carotene are among the nutritious contents of bananas, with the unique feature of a high ratio of α-/β-carotene. Research on the gene and protein of the key enzymes determining the ratio of α-/β-carotene in bananas, namely lycopene beta cyclase (LCYB) and lycopene epsilon cyclase (LCYE), is currently not well defined. Hence, this study aimed to compare the characters of the LCYB and LCYE genes and their putative proteins from Musa acuminata 'DH-Pahang' and Musa balbisiana 'DH-PKW'. The corresponding nucleotide sequences from both species were aligned to detect similarities in the gene structure. Their protein products were characterized at the primary and tertiary levels. The phylogenetic tree was constructed based on nucleotide and protein sequences. The result showed that the gene structure between these two species is similar in LCYB in chromosome 9 but different in LCYB in chromosome 7 and LCYE. The presence of cis-acting regulatory elements in response to light dominated the 2000 nucleotide region of the 5'UTR of LCYB and LCYE genes in both species. Based on protein alignment and domain analysis, the NADB_Rossmann superfamily domain was detected in both LCYB and LCYE. Alignment of the three-dimensional protein structure showed a significant difference between MaLCYB.c07 and MbLCYB.c07 only. The phylogenetic tree based on protein sequences indicated the distant relationship of MaLCYB.c07 and MbLCYB.c07 with other LCYB ingroup OTUs. The results of this study could provide a molecular basis related to the exploration of bananas as a promising functional food to meet the needs of provitamin A.

SlBEL11 affects tomato carotenoid accumulation by regulating SlLCY-b2.

Extensive data have demonstrated that carotenoid accumulation in tomato fruit is influenced by environmental cues and hormonal signals. However, there is insufficient information on the mechanism of its transcriptional regulation, as many molecular roles of carotenoid biosynthetic pathways remain unknown. In this work, we found that the silence of the BEL1-like family transcription factor (TF) BEL1-LIKE HOMEODOMAIN 11 (SlBEL11) enhanced carotenoid accumulation in virus induced gene silencing (VIGS) analysis. In its RNA interference (RNAi) transgenic lines, a significant increase in the transcription level for the lycopene beta cyclase 2 (SlLCY-b2) gene was detected, which encoded a key enzyme located at the downstream branch of the carotenoid biosynthetic pathway. In Electrophoretic mobility shift assay (EMSA), SlBEL11 protein was confirmed to bind to the promoter of SlLCY-b2 gene. In addition, the dual-luciferase reporter assay showed its intrinsic transcriptional repression activity. Collectively, our findings added a new member to the carotenoid transcriptional regulatory network and expanded the functions of the SlBEL11 transcription factor.

Transcriptome and Metabolome Analysis of Color Changes during Fruit Development of Pepper (Capsicum baccatum).

Fruit color is one of the most critical characteristics of pepper. In this study, pepper (Capsicum baccatum L.) fruits with four trans-coloring periods were used as experimental materials to explore the color conversion mechanism of pepper fruit. By transcriptome and metabolome analysis, we identified a total of 307 flavonoid metabolites, 68 carotenoid metabolites, 29 DEGs associated with flavonoid biosynthesis, and 30 DEGs related to carotenoid biosynthesis. Through WGCNA (weighted gene co-expression network analysis) analysis, positively correlated modules with flavonoids and carotenoids were identified, and hub genes associated with flavonoid and carotenoid synthesis and transport were anticipated. We identified Pinobanksin, Naringenin Chalcone, and Naringenin as key metabolites in the flavonoid biosynthetic pathway catalyzed by the key genes chalcone synthase (CHS CQW23_29123, CQW23_29380, CQW23_12748), cinnamic acid 4-hydroxylase (C4H CQW23_16085, CQW23_16084), cytochrome P450 (CYP450 CQW23_19845, CQW23_24900). In addition, phytoene synthase (PSY CQW23_09483), phytoene dehydrogenase (PDS CQW23_11317), zeta-carotene desaturase (ZDS CQW23_19986), lycopene beta cyclase (LYC CQW23_09027), zeaxanthin epoxidase (ZEP CQW23_05387), 9-cis-epoxycarotenoid dioxygenase (NCED CQW23_17736), capsanthin/capsorubin synthase (CCS CQW23_30321) are key genes in the carotenoid biosynthetic pathway, catalyzing the synthesis of key metabolites such as Phytoene, Lycopene, β-carotene and ε-carotene. We also found that transcription factor families such as p450 and NBARC could play important roles in the biosynthesis of flavonoids and carotenoids in pepper fruits. These results provide new insights into the interaction mechanisms of genes and metabolites involved in the biosynthesis of flavonoids and carotenoids in pepper fruit leading to color changes in pepper fruit.

Comparative transcriptome analysis of unripe and ripe banana (cv. Nendran) unraveling genes involved in ripening and other related processes

Banana is one of the most important fruit crops consumed globally owing to its high nutritional value. Previously, we demonstrated that the ripe pulp of the banana cultivar (cv.) Nendran (AAB) contained a high amount of pro-vitamin A carotenoids. However, the molecular factors involved in the ripening process in Nendran fruit are unexplored. Hence, we commenced a transcriptome study by using the Illumina HiSeq 2500 at two stages i.e. unripe and ripe fruit-pulp of Nendran. Overall, 3474 up and 4727 down-regulated genes were obtained. A large number of identified transcripts were related to genes involved in ripening, cell wall degradation and aroma formation. Gene ontology analysis highlighted differentially expressed genes that play a key role in various pathways. These pathways were mainly linked to cellular, molecular and biological processes. The present transcriptome study also reveals a crucial role of up-regulated carotenoid biosynthesis pathway genes namely, lycopene beta cyclase and geranylgeranyl pyrophosphate synthase at the ripening stage. Genes related to the ripening and other processes like aroma and flavor were highly expressed in the ripe pulp. Expression of numerous transcription factor family genes was also identified. This study lays a path towards understanding the ripening, carotenoid accumulation and other related processes in banana.

LED-Induced Carotenoid Synthesis and Related Gene Expression in Brassica Microgreens

In this study, various ratios of combined red, blue, and amber light-emitting diodes (rbaLEDs) were investigated for their effect on the expression of carotenoid biosynthetic genes and carotenoid accumulation in eight Brassica microgreens. Total and individual (β-carotene, lutein, α-carotene, neoxanthin, and violaxanthin) carotenoids were increased 20-44 and 10-55%, respectively, under dose-dependent increasing amber-blue light and decreasing red in most microgreens. Lipophilic 2,2-diphenyl-1-picrylhydrazyl and ferric reducing antioxidant power antioxidant activities were significantly increased under higher amber and blue light fractions, while oxygen radical absorbance capacity was generally decreased. Under rbaLED in mizuna (B. rapa) microgreens, the lycopene epsilon cyclase (LYCε) expression was 10-15-fold higher, which resulted in downstream accumulation of α-carotene and lutein. Lycopene beta cyclase (LYCβ) was not significantly changed, suggesting that β-carotene, violaxanthin and neoxanthin were mainly controlled by upstream phytoene synthase and branch-point LYCε. Increased beta-ring carotenoid hydroxylase (CHXβ) expression was also consistent with lutein accumulation. This study demonstrated for the first time that amber LED was involved in the regulatory mechanism of carotenoid biosynthesis, thus a potential novel approach to production of antioxidant-rich microgreens.

Time\u2011resolved transcriptome analysis during transitions of sulfur nutritional status provides insight into triacylglycerol (TAG) and astaxanthin accumulation in the green alga Chromochloris zofingiensis

BackgroundChromochloris zofingiensis, an oleaginous microalga, is a promising feedstock for the co-production of triacylglycerol (TAG)-based biodiesel and the high-value product astaxanthin. To reveal the molecular mechanism of TAG and astaxanthin biosynthesis during transitions of sulfur nutritional status, namely sulfur-starvation (SS) and sulfur-replenishment (SR), the physiological responses and the transcriptomic dynamics of C. zofingiensis were examined.ResultsThe results revealed a reversible TAG and astaxanthin accumulation under SS, which is correlated with the reduction of cell growth and protein content, indicating the reallocation of carbon. By correlating the data on the physiological and transcriptional responses to different sulfur nutritional status, a model for the underlying mechanism of TAG and astaxanthin accumulation in C. zofingiensis was postulated, which involved up-regulation of key genes including diacylglycerol acyltransferase (DGTT5) and beta-carotene ketolase (BKT1), increased energy and NADPH supply by elevating the tricarboxylic acid (TCA) cycle and the oxidative pentose phosphate (OPP) pathway, and the increased carbon precursors (pyruvate and acetyl-CoA) through central carbon metabolism. In addition, the net enhancement of the de novo biosynthesis of fatty acids and the re-direction of the terpenoid precursors toward the branch catalyzed by lycopene beta cyclase (LCYb) and BKT1 escalated the substrate availability for the biosynthesis of TAG and astaxanthin, respectively.ConclusionsIn this study, the time-resolved transcriptional analysis of C. zofingiensis under SS and SR conditions was reported for the first time to elucidate the regulatory roles of key enzymes, including DGTT5, BKT1 and LCYb, in the underlying mechanisms of TAG and astaxanthin accumulation.

Effect of Elicitation on Polyphenol and Carotenoid Metabolism in Butterhead Lettuce (Lactuca sativa var. capitata).

The effect of elicitation in butterhead lettuce on carotenoid and polyphenol metabolism was evaluated. Different concentrations of arachidonic acid (AA), salicylic acid (SA), methyl jasmonate (MJ) (15, 45, and 90 μM) and Harpin protein (HP) (30, 60, and 120 mg/L) were applied on red and green butterhead lettuces. Total phenolic and flavonoid content were incremented by MJ (90 μM) in green and red lettuce. Carotenoids were increased in red lettuce (AA; 45 μM). Green lettuce modifies their phenolic acid profile after elicitation with AA and MJ; meanwhile, red lettuce incremented mainly in hydroxycinnamic acids and flavonols, MJ being the elicitor with the highest effect. There was an impact on secondary metabolite enzyme gene transcript concentration. Phenylalanine ammonia-lyase (PAL) and lycopene beta cyclase (LBC) increased in both varieties after elicitation. A relationship between phytochemical increase and the activation of the metabolic pathways after elicitation in butterhead lettuce was observed.

Transcription activation of β-carotene biosynthetic genes at the initial stage of stresses as an indicator of the increased β-carotene accumulation in isolated Dunaliella salina strain GY-H13

β-carotene is an efficient antioxidant and its accumulation is an oxidative response to stressors. Dunaliella salina strain GY-H13 is rich in β-carotene under environmental stresses, which was selected as material to understand the molecular mechanism underlying β-carotene biosynthesis. Seven full length cDNA sequences in β-carotene biosynthesis pathway were cloned, including geranylgeranyl pyrophosphate synthase (GGPS), phytoene synthase (PSY), phytoene desaturase (PDS), 15-cis-zeta-carotene isomerase (ZISO), zeta-carotene desaturase (ZDS), prolycopene isomerase (CRTISO), lycopene beta-cyclase (LCYb). The seven protein sequences from the strain GY-H13 showed the highest similarity with other D. salina strains. Especially, PSY, PDS and LCYb protein sequences shared 100 % identity. Phylogenetic analysis indicated all proteins from GY-H13 firstly clustered with those from other D. salina strains with a bootstrap of 100 %. Multiple alignment indicated several distinct conserved motifs such as aspartate-rich domain (ARD), dinucleotide binding domain (DBD), and carotene binding domain (CBD). These motifs are located near ligand-binding pocket, which may be required for the activity of enzyme. Expression levels of these genes and β-carotene content were measured over 24-h cycle, showing clear daily dynamics. All genes were dramatically up-regulated in the morning but the highest accumulation of β-carotene was observed at noon, suggesting a lag-effect between gene transcription and biological response. Furthermore, the accumulation of β-carotene increased under nitrogen deficiency, Cd exposure and high light and decreased under high salinity in a time-dependent manner. No gene of β-carotene biosynthesis was up-regulated by high salinity while most genes were activated by the other stresses at the beginning stage of exposure. Growth inhibition and oxidative damage were also observed under high salinity. Overall, transcription activation of β-carotene biosynthetic genes at the initial stage of stress exposure is a determinant of the increased accumulation of β-carotene in microalgae, which help their survive under harsh environments. The newly isolated D. salina strain GY-H13 would be a promising microalgae model for investigating the molecular mechanism of stress-induced β-carotene biosynthesis.

The apricot (Prunus armeniaca L.) genome elucidates Rosaceae evolution and beta-carotenoid synthesis

Apricots, scientifically known as Prunus armeniaca L, are drupes that resemble and are closely related to peaches or plums. As one of the top consumed fruits, apricots are widely grown worldwide except in Antarctica. A high-quality reference genome for apricot is still unavailable, which has become a handicap that has dramatically limited the elucidation of the associations of phenotypes with the genetic background, evolutionary diversity, and population diversity in apricot. DNA from P. armeniaca was used to generate a standard, size-selected library with an average DNA fragment size of ~20 kb. The library was run on Sequel SMRT Cells, generating a total of 16.54 Gb of PacBio subreads (N50 = 13.55 kb). The high-quality P. armeniaca reference genome presented here was assembled using long-read single-molecule sequencing at approximately 70× coverage and 171× Illumina reads (40.46 Gb), combined with a genetic map for chromosome scaffolding. The assembled genome size was 221.9 Mb, with a contig NG50 size of 1.02 Mb. Scaffolds covering 92.88% of the assembled genome were anchored on eight chromosomes. Benchmarking Universal Single-Copy Orthologs analysis showed 98.0% complete genes. We predicted 30,436 protein-coding genes, and 38.28% of the genome was predicted to be repetitive. We found 981 contracted gene families, 1324 expanded gene families and 2300 apricot-specific genes. The differentially expressed gene (DEG) analysis indicated that a change in the expression of the 9-cis-epoxycarotenoid dioxygenase (NCED) gene but not lycopene beta-cyclase (LcyB) gene results in a low β-carotenoid content in the white cultivar “Dabaixing”. This complete and highly contiguous P. armeniaca reference genome will be of help for future studies of resistance to plum pox virus (PPV) and the identification and characterization of important agronomic genes and breeding strategies in apricot.

Abscisic acid affects ethylene metabolism and carotenoid biosynthesis in Japanese apricot (Prunus mume Sieb. et Zucc.)

The Japanese apricot (Prunus mume Sieb. et Zucc.) is a typical climacteric fruit which loses commercial value during processing when the surface color turns yellow. In our study, treatment with nordihydroguaiaretic acid (NDGA), an abscisic acid (ABA) synthesis inhibitor, delayed the increase of ethylene and decrease of firmness towards ripening, and retarded the degradation of chlorophyll and the accumulation of carotenoids including β-carotene and lycopene through the expression of PmCHL (coding for chlorophyllase), PmGGPPS (coding for geranylgeranyl diphosphate synthase), PmPDS (coding for phytoene desaturase), PmPSY (coding for phytoene synthases), and PmLCYB (coding for lycopene beta-cyclase). NDGA inhibited the ABA synthesis through PmNCED1 and these results show that ABA may affect the ripening of the Japanese apricot by influencing ethylene production and the expression of PmACS (coding for ACC synthase), PmACO (ACC oxidase) and the ethylene-responsive gene PmERF (ethylene-responsive transcription factor), and thus that ethylene and ABA may interact during fruit ripening in climacteric fruit.

Medically important carotenoids from Momordica charantia and their gene expressions in different organs

Carotenoids, found in the fruit and different organs of bitter melon (Momordica charantia), have attracted great attention for their potential health benefits in treating several major chronic diseases. Therefore, study related to the identification and quantification of the medically important carotenoid metabolites is highly important for the treatment of various disorderes. The present study involved in the identification and quantification of the various carotenoids present in the different organs of M. charantia and the identification of the genes responsible for the accumulation of the carotenoids with respect to the transcriptome levels were investigated. In this study, using the transcriptome database of bitter melon, a partial-length cDNA clone encoding geranylgeranyl pyrophosphate synthase (McGGPPS2), and several full-length cDNA clones encoding geranylgeranyl pyrophosphate synthase (McGGPPS1), zeta-carotene desaturase (McZDS), lycopene beta-cyclase (McLCYB), lycopene epsilon cyclases (McLCYE1 and McLCYE2), beta-carotene hydroxylase (McCHXB), and zeaxanthin epoxidase (McZEP) were identified in bitter melon. The expression levels of the mRNAs encoding these eight putative biosynthetic enzymes, as well as the accumulation of lycopene, α-carotene, lutein, 13Z-β-carotene, E-β-carotene, 9Z-β-carotene, β-cryptoxanthin, zeaxanthin, antheraxanthin, and violaxanthin were investigated in different organs from M. charantia as well as in the four different stages of its fruit maturation. Transcripts were found to be constitutively expressed at high levels in the leaves where carotenoids were also found at the highest levels. Collectively, these results indicate that the putative McGGPPS2, McZDS, McLCYB, McLCYE1, McLCYE2, and McCHXB enzymes might be key factors in controlling carotenoid content in bitter melon. In conclusion, the over expression of the carotenoid biosynthetic genes from M. charantia crops to increase the yield of these medically important carotenoids.

Candidate gene sequencing and validation of SNP markers linked to carotenoid content in cassava (Manihot esculenta Crantz)

Cassava is a widely grown staple in Sub-Saharan Africa and consumed as a cheap source of calories, but the crop is deficient in micronutrients including pro-vitamin A carotenoids. This challenge is currently being addressed through biofortification breeding that relies on phenotypic selection. Gene-based markers linked to pro-vitamin A content variation are expected to increase the rate of genetic gain for this critical trait. We sequenced four candidate carotenoid genes from 167 cassava accessions representing the diversity of elite breeder lines from IITA. Total carotenoid content was determined using spectrophotometer and total β-carotene was quantified by high-performance liquid chromatography. Storage root yellowness due to carotenoid pigmentation was assessed. We carried out candidate gene association analysis that accounts for population structure and kinship using genome-wide single nucleotide polymorphisms (SNPs) generated through genotyping-by-sequencing. Significant SNPs were used to design competitive allele-specific PCR assays and validated on the larger population for potential use in marker-assisted selection breeding. Candidate gene sequencing of the genes β-carotene hydroxylase (crtRB), phytoene synthase (PSY2), lycopene epsilon cyclase (lcyE), and lycopene beta cyclase (lcyB) yielded a total of 37 SNPs. Total carotenoid content, total β-carotene, and color parameters were significantly associated with markers in the PSY2 gene. The SNPs from lcyE were significantly associated with color while those of lcyB and crtRB were not significantly associated with carotenoids or color parameters. These validated and breeder-friendly markers have potential to enhance the efficiency of selection for high β-carotene cassava, thus accelerating genetic gain.

Expression Differences of Pigment Structural Genes and Transcription Factors Explain Flesh Coloration in Three Contrasting Kiwifruit Cultivars.

Fruits of kiwifruit cultivars (Actinidia chinensis and A. deliciosa) generally have green or yellow flesh when ripe. A small number of genotypes have red flesh but this coloration is usually restricted to the inner pericarp. Three kiwifruit cultivars having red (‘Hongyang’), or yellow (‘Jinnong-2’), or green (‘Hayward’) flesh were investigated for their color characteristics and pigment contents during development and ripening. The results show the yellow of the ‘Jinnong-2’ fruit is due to the combined effects of chlorophyll degradation and of beta-carotene accumulation. The red inner pericarps of ‘Hongyang’ fruit are due to anthocyanin accumulation. Expression differences of the pathway genes in the inner pericarps of the three different kiwifruits suggest that stay-green (SGR) controls the degradation of chlorophylls, while lycopene beta-cyclase (LCY-β) controls the biosynthesis of beta-carotene. The abundance of anthocyanin in the inner pericarps of the ‘Hongyang’ fruit is the results of high expressions of UDP flavonoid glycosyltransferases (UFGT). At the same time, expressions of anthocyanin transcription factors show that AcMYBF110 expression parallels changes in anthocyanin concentration, so seems to be a key R2R3 MYB, regulating anthocyanin biosynthesis. Further, transient color assays reveal that AcMYBF110 can autonomously induce anthocyanin accumulation in Nicotiana tabacum leaves by activating the transcription of dihydroflavonol 4-reductase (NtDFR), anthocyanidin synthase (NtANS) and NtUFGT. For basic helix-loop-helix proteins (bHLHs) and WD-repeat proteins (WD40s), expression differences show these may depend on AcMYBF110 forming a MYB-bHLH-WD40 complex to regulate anthocyanin biosynthesis, instead of it having a direct involvement.

Carotenoid accumulation in durian (Durio zibethinus) fruit is affected by ethylene via modulation of carotenoid pathway gene expression

Carotenoid content in durian (Durio zibethinus) fruit is an important aspect of fruit quality, with different cultivars distinguished by differing pigmentation. We have studied the dependence of carotenogenesis on ethylene. Fruit of the cultivar ‘Chanee’ harvested at the mature stage were either left untreated (controls), treated with 1-methylcyclopropene (1-MCP) for 12 h, or treated with application of an aqueous ethephon solution to the stem end, or treated for 12 h with 1-MCP followed by ethephon application. Fruit were then stored for 9 d at 25 °C. Pulp color of durian became steadily yellowish as a result of accumulation of carotenoids, which were mainly beta-carotene, and alpha-carotene, with a minor amount of zeaxanthin and lutein. 1-MCP delayed the increase in the accumulation of beta-carotene, alpha-carotene, and zeaxanthin, but not lutein. In contrast, ethephon had no significant effect on carotenoid accumulation. The expression of zeta-carotene desaturase (ZDS), lycopene beta-cyclase (LCYB), chromoplast specific lycopene beta-cyclase (CYCB) and beta-carotene hydroxylase (BCH) genes was highly correlated with carotenoid content and pulp color.1-MCP resulted in significant down-regulation of ZDS, LCYB, CYCB and BCH expression. The accumulation of beta-carotene and alpha-carotene appears to be controlled by the level of expression of LCYB gene, whose function was tested in bacteria to show conversion of lycopene and delta-carotene to beta-carotene and alpha-carotene, respectively. These results suggest that ripening-induced carotenoid accumulation is regulated by endogenous ethylene controlling the expression of key genes such as LCYB.

A wild origin of the loss-of-function lycopene beta cyclase (CYC-b) allele in cultivated, red-fleshed papaya (Carica papaya).

The red flesh of some papaya cultivars is caused by a recessive loss-of-function mutation in the coding region of the chromoplast-specific lycopene beta cyclase gene (CYC-b). We performed an evolutionary genetic analysis of the CYC-b locus in wild and cultivated papaya to uncover the origin of this loss-of-function allele in cultivated papaya. We analyzed the levels and patterns of genetic diversity at the CYC-b locus and six loci in a 100-kb region flanking CYC-b and compared these to genetic diversity levels at neutral autosomal loci. The evolutionary relationships of CYC-b haplotypes were assessed using haplotype network analysis of the CYC-b locus and the 100-kb CYC-b region. Genetic diversity at the recessive CYC-b allele (y) was much lower relative to the dominant Y allele found in yellow-fleshed wild and cultivated papaya due to a strong selective sweep. Haplotype network analyses suggest the y allele most likely arose in the wild and was introduced into domesticated varieties after the first papaya domestication event. The shared haplotype structure between some wild, feral, and cultivated haplotypes around the y allele supports subsequent escape of this allele from red cultivars back into wild populations through feral intermediates. Our study supports a protracted domestication process of papaya through the introgression of wild-derived traits and gene flow from cultivars to wild populations. Evidence of gene flow from cultivars to wild populations through feral intermediates has implications for the introduction of transgenic papaya into Central American countries.

Converted carotenoid production in Dunaliella salina by using cyclization inhibitors 2-methylimidazole and 3-amino-1,2,4-triazole

Carotenoids are vital for most photosynthetic organisms because of their crucial role in prevention of the damage caused by excess light or stress conditions like heat or nutrient deprivation. Some of them are also valuable for biotechnology with respect to their colorful feature and antioxidant properties. In this study, a natural β-carotene producer, green microalga Dunaliella salina, was evaluated for its potential to produce different valuable carotenoids through the inhibition of cyclization reactions in the carotenoid pathway by the chemical inhibitors 2-methylimidazole (2MI) and 3-amino-1,2,4-triazole (Amitrol). 2MI was shown to be effective on lutein accumulation in D. salina cultures grown at high temperature, without affecting cell viability. Addition of 2MI to the culture at 1 mM concentration resulted a 1.7-fold increase in lutein content in the cell with the highest amount of 3.45 pg/cell, and an associated decrease in β-carotene content suggesting that this inhibitor is more effective on lycopene beta-cyclase activity, thus shifting the pathway from β-carotene arm to the α-carotene direction. The results of this study may give the opportunity to use D. salina for the production of valuable carotenoids other than β-carotene.