Longer Amplicons Research Articles

Comprehensive evaluation of UV inactivation of E. coli using multiple gene targets and real-time quantitative PCR

UV disinfection is extensively used for wastewater disinfection and disinfection efficiency is commonly monitored using culture-based enumeration of E. coli. While culture-independent real-time quantitative polymerase chain reaction (qPCR) based methods are attractive due to faster turnaround and easier application, previous attempts with qPCR to monitor disinfection have been unsuccessful. In this study, the effect of UV irradiation on a pure E. coli culture was examined in collimated beam (CB) experiments and monitored using both a culturing technique and DNA damage quantified using both short amplicon (SA; <∼200 bp) qPCR and longer amplicon (LA; ∼500-bp) qPCR. The results, covering a UV dose range of 0 - 20 mJ/cm2 commonly used for wastewater disinfection, indicate a correlation between DNA gene damage quantified by both SA- and LA-qPCR and the decline in E. coli observed through culture-based methods. This demonstrates the potential of qPCR to serve as rapid alternative for monitoring wastewater disinfection efficacy. Furthermore, LA-qPCR was observed to be more sensitive than SA-qPCR. The results using LA-qPCR also revealed that UV exposure caused widespread and indiscriminate damage to E. coli’s genome, which is considered critical for its function and survival. The combined effect of UV on E. coli’s ability to function, grow or repair damage is suggested as the reason for the decline in culturability observed.

Long-read MinION™ sequencing of 16S and 16S-ITS-23S rRNA genes provides species-level resolution of Lactobacillaceae in mixed communities.

The Lactobacillaceae are lactic acid bacteria harnessed to deliver important outcomes across numerous industries, and their unambiguous, species-level identification from mixed community environments is an important endeavor. Amplicon-based metataxonomics using short-read sequencing of partial 16S rRNA gene regions is widely used to support this, however, the high genetic similarity among Lactobacillaceae species restricts our ability to confidently describe these communities even at genus level. Long-read sequencing (LRS) of the whole 16S rRNA gene or the near complete rRNA operon (16S-ITS-23S) has the potential to improve this. We explored species ambiguity amongst Lactobacillaceae using in-silico tool RibDif2, which identified allele overlap when various partial and complete 16S rRNA gene and 16S-ITS-23S rRNA regions were amplified. We subsequently implemented LRS by MinION™ to compare the capacity of V3-V4, 16S and 16S-ITS-23S rRNA amplicons to accurately describe the diversity of a 20-species Lactobacillaceae mock community in practice. In-silico analysis identified more instances of allele/species overlap with V3-V4 amplicons (n = 43) compared to the 16S rRNA gene (n = 11) and partial (n = up to 15) or complete (n = 0) 16S-ITS-23S rRNA amplicons. With subsequent LRS of a DNA mock community, 80% of target species were identified using V3-V4 amplicons whilst the 16S rRNA gene and 16S-ITS-23S rRNA region amplicons resulted in 95 and 100% of target species being identified. A considerable reduction in false-positive identifications was also seen with 16S rRNA gene (n = 3) and 16S-ITS-23S rRNA region (n = 9) amplicons compared with V3-V4 amplicons (n = 43). Whilst the target species affected by allele overlap in V3-V4 and 16S rRNA gene sequenced mock communities were predicted by RibDif2, unpredicted species ambiguity was observed in 16S-ITS-23S rRNA sequenced communities. Considering the average nucleotide identity (ANI) between ambiguous species (~97%) and the basecall accuracy of our MinION™ sequencing protocol (96.4%), the misassignment of reads between closely related taxa is to be expected. With basecall accuracy exceeding 99% for recent MinION™ releases, the increased species-level differentiating power promised by longer amplicons like the 16S-ITS-23S rRNA region, may soon be fully realized.

DNA metabarcoding of light trap samples vs. morphological species identification

Abstract DNA metabarcoding has developed into a commonly used tool for biodiversity assessment and monitoring. How results from DNA metabarcoding are compared with studies based on ‘classic’, in most cases morphological species identification, is still unclear. Studies investigating species detection against a known baseline are virtually non‐existent. In this study, we used light trap samples collected in eastern Austria to investigate the concordance between morphological species lists and results obtained from COI metabarcoding using the Illumina MiSeq platform. Two primer combinations of different lengths (313 and 205 bp) were compared to assess the influence of amplicon length. Species detection rates ranged between 0.38 and 0.69; the shorter amplicon had on average higher species detection rates compared with the longer amplicon. Singleton species were less likely to be detected through metabarcoding. The major determinant for a species to be detected was its biomass, viz. smaller species had a lower chance to be detected. However, there is also evidence of taxonomic bias on the level of superfamilies. While the influence of biomass is to be expected, the presence of taxonomic bias gives reason for concern and requires further studies. Such a bias can be of significance when metabarcoding is used to determine conservation measures. Ordination analyses of all sampling sites showed that as far as community ecology is concerned, the overall pattern obtained from the full species list was mostly preserved in our metabarcoding results.

Detecting DNA damage in stored blood samples

Several commercially available quantitative real-time PCR (qPCR) systems enable highly sensitive detection of human DNA and provide a degradation index (DI) to assess DNA quality. From routine casework in forensic genetics, it was observed that DNA degradation in forensic samples such as blood samples stored under sub-optimal conditions leads to visible effects in multiplex analyses of short tandem repeat markers (STRs) due to decreased amplification efficiencies in longer amplicons. It was further noticed that degradation indices often remain below the value that is considered to be critical. Thus, the aim of this work was to systematically analyze this effect and to compare conventional qPCR assays with a modified qPCR approach using uracil DNA glycosylase (UNG) and DNA quality assessment methods based on electrophoresis. Blood samples were stored at three different storage temperatures for up to 316 days. Significantly increased DNA recovery was observed from samples stored at high temperatures (37 °C) compared samples stored at room temperature and 4 °C. We observed typical effects of degradation in STR analyses but no correlation between DI and storage time in any of the storage conditions. Adding UNG slightly increased the sensitivity of detecting DNA degradation in one of the qPCR kits used in this study. This observation was not confirmed when using a second qPCR system. Electrophoretic systems did also not reveal significant correlations between integrity values and time. Methods for detecting DNA degradation are usually limited to the detection of DNA fragmentation, and we conclude that degradation affecting forensic STR typing is more complex.

Limitations of qPCR to estimate DNA quantity: An RFU method to facilitate inter-laboratory comparisons for activity level, and general applicability

The application of qPCR to estimate the quantity of DNA present is usually based upon a short amplicon (typically c.80bp) and a longer amplicon (typically c.200–300bp) where the latter is used to determine the amount of degradation present in a sample. The data are used to make decisions about a) whether there is sufficient template to amplify? b) how much of the elution volume to forward to PCR? A typical multiplex amplifies template in the region of 100–500bp. Consequently, the results from an 80bp amplicon will tend to overestimate the actual amplifiable quantity that is present in a degraded sample. To compensate, a method is presented that relates the quantity of amplifiable DNA to the average RFU of the amplified fragments. This provides greatly improved accuracy of the estimated quantity of DNA present, which may differ by more than an order of magnitude compared to qPCR. The relative DNA quantities can be apportioned per contributor once mixture proportions are ascertained with probabilistic genotyping software (EuroForMix). The motivation for this work was to provide an improved method to generate data to prepare distributions that are used to inform activity level propositions. However, other applications will benefit, particularly those where extraction and quantification are bypassed: For example direct PCR and Rapid DNA technology. The overall aim of this work was to provide a method of quantification that is standardised and can be used to compare results between different laboratories that use different multiplexes. A software solution ”ShinyRFU” is provided to aid calculations.

The Effects of DNA Extraction Kits and Primers on Prokaryotic and Eukaryotic Microbial Community in Freshwater Sediments.

DNA based sequencing technology has revolutionized the field of microbial ecology and environmental studies. However, biases can be introduced at all experimental steps and, thus, affect the interpretation of microbial community. So far, previous studies on the biases introduced from the key steps of DNA extraction and primer sets mainly focused on the bacterial communities in soil or sediment samples, while little is known about the effect on the eukaryotic microbial communities. Here, we studied the effects of three different DNA extraction kits on both prokaryotic and micro-eukaryotic communities by 16S and 18S rRNA gene amplicon sequencing, and further disentangled the influence of primer choice on the micro-eukaryotic communities. Our results showed that the FastDNA SPIN Kit for Soil and DNeasy PowerSoil Kit produced much higher DNA yield with good reproducibility, and observed more eukaryotic OTUs compared to the MinkaGene DNA extraction kit, but all three kits exhibited comparable ability in recovering bacterial alpha diversity. Of the two primer sets, both targeting the V4 region of the 18S rRNA gene, the TAR primer set detected higher number of unique OTUs than the EK primer set, while the EK primer set resulted in longer amplicons and better reproducibility between replicates. Based on our findings, we recommend using the DNeasy PowerSoil Kit with the EK primer set to capture the abundant micro-eukaryotic taxa from freshwater sediment samples. If a more complete picture of the eukaryotic microbial community is desired, the TAR primer set in combination with the FastDNA SPIN Kit is more efficient in this study.

Rapid detection of viable Cronobacter sakazakii in powdered infant formula using improved propidium monoazide (PMAxx) and quantitative recombinase polymerase amplification (qRPA) assay

Cronobacter sakazakii is a common foodborne pathogen that may cause serious neonatal disease. The quantification of the viable bacteria is a major concern during food processing. The traditional culture-based method is time-consuming and laborious. In this work, the improved propidium monoazide (PMAxx) was successfully combined with real-time recombinase polymerase amplification (qRPA) and real-time polymerase chain reaction (qPCR) to quantify the viable C. sakazakii in spiked powdered infant formula (PIF). Primers specific for C. sakazakii were designed to amplify different sized fragments of the alpha-glucosidase (gluA) gene. The impact of amplicon size on differentiation of viable and heat-killed cells (90 °C, 15 min) was determined following PMAxx treatment. Results demonstrated that the developed PMAxx-qRPA and PMAxx-qPCR assay can distinguish viable and dead bacterial cells. The long amplicon (256 bp and 338 bp) significantly reduced the signal from dead cells compared to the short amplicon (110 bp and 128 bp, P < 0.05). The PMAxx-qRPA assay was completed within 20 min at 37 °C compared to the PMAxx-qPCR assay which required a longer reaction time and multiple temperature gradients to complete the amplification. The food matrix in PIF significantly affected the detection of viable cells in PMAxx-qPCR assay whereas not in PMAxx-qRPA assay (P < 0.05). When different number of viable cells (0 - 107 cfu/g) were mixed with dead cells (107 cfu/g) in the PIF matrix, both PMAxx-based assays eliminated the false-positive signals from the dead cells, and the quantitative results of PMAxx-qRPA assays for viable cells were consistent with the traditional culture-based method (P > 0.05). Thus, PMAxx-qRPA with longer amplicons can be used as an effective tool to quantify the viable C. sakazakii in complex food samples such as PIF, which greatly improve detection efficiency and can be a promising technique for risk assessments in food processing.

Abstract 2455: Single-color accurate and precise quantification of wild-type versus mutant allele using a novel integrated digital PCR platform

Abstract In this study we present a single-step, one-color quantification of mutant versus wild-type allele using a novel integrated, clinic-optimized digital PCR (dPCR) platform. Allelic variants in DNA or RNA can be distinguished and quantified using Polymerase Chain Reaction (PCR) in concert with intelligent primer and probe design. Most commonly, a researcher or clinician will use unlabeled forward and reverse primers that bind to conserved regions outside of the allelic variation in addition to two differently labeled hydrolysis probes that bind at the region of allelic variation. Here we describe a novel method that leverages the precision of digital PCR (dPCR) technology and requires only one-color fluorescence utilizing probe-free, intercalating dye chemistry. The expense in developing or purchasing a complete PCR assay is normally embedded in the cost of the fluorescently labeled probe. The method described here eliminates the need for the fluorescently labeled probe, thereby reducing chemistry cost. Furthermore, technical complexity is reduced by requiring only one-color fluorescence. In our assay, we use a common unlabeled reverse primer that binds downstream of the allelic variation. Two unlabeled, allele-specific forward primers bind preferentially to either the wild-type or mutant allele at the site of allelic variation. The mutant forward primer contains a non-annealing tail (ie: stretch of the DNA primer that does not anneal to the initial DNA template) that will cause the ultimate mutant PCR product to be longer than the wild-type product. Digital PCR is characterized by dividing up a bulk PCR reaction volume into thousands of fluidically isolated partitions or droplets. In the presence of an intercalating dye, a longer amplicon will result in a higher endpoint fluorescence in that specific dPCR partition. As such, using our novel assay, dPCR partitions containing mutant versus wild-type amplicons can be distinguished by differing levels of end-point partition fluorescence. In this study we used the BRAF gene and the clinically relevant BRAF V600E mutation to benchmark this assay using a novel integrated one-step dPCR platform. This dPCR platform consists of a single, fully-integrated instrument along with a novel micro-injection molded plastic consumable providing a simple, single-step workflow. The instrument is dry and contamination-free, making it an attractive instrument for easy transition to the clinic. Parameters including thermal-cycling time and primer concentration were serially optimized for the novel integrated dPCR platform. This work highlights that we can accurately and precisely quantify samples containing varying ratios of wild-type versus V600E BRAF down to 0.1% mutant/wild-type ratio using one color of fluorescence and a novel integrated single-step walkaway dPCR workflow. Citation Format: Megan E. Dueck, Christina Wood-Bouwens, Andrew Zayac, Robert Lin, Steve Gallagher, Hanlee Ji, Paul Hung. Single-color accurate and precise quantification of wild-type versus mutant allele using a novel integrated digital PCR platform [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2019; 2019 Mar 29-Apr 3; Atlanta, GA. Philadelphia (PA): AACR; Cancer Res 2019;79(13 Suppl):Abstract nr 2455.

Abstract 1243: Effect of antigen retrieval on immuno-based RNA microdissection methods

Abstract Introduction: Clinical applications and research studies routinely utilize immunohistochemistry (IHC) approaches on tissue sections. The aim is to selectively target antigens (proteins) in the cells of a tissue section by exploiting the principle of antibody binding, thus enabling target specificity. The antigen retrieval (AR) process employed at the beginning of most IHC protocols increases epitope availability and improves staining characteristics; however, the procedure can damage nucleic acids, in this case RNA, to an unknown extent. Experimental Procedures: To better understand the effects of AR on RNA quality and quantity, model system samples (lung cancer patient derived xenograft tissue) were subjected to a commonly employed AR method [heat induced epitope retrieval (HIER)] and the effects on RNA were assessed by Qubit, Fragment Analyzer, and digital droplet PCR (ddPCR). The ddPCR experiments were performed following reverse transcriptase (RT) product generation and construction of cDNA, which then served as input to the ddPCR assay. Absolute quantitation of gene expression levels and expressed mutations were evaluated by ddPCR. Data Summary: The results showed that HIER resulted in optimal staining characteristics, but induced significant damage to RNA, producing extensive fragmentation and decreased yields. In general, fragmentation showed an inflection point at ~200 nt transcript length. Variation in the HIER protocol mitigated but did not eliminate the negative effects. Apart from the AR procedure, the IHC process itself also resulted in a significant decreased yield of RNA. Of note, in these experiments DAB chromogen was used exclusively in the IHC process. However, in spite of the observed deleterious effects on RNA, none of the AR methods combined with IHC negatively affected RT product generation and PCR amplification of small amplicons. Regarding the detection of RT product under different conditions, the size of the amplicon was found to make a difference, with the detection of longer amplicons being more difficult. In addition to a number of successful human and mouse gene expression measurements, KRAS gene mutations were successfully identified in the clinical cases under all conditions. Conclusions: The data indicate that RNA recovered from histology slides after standard AR and IHC processing can be successfully employed for genomic applications utilizing RT product formation (cDNA) for gene expression and detection of expressed mutations, especially if the detection methods are based on relatively short length nucleic acids. Studies that require larger RNA fragments such as long-read sequencing should avoid the use of HIER. Citation Format: Donald J. Johann, Meeiyueh Liu, Adam Roberge, Sarah Laun, Michael Emmert-Buck, Michael Tangrea. Effect of antigen retrieval on immuno-based RNA microdissection methods [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2019; 2019 Mar 29-Apr 3; Atlanta, GA. Philadelphia (PA): AACR; Cancer Res 2019;79(13 Suppl):Abstract nr 1243.

PacBio metabarcoding of Fungi and other eukaryotes: errors, biases and perspectives.

Second-generation, high-throughput sequencing methods have greatly improved our understanding of the ecology of soil microorganisms, yet the short barcodes (<500bp) provide limited taxonomic and phylogenetic information for species discrimination and taxonomic assignment. Here, we utilized the third-generation Pacific Biosciences (PacBio) RSII and Sequel instruments to evaluate the suitability of full-length internal transcribed spacer (ITS) barcodes and longer rRNA gene amplicons for metabarcoding Fungi, Oomycetes and other eukaryotes in soil samples. Metabarcoding revealed multiple errors and biases: Taq polymerase substitution errors and mis-incorporating indels in sequencing homopolymers constitute major errors; sequence length biases occur during PCR, library preparation, loading to the sequencing instrument and quality filtering; primer-template mismatches bias the taxonomic profile when using regular and highly degenerate primers. The RSII and Sequel platforms enable the sequencing of amplicons up to 3000 bp, but the sequence quality remains slightly inferior to Illumina sequencing especially in longer amplicons. The full ITS barcode and flanking rRNA small subunit gene greatly improve taxonomic identification at the species and phylum levels, respectively. We conclude that PacBio sequencing provides a viable alternative for metabarcoding of organisms that are of relatively low diversity, require >500-bp barcode for reliable identification or when phylogenetic approaches are intended.

P185 Next generation sequencing of HLA class II in an argentinian registry population reveals the complexity of these loci

Aim This study used next generation sequencing (NGS) in 1472 healthy volunteers from an Argentinian registry to characterize class II gene diversity. Complications of using NGS for these regions arise from large introns, different length alleles, regions with few polymorphisms, and incomplete sequences in the IPD-IMGT/HLA database. Methods Amplicons were generated to include exons 2–6 of HLA-DQB1, and exons 2–3 of -DRB1 and -DPB1 using DNA extracted from blood. Samples were combined and sequenced on an Illumina MiSeq with an in-house library construction protocol. Conexio Assign was used to identify alleles based on the IPD-IMGT/HLA database from October 2016. Full length gene sequencing of select samples was performed with two overlapping amplicons for HLA-DPB1 and -DRB1. Results The majority of the alleles identified at each locus were common with ⩽1% of alleles per gene designated as well-documented or with frequency not defined. With only exons 2–3 sequenced, 6% of HLA-DRB1 assignments and 11% of -DPB1 were ambiguous. When additional exons were sequenced, most showed the common allele; however, DPB1∗104:01 was seen in 16% of samples typed as DPB1∗03:FNVX. For HLA-DRB1, preferential amplification due to differences in allele size and presence of pseudogenes led to certain alleles with low read depth and poor sequence quality, in particular DRB1∗04. Analysis of HLA-DQB1 introns proved difficult due to insertions and deletions that poorly aligned to the reference. Intron 2 of HLA-DPB1 is large and has few variations between certain combinations of alleles that were not phased in 14% of samples. These were not resolved with full length sequencing. Conclusions Although conditions still need to be optimized, NGS of HLA class II is a powerful tool in determining genetic diversity. HLA-DRB1 ambiguities would be reduced by 82% with the initial sequencing of exons 2–4; however, longer amplicons reduce read depth. Addition of primers to maximize amplification of low amplifying alleles may be necessary to increase read depth. Alternate methodology such as sequencing of single DNA molecules is necessary to solve the ambiguities for alleles that are not phased. These proposed changes will lead to more successful sequencing of HLA class II. Even so, these complications make NGS challenging when applied to high volume typing.

The effect of long-term −80°C storage of thyroid biospecimens on RNA quality and ensuring fitness for purpose

AimsTo establish whether RNA degrades in long-term storage at −80°C and whether RNA integrity numbers (RINs) determine ‘fitness for purpose’ in severely degraded RNA.MethodsRNA was extracted from 549 thyroid biospecimens...

Mitochondrial DNA Fragmentation to Monitor Processing Parameters in High Acid, Plant-Derived Foods.

Mitochondrial DNA (mtDNA) fragmentation was assessed in acidified foods. Using quantitative polymerase chain reaction, Ct values measured from fresh, fermented, pasteurized, and stored cucumber mtDNA were determined to be significantly different (P > 0.05) based on processing and shelf-life. This indicated that the combination of lower temperature thermal processes (hot-fill at 75 °C for 15 min) and acidified conditions (pH = 3.8) was sufficient to cause mtDNA fragmentation. In studies modeling high acid juices, pasteurization (96 °C, 0 to 24 min) of tomato serum produced Ct values which had high correlation to time-temperature treatment. Primers producing longer amplicons (approximately 1 kb) targeting the same mitochondrial gene gave greater sensitivity in correlating time-temperature treatments to Ct values. Lab-scale pasteurization studies using Ct values derived from the longer amplicon differentiated between heat treatments of tomato serum (95 °C for <2 min). MtDNA fragmentation was shown to be a potential new tool to characterize low temperature (<100 °C) high acid processes (pH < 4.6), nonthermal processes such as vegetable fermentation and holding times of acidified, plant-derived products.

PCR-based Y chromosome marker for discriminating between golden jackal (Canis aureus) and domestic dog (Canis lupus familiaris) paternal ancestry

Numerous reports of hybridization between wild Canis species and domestic dog suggest that hybridization between golden jackal and dog is likely. Here we present an assay of a Y chromosome marker for discriminating between golden jackal (Canis aureus) and dog (Canis lupus familiaris) paternal ancestry. Taking advantage of an insertion found in a dog Zfy intron haplotype but not in a golden jackal haplotype, we developed a three-primer PCR system in which species are differentiated based on the number of amplicons. Two amplicons are produced from domestic dog DNA template, while one amplicon is produced from golden jackal DNA template. Both amplicons can be analyzed in a single agarose gel electrophoresis run, while the longer amplicon also serves as an internal control. The method was validated using 27 golden jackal and 25 dog samples; all samples showed the expected amplicons. This simple and cost-effective method should prove useful for determining the direction of golden jackal–dog hybridization.

Improved analysis of long STR amplicons from degraded single source and mixed DNA

DNA profiles from degraded samples often suffer from information loss at the longer short tandem repeat (STR) loci. Sensitising the reactions, either by performing additional PCR cycles or increasing the capillary electrophoresis injection settings, carries the risk of over-amplifying or overloading the shorter fragments. We explored whether profiling of degraded DNA can be improved by preferential capturing of the longer amplified fragments. To this aim, a post-PCR purification protocol was developed that is based on AMPure XP beads that have size-selective properties. A comparison was made with an unselective post-PCR purification system (DTR gel filtration) and no purification of the PCR products. Besides a set of differently and serially degraded single source samples, unequal mixtures of degraded DNAs were analysed, in order to extract more genotyping information for the minor contributor without overloading the major component at the shorter amplicons. Purification by the AMPure protocol resulted in higher peak heights especially for the longer amplicons, while DTR gel filtration gave higher peaks for all amplicon sizes. Both purification methods presented more detected alleles, with the AMPure protocol performing slightly better, on average. In conclusion, the in-house developed AMPure protocol can be employed to improve STR profile analysis of degraded single source and (unequally) mixed DNA samples.

Zygosity Determination in Hairless Mice by PCR Based on &lt;i&gt;Hr&lt;sup&gt;hr&lt;/sup&gt;&lt;/i&gt; Gene Analysis

We analyzed the Hr gene of a hairless mouse strain of unknown origin (HR strain, http://animal.nibio.go.jp/e_hr.html) to determine whether the strain shares a mutation with other hairless strains, such as HRS/J and Skh:HR-1, both of which have an Hrhr allele. Using PCR with multiple pairs of primers designed to amplify multiple overlapping regions covering the entire Hr gene, we found an insertion mutation in intron 6 of mutant Hr genes in HR mice. The DNA sequence flanking the mutation indicated that the mutation in HR mice was the same as that of Hrhr in the HRS/J strain. Based on the sequence, we developed a genotyping method using PCR to determine zygosities. Three primers were designed: S776 (GGTCTCGCTGGTCCTTGA), S607 (TCTGGAACCAGAGTGACAGACAGCTA), and R850 (TGGGCCACCATGGCCAGATTTAACACA). The S776 and R850 primers detected the Hrhr allele (275-bp amplicon), and S607 and R850 identified the wild-type Hr allele (244-bp amplicon). Applying PCR using these three primers, we confirmed that it is possible to differentiate among homozygous Hrhr (longer amplicons only), homozygous wild-type Hr(shorter amplicons only), and heterozygous (both amplicons) in HR and Hos:HR-1 mice. Our genomic analysis indicated that the HR, HRS/J, and Hos:HR-1 strains, and possibly Skh:HR-1 (an ancestor of Hos:HR-1) strain share the same Hrhr gene mutation. Our genotyping method will facilitate further research using hairless mice, and especially immature mice, because pups can be genotyped before their phenotype (hair coat loss) appears at about 2 weeks of age.

New primers to amplify the fungal ITS2 region - evaluation by 454-sequencing of artificial and natural communities

With recent methodological advances, molecular markers are increasingly used for semi-quantitative analyses of fungal communities. The aim to preserve quantitative relationships between genotypes through PCR places new demands on primers to accurately match target sites and provide short amplicons. The internal transcribed spacer (ITS) region of the ribosome encoding genes is a commonly used marker for many fungal groups. Here, we describe three new primers - fITS7, gITS7 and fITS9, which may be used to amplify the fungal ITS2 region by targeting sites in the 5.8S encoding gene. We evaluated the primers and compared their performance with the commonly used ITS1f primer by 454-sequencing of both artificially assembled templates and field samples. When the entire ITS region was amplified using the ITS1f/ITS4 primer combination, we found strong bias against species with longer amplicons. This problem could be overcome by using the new primers, which produce shorter amplicons and better preserve the quantitative composition of the template. In addition, the new primers yielded more diverse amplicon communities than the ITS1f primer.

Accuracy in Copy Number Calling by qPCR and PRT: A Matter of DNA

The possible implication of copy number variation (CNV) in the genetic susceptibility to human disease needs to be assessed using robust methods that can be applied at a population scale. In this report, we analyze the performance of the two major techniques, quantitative PCR (qPCR) and paralog ratio test (PRT), and investigate the influence of input DNA amount and template integrity on the reliability of both methods. Analysis of three genes (PRELID1, SYNPO and DEFB4) in a large sample set showed that both methods are prone to false copy number assignments if sufficient attention is not paid to DNA concentration and quality. Accurate normalization of samples is essential for reproducible qPCR because it avoids the effect of differential amplification efficiencies between target and control assays, whereas PRT is generally more sensitive to template degradation due to the fact that longer amplicons are usually needed to optimize sensitivity and specificity of paralog sequence PCR. The use of normalized, high quality genomic DNA yields comparable results with both methods.

TP53 Alterations Including Missense Mutations, Aberrant Exon-Junctions and Internal Intron Retentions Are Frequent and May Contribute to MDM2 Antagonist-Resistance in B-Acute Lymphoblastic leukemia

Abstract 1484MDM2, a p53-inducible phosphoprotein, binds to the N-terminus of the p53 and negatively regulates its transcriptional activity. New MDM2 antagonists, such as RO5045337 (Roche) and NSC-66811 (Merck), are now available for Phase I/II clinical development, but their activity is dependent on TP53 mutation status. Therefore, in order to efficiently treat B-progenitor acute lymphoblastic leukemia (ALL) patients with an MDM2 antagonist, we set up a sensitive assay to identify TP53 lesions.Deletions and uniparental disomy (UPD) involving TP53 were assessed on 146 DNA samples from Philadelphia-positive (Ph+)(n = 126) and Ph-negative (n = 20) ALL patients by Genome-Wide Human SNP 6.0 array (Affymetrix). No 17p UPD events were detected whereas losses were identified in 2% of cases.Mutations of TP53 were thereafter investigated in 67 samples including 60 Ph+ and 7 Ph-negative cases. Since the majority of the studies in leukemia were focused on genomic alterations and resulted in low rate of TP53 mutations, we aimed to identify RNA mutations and aberrant isoforms due to other mechanisms, such as RNA editing. To this purpose three overlapping shorter amplicons covering the entire coding cDNA sequence (GenBank accession number NM_000546.4) and the untranslated exon 1 [amplicon 1 (491 bp): exons 1–5; amplicon 2 (482 bp): exons 5–8; amplicon 3 (498 bp): exons 8–11)] and a longer amplicon (1,317 bp) starting from exon 1 and ending to exon 11 were sequenced by Sanger method. TP53 mutations were detected in only 6 cases (8.9%), suggesting that these alterations are apparently rare events in B-ALL. They included 4 missense point mutations in the DNA binding domain and in the carboxyl-terminal tetramerization and regulatory domain: C135Y (ex 5), A234T (ex 7), R290C (ex 8) and A347T (ex 10). Interestingly, in two cases we identified aberrant transcripts: 1) a TP53 isoform characterized by retention of introns 5–6–7 and predicted to encode for a truncated protein due a premature stop codon; 2) a TP53 isoform in which the DNA binding domain is lost due to an exon conjunction between the exon 4 and the 3’ untraslated region (UTR)(ex4-3’UTR: 7579533–7572842, according to GRCh37/hg19).Next, in order to investigate if low rate of mutations were detectable, we also analyzed our whole transcriptome data obtained using next generation sequencing technology (Illumina/Solexa Genome Analyzer) on 3 Ph+ ALL patients. Curiously, all patients harbored clones ranging from 45% to 94% with TP53 mutations in the DNA binding and tetramerization domains: C182W (ex 5), T231A (ex 7), L330R (ex 9) in the first patient and Stop394S, D393V/H and G389Y/V (ex 11) in the second one. Moreover, in the first and third patient we detected 10 and 13 base exchanges, respectively, located in intron 6 within 7578166–7578142 region, suggesting a retention of this intron in the primary transcript and the dysfunction of the DNA-binding domain. The mechanism of intron retention (with or without mutations) was particularly intrigued since it could be a new mechanism of functional inactivation of TP53. To address this hypothesis we performed amplification of TP53 cDNA followed by single cell cloning and subsequent direct sequencing in 4 patients previously resulted wild-type by Sanger sequencing for TP53. By this approach, all patients showed cDNA alterations. In one case we identified the missense mutation S90P (ex 4) and an aberrant isoform lacking the DNA binding domain and caused by an exon-junction between exons 2 and 7 (ex2-7: 7579866–7577510). In a second patient the P190S (ex 6) and N235S (ex 7) missense mutations were detected. Moreover, an aberrant isoform lacking the DNA binding domain and characterized by an exon-junction between the first part of exon 4 and the last part of exon 7 (ex4-7: 7579581–7577532) was also identified. In the third patient the E285G (ex 8) was found associated with a 3’-UTR base exchange, which was also detected in the remaining fourth patient. In conclusion, we demonstrate for the first time that TP53 alterations at the RNA level, including missense mutations, aberrant exon junctions and internal intron retentions are highly frequent in B-ALL patients and that testing for TP53 mutations with sensitive assay based on RNA analysis is absolutely required. Supported by European LeukemiaNet, AIL, AIRC, Fondazione Del Monte di Bologna e Ravenna, FIRB 2006, PRIN 2009, Ateneo RFO grants, PIO program, Programma di Ricerca Regione – Università 2007 – 2009. Disclosures:Soverini:Novartis: Consultancy; ARIAD: Consultancy; Bristol-Myers Squibb: Consultancy. Baccarani:Pfizer Oncology: Consultancy; Novartis: Consultancy; BMS: Consultancy; Ariad: Consultancy; Novartis: Research Funding; Pfizer Oncology: Honoraria; Novartis: Honoraria; BMS: Honoraria; Ariad: Honoraria; Novartis: Membership on an entity's Board of Directors or advisory committees; BMS: Membership on an entity's Board of Directors or advisory committees; Ariad: Membership on an entity's Board of Directors or advisory committees. Martinelli:Novartis: Consultancy, Honoraria; BMS: Consultancy, Honoraria; Pfizer: Consultancy.

Nucleic acid quantity and quality from paraffin blocks: Defining optimal fixation, processing and DNA/RNA extraction techniques

Although the extraction and analysis of nucleic acids from formalin-fixed paraffin-embedded tissues is a routine and growing part of pathology practice, no generally accepted recommendations exist to guide laboratories in their selection of tissue fixation, processing and DNA/RNA extraction techniques. The aim of this study was to determine how fixation method and length, paraffin embedding, processing conditions and nucleic acid extraction methods affect quality and quantity of DNA and RNA, and their performance in downstream applications. Nine tissue samples were subjected to freezing, fixation in formalin for <24h and 7days followed by conventional processing, and fixation in molecular fixative for <24h and 7days followed by rapid processing. DNA and RNA were isolated using in-house extraction and commercial kits, and assessed by PCR reactions for amplicons with varying sizes ranging from 268 to 1327bp and one-step RT-PCR for 621bp and 816bp amplicons of housekeeping genes. Molecular fixative (MF) appeared to perform well under nearly all circumstances (extraction methods, fixation lengths and longer amplicons), often performing as well as frozen samples. Formalin fixation generally performed well only for shorter length amplicons and short fixation (<24h). WaxFree kit showed consistently higher success rates for DNA and poorer rates for RNA. RecoverAll kit generally performed suboptimally in combination with prolonged formalin fixation. In conclusion, the Molecular Fixative regardless of fixation length, and the rapid tissue processing system were able to preserve large DNA and RNA fragments in paraffin blocks, making these techniques preferable for use in downstream molecular diagnostic assays.