Lily Symptomless Virus Research Articles

First Report of Olive Mild Mosaic Virus in Imported Tulips (Tulipa gesneriana) in Korea.

Tulip cultivation in Korea primarily uses imported bulbs due to the absence of domestic production. To ensure safety and sustainability, Korean authorities have implemented strict phytosanitary measures for five viruses: arabis mosaic virus, tobacco necrosis virus, tobacco ringspot virus, tomato black ring virus, and tomato bushy stunt virus. In April 2021, 86 tulip plants presented symptoms such as chlorotic mottle, mosaic, streak, stripe, yellowing of the leaves, and color breaking on flowers. These samples were collected to investigate the incidence of viruses in four Korean provinces (Gangwon, Gyeongbuk, Gyeongnam, and Chungnam). The leaves and petals from each individual sample (10 mg each) were pooled and ground using liquid nitrogen. Total RNA was extracted using a Maxwell® 16 LEV Plant RNA Kit (Promega, Madison, USA). A cDNA library was constructed using TruSeq Standard Total RNA with Ribo - Zero (Illumina, San Diego, USA) and sequenced on an Illumina NovaSeq 6000 platform (Macrogen, Seoul, Korea) with 100-bp paired-end reads. Trinity software identified tulip breaking virus (TBV), tulip virus X (TVX), and lily symptomless virus (LSV), which are known to occur in Korea (Bak et al. 2023) by de novo assembly of 628 million reads into 498,795 contigs. The contigs were annotated as previously described (Bak et al. 2022). Moreover, a contig (ON758350) related to olive mild mosaic virus (OMMV; genus Alphanecrovirus, family Tombusviridae) was identified through BLASTn analysis. This contig had a 99.27% nucleotide (nt) identity to OMMV PPO-L190209 (KU641010), which was assembled from 201,346 reads and spanned 3,713 bp. To confirm the presence of OMMV, a primer pair (5'-GAATGTCTGGCGTTAAGCG-3'/5'-GTGTCCTGCGCATCATACAC-3') was designed to amplify a 797-bp fragment of the coat protein gene. In RT-PCR, 31.4% (27/86) of samples were positive for OMMV and coinfected with TBV or TBV+LSV. Coinfection with TBV led to chlorotic mottling and stripes, whereas triple coinfection with TBV+LSV produced distinct yellow streaks and mosaic within the lesion boundaries. In contrast, solely TBV infection did not produce such symptoms. The samples infected with OMMV were exclusively collected from Gangwon and Gyeongnam. In each province, an RT-PCR amplicon was cloned, and subsequently sequenced (Bioneer, Daejeon, Korea). The obtained sequences were named CC (OM243091) and GS (OM243092), and they shared 98.6% and 98.9% identity with PPO-L190209 (KU641010), respectively. A bioassay was conducted using a leaf infected with OMMV CC and TBV to inoculate 13 indicator species in triplicate, including Capsicum annuum, Chenopodium amaranticolor, C. quinoa, Cucumis sativus, Nicotiana benthamiana, N. clevelandii, N. glutinosa, N. occidentalis, N. rustica, N. tabacum, Solanum lycopersicum, Tetragonia tetragonioides, and Tulipa gesneriana. The RT-PCR revealed positivity only for OMMV in the upper leaves of N. clevelandii, while all other species were negative with no symptoms. To our knowledge, this is the first report of OMMV occurring in tulips grown from imported bulbs in Korea, with no other known natural hosts such as olive tree (Cardoso et al. 2004), spinach (Gratsia et al. 2012), and corn salad (Verdin et al. 2018). The Korean OMMV isolates exhibited a high nt identity with the foreign isolate, and the samples were collected from farms that rely entirely on bulb imports for cultivation. These suggest that the outbreak of OMMV was likely caused by imported bulbs.

First report of Tulip Virus X infecting tulip (Tulipa gesneriana) in Korea.

Tulip virus X (tulip virus X, TVX) is a member of the genus Potexvirus (family Alphaflexiviridae) and is a positive single-stranded RNA virus. TVX was described first in Scotland (Mowat 1982), followed by several countries (Yamaji et al. 2001; Tzanetakis et al. 2005; Ward et al. 2008; Dees et al. 2011; Sochacki and Komorowska 2012; Wylie et al. 2019). In April 2021, 86 whole tulip plants showing viral symptoms in leaves (mosaic, yellowing, and malformation) and flowers (color breaking) were collected in Chilgok, Chuncheon, Goseong, Yecheon and Yesan, Korea. Furthermore, high-throughput sequencing was performed to identify viruses that infect tulips in Korea. Total RNA was extracted from pooled the leaves and petals using a Maxwell® 16 LEV Plant RNA Kit (Promega, Madison, USA). We constructed a single library using the TruSeq Stranded Total RNA LT Sample Prep Kit for Plant (Illumina, San Diego, USA). The library was 100 bp paired-end sequenced using Illumina's NovaSeq 6000 (Macrogen, Seoul, Korea) and was assembled de novo using Trinity software version trinityrnaseq_r20140717, with default parameters. The contigs were annotated as in previous study (Lee et al. 2020), revealing a single contig each related to TVX, lily symptomless virus (LSV), and tulip breaking virus (TBV) was generated from 648 million total reads. The TVX-related contig (GenBank ON205948) consisting of 6,076 bp showed 99.52% nucleotide identity (6027/6056 bp) with TVX-J (GenBank AB066288). We conducted an RT-PCR assay to validate the presence of viruses with specific primers as TVX-F5093/R5624 (5'-CTATCCGGACTCATTCTACTTC/GTGCGTTCCAGATAAGCTTG-3'), LSV-F7013/R7338 (5'-CTTGGTCGACAGGGACATAAC/GATTGGAATTGTGCTTTTCAGC-3'), and TBV-F7515/R8116 (5'-GTGTGTCATGGATGATTGTTG/CAACTGATTTGCTACCGCTAG-3'). Consequently, TVX were detected in 13 of 86 samples. Moreover, LSV and TBV were detected in 15 and 26 samples, respectively. However, the yellowing and mosaic observed in the TVX infected samples were not observed in the LSV and TBV infected samples. Subsequently, two TVX amplicons were selected, cloned and sequenced. The obtained sequences were 532 bp and were named YS24 and YS38 (GenBank LC664027 and LC664028), respectively. The Korean isolates showed 98.68% (525/532 bp) and 99.62% (530/532 bp) identity with Australian isolate (GenBank MH886522) in BLASTn analysis. To bioassay for TVX, the infected tulip leaf tissue from which YS24 was obtained was used to sap-inoculate, in triplicates, 15 species of indicator plants (Nicotiana benthamiana, N. clevelandii, N. debneyi, N. glutinosa, N. rustica, N. tabacum, Datura stramonium, Glycine max, Phaseolus vulgaris, Chenopodium amaranticolor, C. quinoa, Cucumis sativus, Cu. melo, Gomphrena globosa, and Tetragonia tetragonioides). After 14 days of inoculation, we observed distinct chlorotic spots on inoculated and upper leaves of C. quinoa, but no symptoms were observed in other indicator plants. In RT-PCR assay using TVX-specific primers, only C. quinoa showed a positive reaction. In previous studies, C. amaranticolor, C. quinoa, G. globosa, and N. benthamiana were known as the experimental host of TVX (Dees et al. 2011; Tzanetakis et al. 2005), but only C. quinoa was confirmed to be susceptible to the Korean isolate. Furthermore, transmission electron microscopy revealed typical flexuous rod-shaped viral particles in the inoculated C. quinoa. To our knowledge, this is the first report of TVX infecting tulips in Korea.

Development of a multiplex RT-PCR assay for simultaneous detection of Lily symptomless virus, Lily mottle virus, Cucumber mosaic virus, and Plantago asiatica mosaic virus in Lilies

BackgroundViral pathogens causing significant economic losses in lilies (Lilium spp. and hybrids) include Lily symptomless virus (LSV), Lily mottle virus (LMoV), Cucumber mosaic virus (CMV), and Plantago asiatica mosaic virus (PlAMV). Rapid and efficient virus detection methods are pivotal to prevent the spread of these viruses.ResultsIn this study, four specific primer pairs designed from conserved regions of genomic sequences of each virus were used to amplify a 116 bp product for LSV, a 247 bp product for LMoV, a 359 bp product for CMV, and a 525 bp product for PlAMV in a multiplex reverse transcription-polymerase chain reaction (multiplex RT-PCR). The amplified products were clearly separated by 2% agarose gel electrophoresis. The optimal reaction annealing temperature and cycle number were 53.8 °C and 35, respectively. The developed multiplex RT-PCR method was then used to test virus infections from lily samples collected from different regions of China.ConclusionsAn effective multiplex RT-PCR assay was established for the simultaneous detection and differentiation of LSV, LMoV, CMV, and PlAMV in lilies, which offers a useful tool for routine molecular diagnosis and epidemiological studies of these viruses.

Garden Lupin (Lupinus polyphyllus) Is a New Natural Host of Lily Symptomless Virus in Korea.

Lupinus polyphyllus (Fabaceae), commonly known as garden lupin, is cultivated for commercial, private, and gardening purposes in many countries in Europe, North America, and Asia (Ramula and Kalske 2020). No previous studies have reported viruses infecting L. polyphyllus in the Republic of Korea. In May 2021, virus-like symptoms such as stunting, chlorotic striping, and mosaic were observed on the leaves of L. polyphyllus at the Suncheonman National Garden in Suncheon, South Korea; the disease incidence was estimated to be between 10 and 20%. These symptoms were similar to those observed in lily plants infected by lily symptomless virus (LSV) (Singh et al. 2005, Flores et al. 2019). Several different species of Lilium, including lilies, were grown in the same garden with L. polyphyllus on the adjacent block. Only carlavirus-like filamentous particles (approximately 610-700 nm in length and 12-15 nm in diameter) were observed using transmission electron microscopy in negatively stained extracts from five symptomatic samples. To further investigate the causative virus, a total of 20 symptomatic leaves were collected from 20 different L. polyphyllus plants and tested by DAS-ELISA using polyclonal antibodies against viruses infecting plants from the Lilium genus, including arabis mosaic virus, cucumber mosaic virus, LSV, lily mottle virus, and plantago asiatica mosaic virus (Agdia, Elkhart, IN, USA). Commercial positive and negative controls and extract from healthy L. polyphyllus tissue were included in each ELISA. The serological analyses showed that all symptomatic samples were positive only for LSV, but not for other viruses. To further confirm LSV infection, total RNA was extracted from 10 ELISA-positive plants and two healthy L. polyphyllus plants (negative control) using Clear-S Total RNA extraction kit (InVirusTech Co., Gwangju, Korea). RT-PCRs were performed using LSV coat protein (CP) specific primers, LSV1 (5'-CACATATGCAATCAAGACCAGCAC-3') and LSV2 (5'-GAGGATCCTCATCCATTATTTGCGTATC-3'), designed to amplify an 876-nt fragment of the CP gene (Lim et al. 2009). A DNA fragment of the expected size was amplified from only the ten symptomatic leaves. Three amplified RT-PCR products were cloned into the pGEM-T Easy Vector (Promega, Madison, WI) and sequenced. The sequences obtained from each amplicon showed 100% sequence identity; a single representative sequence was deposited to GenBank (LC649240). Pairwise nucleotide sequence analysis revealed that this LSV isolate LP2 had 99% nucleotide and 100% amino acid identity with Lilium longiflorum LSV isolate from South Korea (JX962776). To fulfill Koch's postulates, sap from an LSV-positive L. polyphyllus plant was inoculated to 10 young healthy L. polyphyllus plants. At 14 days post-inoculation, all the inoculated plants showed typical symptoms of LSV infection, such as mild vein-clearing and mosaic (Asjes 2000). The LSV infection in the inoculated plants was confirmed by RT-PCR using the aforementioned primers and sequencing of the 876-nt amplicons. To the best of our knowledge, this is the first report of LSV naturally infecting L. polyphyllus in the Republic of Korea. LSV could negatively impact the quality of L. polyphyllus and trade. Thus, it is important to investigate the extent of its distribution in South Korea and how it can be effectively managed.

Application of Multiplex TaqMan Real-Time PCR Assay in Survey of Five Lily Viruses Infecting Lilium spp.

Lily symptomless virus (LSV), Lily mottle virus (LMoV), Cucumber mosaic virus (CMV), Shallot yellow stripe virus (SYSV), and Plantago asiatica mosaic virus (PlAMV) are five of the economically important viruses infecting lilies (Lilium spp.) worldwide. In order to prevent the occurrence and spread of these viruses, it is necessary to develop a rapid, effective, and sensitive detection method for the simultaneous detection and specific quantification of these viruses. In this study, specific primers and probes for multiplex TaqMan real-time PCR assays designed from conserved regions of the coat protein sequence of each virus were used for the simultaneous detection of these viruses in lilies (Lilium spp.). The optimal concentration of primers and probes and reaction annealing temperature were 20 µM and 55.9 °C, respectively. The detection limits of the assay were 1.33 × 102, 1.27 × 101, 1.28 × 101, 2.33 × 102, and 2.01 × 102 copies·μL−1 for LSV, LMoV, CMV, SYSV, and PlAMV, respectively. Specificity was determined using seven viral pathogens of lilies. Variability tests of intra- and inter-assays showed high reproducibility with coefficients of variation <2%. The multiplex TaqMan real-time PCR assay was used to detect these viruses from lily samples in China. In brief, our developed assay showed high specificity, sensitivity, and reproducibility for the simultaneous detection and differentiation of five lily-infecting viruses and can be used for certification and quarantine programs.

Virus Detection and Production of Virus Free Plant Materials from the Lily by Selecting Basal Filament Flower as Explants

Lilium is a perennial bulbous flower of Lily family Liliaceae, with high ornamental and economic value. However, Lily is vulnerable to virus infection, which seriously affects the yield and quality of Lily, and poses a great threat to the production, sales, especially export of Lily, and has caused huge economic losses to the related industries. Therefore, the research on lily virus removal methods and virus detection technology has important practical significance to improve the ornamental value and economic value of lily.
 In this study, the filaments of four susceptible lily varieties,' Valdisole' (A),'Adoration'(LA),' Ice Cube'(OT) and ‘Zantriana’ (O), were used as explants. The filaments of lily were divided into three parts, namely, top, middle, and base. In this paper, the virus detection of tissue culture seedlings induced by lily filaments was carried out by using DAS-ELISA and RT-PCR, and the removal effects of Cucumber mosaic virus,(CMV) and lily symptomless virus (LSV), two common viruses in lily, were explored, and the two detection technologies were compared.
 The results showed that the success rate of tissue culture seedlings induced by filament base was the highest, and CMV virus could be basically removed. RT-PCR detection is more sensitive than DAS-ELISA detection, but RT-PCR detection requires higher test conditions and technology. Therefore, appropriate virus detection methods can be selected according to actual conditions and severity.

Effective detection of Lily Symptomless Virus using the reverse transcription loop–mediated isothermal amplification method

Lily Symptomless Virus (LSV) is prevalent in lily, causing severe economic losses in Lily production. Therefore, it is quite necessary to develop an effective method for detecting LSV. This study aimed to develop a visual Reverse Transcription Loop–Mediated Isothermal Amplification (RT-LAMP) method to detect LSV. The optimum condition was 60 min at 65 °C. The primers designed were highly specific to LSV and did not cross-react with other seven Lily viruses. The sensitivity of RT-LAMP assay for LSV was 0.0001 ng/ul. This RT-LAMP method was rapid, simple, highly specific, and sensitive and helped in the reliable visual detection of LSV in Lily plants.

RNA viromes of the oriental hybrid lily cultivar \u201cSorbonne\u201d

BackgroundThe lily is a perennial flowering plant belonging to the genus Lilium in the family Liliaceae. Most cultivated lily plants are propagated by bulbs. Therefore, numerous lily bulbs are frequently infected by diverse viruses causing viral diseases. To date, no study has examined the viromes of plants of one type with identical genetic backgrounds collected from different geographical regions.ResultsHere, we examined different viromes of the lily cultivar “Sorbonne” using 172 gigabytes of transcriptome data composed of 23 libraries from four different projects for the cultivar “Sorbonne.” We identified 396 virus-associated contigs from all but one library. We identified six different viruses, including Plantago asiatica mosaic virus (PlAMV), Cucumber mosaic virus (CMV), Lily symptomless virus (LSV), Tulip virus X (TVX), Lily mottle virus (LMoV), and Tobacco rattle virus (TRV). Of them, PlAMV was the most common virus infecting the lily. Scale and flower samples possessed a high number of virus-associated reads. We assembled 32 nearly complete genomes for the six identified viruses possessing the polyadenylate tails. Genomes of all six viruses were highly conserved in the lily cultivar “Sorbonne” based on mutation analysis. We identified defective RNAs from LSV, TVX, and PlAMV localized in the triple gene block region. Phylogenetic analyses showed that virus genomes are highly correlated with geographical regions and host plants.ConclusionsWe conducted comprehensive virome analyses of a single lily cultivar, “Sorbonne,” using transcriptome data. Our results shed light on an array of lily virome-associated topics, including virus identification, the dominant virus, virus accumulation in different plant tissues, virus genome assembly, virus mutation, identification of defective RNAs, and phylogenetic relationships of identified viruses. Taken together, we provide very useful methods and valuable results that can be applied in other virome-associated studies.

The occurrence and distribution of viruses infecting Lanzhou lily in northwest, China

Field surveys were conducted during 2015–16 to document the occurrence of multiple virus infections and to record predominant viruses infecting Lanzhou lily (Lilium davidii var. unicolor) in the major area of cultivation, northwest China. Specimens were randomly collected from crops in eight different regions and tested for Lily symptomless virus (LSV), Cucumber mosaic virus (CMV) and Lily mottle virus (LMoV) using a quadruplex RT-PCR assay. Results indicated a high level of LSV (98.2%), a high level of CMV (42.5%), and a low level of LMoV (1.5%). In addition, a high level of mixed infections of LSV + CMV was confirmed in Lanzhou lily; in Huangyu, north Yuzhong and Yongjing, incidence of mixed infections of LSV + CMV occurred in over 50% of plants. Interestingly, 99% of CMV-infected plants were in combination with LSV. The sequence homology of LMoV isolate from this study (GenBank: MF781080) was similar to that previously reported in this region from Lilium oriental. Approaches to disease control using improved virus detection methods are also discussed.

English

English

Simultaneous detection of three lily viruses using Triplex IC-RT-PCR

Viruses commonly infecting lily (Lilium spp.) include: Lily symptomless virus (LSV), Cucumber mosaic virus (CMV) and Lily mottle virus (LMoV). These viruses usually co-infect lilies causing severe economic losses in terms of quantity and quality of flower and bulb production around the world. Reliable and precise detection systems need to be developed for virus identification. We describe the development of a triplex immunocapture (IC) reverse transcription (RT) polymerase chain reaction (PCR) assay for the simultaneous detection of LSV, CMV and LMoV. The triplex IC-RT-PCR was compared with a quadruplex RT-PCR assay. Relative to the quadruplex RT-PCR, the specificity of the triplex IC-RT-PCR system for LSV, CMV and LMoV was 100% for field samples. The sensitivity of the triplex IC-RT-PCR system was 99.4%, 81.4% and 98.7% for LSV, CMV and LMoV, respectively. Agreement (κ) between the results obtained from the two tests was 0.968, 0.844 and 0.984 for LSV, CMV and LMoV, respectively. This is the first report of the simultaneous detection of LSV, CMV and LMoV in a triplex IC-RT-PCR assay. In particular we believe this convenient and reliable triplex IC-RT-PCR method could be used routinely for large-scale field surveys or crop health monitoring of lily.

MOLECULAR CLONING, PROKARYOTIC EXPRESSION AND PREPARATION OF ANTISERUM AGAINST LILY SYMPTOMLESS VIRUS TGB1 PROTEIN

The triple gene block gene TGB1 was amplified by RT-PCR from lily leaves infected with Lily symptomless virus and cloned into prokaryotic expression vector pET-28a(+). The recombinant vector was transformed into Escherichia coli strain BL21 (DE3). On induction with isopropyl β-D-1-thiogalactopyranoside,TGB1 protein was highly expressed and the molecular weight was 29 kDa (including a His-tag-containing fusion). After protein purification by Ni2+-NTA affinity chromatography, a polyclonal antibody against TGB1 was raised in mouse. Western blot analysis showed that the antiserum reacted specially with the TGB1 protein of LSV. ELISA and RT-PCR confirmed that the antiserum reacted specially with lily leaves infected with LSV, and can be used for a rapid test for LSV. The antibody produced in this work may be used for future immunohistochemistry and functional study of TGB1.

Rapid and sensitive detection of Lily symptomless virus by reverse transcription loop-mediated isothermal amplification

Lily symptomless virus (LSV) is one of the most prevalent viruses that infect lily plants worldwide. A rapid and sensitive reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay was developed for detection of LSV, using two primer pairs that specifically amplified the conserved sequence of LSV coat protein. The optimum reaction conditions were as follows: 4mM MgCl2 and 0.8M betaine with incubation at 64°C for 30min. The limit of detection of LSV from infected lily leaves was 10-fold higher for RT-LAMP than for conventional RT-PCR. Moreover, RT-LAMP detected LSV in not only symptomatic, but also in symptomless tissues of infected plants. These findings indicate that our RT-LAMP method for LSV can serve as a low-cost, simple, and rapid alternative to conventional detection assays.

Occurrence and molecular analysis of quarantine virus in lily cultivation areas in Brazil

Abstract: The objective of this work was to describe the occurrence of quarantine Tulip breaking virus (TBV, synonym Lily mottle virus - LMoV) and Lily symptomless virus (LSV), and their respective molecular analyses, to provide data for supporting TBV removal from the Brazilian A1 quarantine pest list, since this virus has spread among the main commercial lily crops in Brazil. The occurrence of these viruses was detected in 12 cultivation areas through multiplex reverse transcription (RT-PCR), using specific primers to genes encoding the respective coat proteins (CP). Eight fragments of 800 nucleotides (nt) obtained from the LMoV-infected lilies and nine fragments of 600 nt from LSV-infected lilies were sequenced. Phylogenetic tree reconstruction showed a robust branch containing the LMoV Brazilian sequences, other LMoV isolates, TBV, and Tulip band breaking virus, suggesting that all are LMoV isolates, although they are clustered into two subgroups. Phylogenetic analysis also showed a robust branch supporting all Brazilian and other LSV sequences, except for an LSV Japanese isolate. Recombination analyses also showed an LMoV recombinant isolate, whereas no recombination events were found among LSV isolates. Lily mottle virus is the prevalent virus in lily crops in Brazil, in single and mixed infections with LSV or Cucumber mosaic virus (CMV).

Elimination of Lily Symptomless Virus by In Vitro Scaling and Reinfection Rates under Various Culture Conditions in Korean Native Lilies

Abstract: The lily symptomless virus (LSV) is the most common virus in Korean native lilies and causes various types of dama ge to overall plant growth. This study was carried out to investigate the elimination rate of the LSV by the in vitro scale culture (scaling) method in Korean native lilies and to test reinfection rates of the LSV under several field culture conditions of bul b production. Four Korean native lilies ( Lilium dauricum, L. distichum, L. lancifolium, and L. maximowitzii) were used and their scales were cultured in vitro for micro-scale formation. The micro-scales were subcultured repeatedly using MS culture medium supplemented with 30 or 90 g･L -1 sucrose. The culture conditions were 24 µmol･m -2 ･s -1 PPFD with 16 hour daylength usin g fluorescent lamps and maintained at 22 ± 2°C. The virus-free bulblets were grown for one to three years in the greenhouse and transplanted to the field in October or March. Virus infection rates were investigated by direct tissue blotting immunobind ing assays and measurement of chlorophyll and protein contents. Virus-free plants could be obtained from the 5th subculture of micro-scales in L. lancifolium and L. maximowitzii or from primary culture in L. dauricum and L. distichum. LSV-free plants were reinfected during bulb production in the field. Reinfection rates were higher at older bulb ages and under higher planting dens ity. The plants planted in October and at inland Gyeongsan had higher infection rates than those planted in March and at coastal area Pohang. The reinfection rate of L. maximowitzii was higher than those of L. dauricum and L. lancifolium. The LSV-infected plants had lower chlorophyll contents and unchanged protein contents compared to virus-free plants.Additional key words:

English

When submitted to stress conditions during growth, plants modify their secondary metabolites production, which could increase therapeutic properties. Lilium candidum is a beautiful plant with potent antiviral activity, growing wild in the Middle East. We investigated the effect of biotic and abiotic stress applied on L. candidum plants during their growth, on the anti-herpetic efficiency of leaf ethanolic extracts and their fractions against herpes simplex virus (HSV) 1 in vitro. Ethanolic leaf extracts were collected from L. candidum leaves of healthy plants growing under regular conditions, or submitted to abiotic stresses in the form of drought, heat and salinity or from plants infected with the Lily symptomless virus (LSV). The highest anti-herpetic effect was recorded in extracts from virus-infected plants (biotic stress), followed by extracts from plants submitted to heat stress. Similar antiviral effect was recorded for extracts from plants grown under regular conditions and under salinity. 80% methanolic fraction from heat-shock plants, rich in flavonoid was particularly efficient against HSV-1 infection. We suggest that stress conditions during plant growth increased leaf flavonoid content, inducing anti-herpetic efficiency. The fact that biotic and abiotic stress during plant growth increases anti-herpetic efficiency should be taken into consideration when growing plants for medicinal purposes. Key words: Lilium candidum, herpes virus, leaf extract, antiviral activity.

Development of an immunochromatographic strip test for rapid detection of lily symptomless virus

A rapid immunochromatographic strip (ICS) test for specific detection of lily symptomless virus (LSV) was developed. The test is based on a double-antibody sandwich format and employs two distinct anti-LSV polyclonal antibodies (IgG1 and IgG2). The first antibody, IgG1 was used as the detection antibody conjugated to colloidal gold and the second antibody, IgG2 was used to as the capture antibody at the test line. The performance of the ICS test was evaluated and the results obtained were compared with a quadruplex RT-PCR assay. When serial dilutions of purified LSV were tested, the LSV detection limit of the ICS test was 6.0×10−8mg/mL, which was the same as the quadruplex RT-PCR assay. Relative to quadruplex RT-PCR, the specificity and sensitivity of the ICS were 98.6% and 100%, respectively for field leaf samples. There was significant agreement between the results of the ICS and quadruplex RT-PCR tests (κ=0.983). Compared with conventional lily virus detection methods, our ICS test has many advantages: simple, fast, low cost, high sensitivity and specificity, and has applications in the laboratory and in the field to detect and control LSV.

First Report of Plantago asiatica mosaic virus in Imported Asiatic and Oriental Lilies (Lilium hybrids) in the United States.

Asiatic and Oriental hybrid lilies (Lilium sp., Liliaceae) are bulbous ornamentals valued for their flowers. Bulbs of several varieties of each lily type, imported from the Netherlands, were purchased in spring 2013 from retail nurseries and grown in a cool greenhouse; additional bulbs were obtained in 2014. After flowering in 2013, but prior to leaf senescence, necrotic streaking was observed in midstem leaves of several plants. RNA extracted from leaves of several individual plants was subjected to reverse-transcription-polymerase chain reaction (RT-PCR) assay using NSNC-odT primed cDNA and PCR with primers PxDeg/BNSNC or potyS/BNSNC to amplify potexvirus/carlavirus and potyvirus products respectively (2,3,4). Sequencing of a c. 1.7-kb PCR product from one lily identified Lily symptomless virus (LSV). Mechanical inoculation of pooled lily leaf samples to Nicotiana benthamiana, N. glutinosa, and Chenopodium quinoa (not hosts of LSV) yielded chlorotic or necrotic local lesions on C. quinoa and systemic mosaic with necrotic spotting, streaking, or apical necrosis on N. benthamiana; electron microscopy revealed potexvirus-like flexuous particles. RT-PCR from C. quinoa and N. benthamiana with PxDeg/BNSNC yielded a c. 1.3-kb product, which was cloned and sequenced; the consensus sequence (KM205357) had 98.7% nucleotide identity to a Dutch isolate of Plantago asiatica mosaic virus (PlAMV, KF471012; 78.5 to 87.8% to other isolates), and 99.0% coat protein amino acid identity to KF471012 (88.9 to 93.2% to other isolates). The 2013 lilies were stored overwinter at 4°C, and RNA was extracted from roots of individual bulbs. Primers PlAMV CP-F2 (TTCGTCACCCTCAGCGG) and PlAMV CP-R3 (AAACGGTAAAATACACACCGGG) were designed based on alignment of KM205357 with all PlAMV sequences available in GenBank. RT-PCR using PlAMV CP-F2/CP-R3 yielded products of the expected 511 bp from 20 bulbs and no product from a no-template control. ELISA of root and bulbscale samples using PlAMV-lily specific antibody and conjugate (a gift of R. Miglino, BKD, The Netherlands) confirmed PlAMV in seven of 20 bulbs positive by RT-PCR. Bioassay of PCR-positive lilies on N. benthamiana, C. quinoa, and Tetragonia expansa confirmed infection in three out of eight by both symptoms and ELISA. Altogether nine out of 13 Asiatic lilies (four of four cultivars: America, Connecticut King, Grand Cru, and Pink Pixie) and 11 Oriental lilies (cvs. Stargazer and Starfighter) were found to be infected with PlAMV by RT-PCR, of which seven were confirmed by bioassay and/or ELISA. Bulbs obtained in 2014 were tested only by ELISA; five of 18 Asiatic lilies (three of six cultivars: Connecticut King, Crimson Pixie, and Yellow Electric) and three of 13 Oriental lilies (three of six cultivars: Anastasia, Casa Blanca, and Garden Party) were found to be infected. PlAMV was reported in lilies in the Netherlands in 2010, with losses of up to 80% in greenhouse cut-flower production (1). The Nandina mosaic isolate (PlAMV-NMV) has been known in the United States since 1976 (5), but PlAMV infection of lily has not previously been documented in the United States. Both RT-PCR and ELISA tests also detected PlAMV-NMV. The degree of damage observed in the Netherlands suggests that growers should seek bulb stocks free of PlAMV.

Expression of Lily mottle virus Coat Protein and Preparation of IgY Antibody against the Recombinant Coat Protein

Lily symptomless virus (LSV), Lily mottle virus (LMoV), and Cucumber mosaic virus (CMV) are the most prevalent viruses infecting lilies in Korea. Leaf and bulb samples showing characteristic symptoms of virus infection were collected in 2012, and 80 field samples were analyzed by reverse transcription polymerase chain reaction (RT-PCR). The infection frequencies were 79% for LMoV, 5% for LSV, and 3% for CMV. The LMoV coat protein gene was amplified and cloned into the pET21d(+) expression vector to develop serological diagnostic tools to detect LMoV. The resulting carboxy-terminal His-tagged coat proteins were expressed in Escherichia coli strain BL21 (DE3) by induction with IPTG. The recombinant proteins were purified using Ni-NTA agarose beads and used as an antigen to produce polyclonal antibodies in laying hens. The resulting egg yolk immunoglobulin (IgY) specifically recognized LMoV from infected plant tissues in immunoblotting assays and had comparable sensitivity to that of a mammalian antibody. In addition, method of immunocapture RT-PCR using this IgY was developed for sensitive, efficient, and rapid detection of LMoV. Based on these results, large-scale bulb tests and detection of LMoV in epidemiological studies can be performed routinely using this IgY. This is the first report of production of a polyclonal IgY against a plant virus and its use for diagnosis.

우리나라 식물검역 격리재배 시스템과 2005-2012년 실적보고

우리나라의 격리재배는 102속, 약 250여종의 식물에 대해 실시하고 있으며, 직접경검법, 배양법, 선택배지, 생리생화학, ELISA 및 PCR 검사방법을 사용한다. 2005-2012년, 우리나라에서 수행된 격리재배는 총 8,307건이며 이중 구근류가 5,165건(62.2%)로 가장 많았고, 묘목류가2,119건(25.0%), 종자 796건(9.6%), 삽수 150건(1.8%), 접수 70건(0.8%) 및 기타 7건(0.1%) 이었다. 불합격 사례는 총 413건으로 약 4.97%였고, 발견된 병의 종류는 총 47종으로 나타났다. 종류별로는 바이러스가 27종으로 가장 많은 수를 차지했으며, 곰팡이 16종, 바이로이드 1종, Chromalveolata 1종 및 기타 2종으로 나타났다. 가장 많은 검역건을 올린 병원체는 Arabis mosaic virus (77건), Tobacco rattle virus (70건), Lily symptomless virus (46건), Penicillium expansum (46건)이다. In Korea, isolated cultivation has been implemented for 102 genera, including about 250 species, each of which has underwent microscopic inspection, cultivation of bacteria in selective medium, analysis of physiology and biochemistry, enzyme-linked immunosorbent assay (ELISA) and polymerase chain reaction (PCR). The number of isolated microorganisms was 8,307 in the period of 2005-2012, and bulbs and tubers had the greatest diversity of microorganisms, of 5,165 (62.2%), followed by 2,119 (25.0%) sapling, 796 (9.6%) seed, 150 (1.8%) cutting slip, 70 (0.8%) branch graft and 7 (0.1%). The number of cases which were disqualified were 413 (4.97%), after the detection of 47 disease causing species of microorganism. Viruses predominated, with 27 species, followed by 16 fungi, a viroid, a Chromalveolata and 2 further species. Top on the list of detection was Arabis mosaic virus (77 cases), followed by Tobacco rattle virus (70 cases), Lily symptomless virus (46 cases) and Penicillium expansum (46 cases).