Liaoning Province Of China Research Articles

Clinical named entity recognition for percutaneous coronary intervention surgical information with hybrid neural network.

Percutaneous coronary intervention (PCI) has become a vital treatment approach for coronary artery disease, but the clinical data of PCI cannot be directly utilized due to its unstructured characteristics. The existing clinical named entity recognition (CNER) has been used to identify specific entities such as body parts, drugs, and diseases, but its specific potential in PCI clinical texts remains largely unexplored. How to effectively use CNER to deeply mine the information in the existing PCI clinical records is worth studying. In this paper, a total of 24 267 corpora are collected from the Cardiovascular Disease Treatment Center of the People's Hospital of Liaoning Province in China. We select three types of clinical record texts of fine-grained PCI surgical information, from which 5.8% of representative surgical records of PCI patients are selected as datasets for labeling. To fully utilize global information and multi-level semantic features, we design a novel character-level vector embedding method and further propose a new hybrid model based on it. Based on the classic Bidirectional Long Short-Term Memory Network (BiLSTM), the model further integrates Convolutional Neural Networks (CNNs) and Bidirectional Encoder Representations from Transformers (BERTs) for feature extraction and representation, and finally uses Conditional Random Field (CRF) for decoding and predicting label sequences. This hybrid model is referred to as BCC-BiLSTM in this paper. In order to verify the performance of the proposed hybrid model for extracting PCI surgical information, we simultaneously compare both representative traditional and intelligent methods. Under the same circumstances, compared with other intelligent methods, the BCC-BiLSTM proposed in this paper reduces the word vector dimension by 15%, and the F1 score reaches 86.2% in named entity recognition of PCI clinical texts, which is 26.4% higher than that of HMM. The improvement is 1.2% higher than BiLSTM + CRF and 0.7% higher than the most popular BERT + BiLSTM + CRF. Compared with the representative models, the hybrid model has better performance and can achieve optimal results faster in the model training process, so it has good clinical application prospects.

Evaluation on the Forecast Skills of Precipitation and Its Influencing Factors in the Flood Season in Liaoning Province of China

To clarify the precipitation forecast skills of climate forecast operations in the flood season in Liaoning Province of China, this study examines the forecast accuracies of China’s national and provincial operational climate prediction products and the self-developed objective prediction methods and climate model products by Shenyang Regional Climate Center (SRCC) in the flood season in Liaoning. Furthermore, the forecast accuracies of the main influencing factors on the precipitation in the flood season of Liaoning are assessed. The results show that the SRCC objective methods have a relatively high accuracy. The European Centre for Medium-Range Weather Forecasts (ECMWF) sub-seasonal forecast initialized at the sub-nearest time has the best performance in June. The National Climate Center (NCC) Climate System Model sub-seasonal forecast initialized at the sub-nearest time, and the ECMWF seasonal and sub-seasonal forecasts initialized at the nearest time, perform the best in July. The NCC sub-seasonal forecast initialized at the sub-nearest time has the best performance in August. For the accuracy of the SRCC objective method, the more significant the equatorial Middle East Pacific sea surface temperature (SST) anomaly is, the higher the evaluation score of the dynamic–analogue correction method is. The more significant the North Atlantic SST tripole is, the higher the score of the hybrid downscaling method is. For the forecast accuracy of the main influencing factors of precipitation, the tropical Atlantic SST and the north–south anti-phase SST in the northwest Pacific can well predict the locations of the southern vortex and the northern vortex in early summer, respectively. The warm (clod) SST in China offshore has a good forecast performance on the weak (strong) southerly wind in midsummer in Northeast China. The accuracy of using the SST in the Nino 1+2 areas to predict the north–south location of the western Pacific subtropical high is better than that of using Kuroshio SST. The accuracy of predicting northward-moving typhoons from July to September by using the SST in the west-wind-drift area is better than using the SST in the Nino 3 area. The above conclusions are of great significance for improving the short-term climate prediction in Liaoning.

Association between pregnant specific stress and depressive symptoms in the late pregnancy of Chinese women: the moderate role of family relationship and leisure hobbies.

Little research has been conducted on the association between pregnant specific stress and depressive symptoms, and whether family relationship and leisure hobbies moderate the association. A cross-sectional survey of 647 pregnant women was conducted in Shenyang City, Liaoning Province of China. Pregnancy Pressure Scale (PPS), Edinburgh Postnatal Depression Scale (EPDS) and two single items were used to assess stress, perinatal depressive symptoms, family relationship and leisure hobbies, respectively. The analysis included χ2-test, Fisher's exact test, and binary logistic regression. The prevalence of perinatal depressive symptoms was 22.9% among the participants. After adjustment, four dimensions of pregnancy stress were found to increase the risk of depressive symptoms, and odds ratios (ORs) were 4.175 (95% confidence interval (CI) = 2.240, 7.779), 5.947 (95% CI = 2.624, 13.478), 3.907 (95% CI = 2.375, 6.425), and 8.534 (95% CI = 4.588, 15.873) for factors 1, 2, 3, and 4 (recognition of the role of parents, worrying about maternal and child health and safety, the changes in body shape and physical activity level, as well as child care and marriage), respectively. In addition, significant interactions were found between factor 2, factor 4 and family relationship, leisure hobbies with depressive symptoms, respectively (interaction P < 0.10). Tailored stress-overcoming programs, as well as health services, are needed to relieve women's pregnancy stress and prevent them from depressive symptoms. Clinical practice should conduct family relationship-oriented interventions and women themselves can cultivate extensive leisure hobbies in the period of pregnancy preparation.

First report of Vitis cryptic virus from grapevines in China.

Vitis cryptic virus (VCV) was recently identified on wild Vitis coignetiae in Japan in 2021, and was tentatively classified as a new member of the genus Deltapartitivirus, which is consistent with the two-segmented genome encoding RdRp and CP (Nabeshima et al., 2021). In June 2020, a grapevine cv. Jinhuanghou in a vineyard exhibiting chlorotic mottling (Figure S1) was collected in Xingcheng, Liaoning province of China. Total RNAs were extracted using RNAprep Pure Plant Plus Kit (DP441, TIANGEN BIOTECH, Beijing), and the ribosomal RNA were removed by the Epicentre Ribo-Zero rRNA Removal Kit (Epicentre, Madison, WI, USA). The ribosomal RNA-depleted RNA was then used to construct a cDNA library using a TruSeq RNA Sample Prep Kit (Illumina, San Diego, CA, USA), which was sequenced on an Illumina NovaSeq 6000 platform (Biomarker Biology Technology), resulting 60,208,348 paired-end clean reads (150 nt × 2). Reads mapping to the grapevine genome (PN40024 assembly 12X) were removed by hierarchical indexing using hisat2 2.1.0 software (Kim et al., 2019). The unmapped reads were de novo assembled into 116,809 contigs using the rnaviralSPAdes method in the SPAdes v3.15.3 software with default parameters (Prjibelski et al., 2020) and analyzed through BLAST analysis. Two viruses and two viroids were identified: VCV (2 contigs), grapevine emaravirus A (GEVA; 5 contigs), grapevine yellow speckle viroid 1 (GYSVd1; 1 contig) and hop stunt viroid (HSVd; 1 contig). The two contigs of VCV had lengths of 1575 nt and 1563 nt, and shared 95% and 90% nt identity with RNA1 and RNA2 genomes of the VCV isolate H1 (GenBank accession nos. LC602838-39) with 99% and 96% coverage respectively. To further confirm the infection of VCV, we designed two pairs of primers VCV-RP1a/1b (5'- TGGTCGAGAAGTTACTATACTCG -3'/5'- AGACCACAATATTGCTTTGGCTC -3') and VCV-CP1a/1b (5'-TTACGAAGTCCGCACTATTGC-3'/5'- AGCATACGGATAGCTCCTGAC-3'), which were to amplify the 297-bp and 279-bp fragments in the RdRp and CP gene encoded by RNA1 and RNA2 genomes of VCV respectively. The amplified PCR products were cloned and sequenced and the two sequences (OM460075-76) showed 93% and 91% nt identity with the genomic segments of the VCV isolate H1 respectively. The graft transmissibility of VCV was assessed in July 2021 by grafting the VCV-infected grapevine buds onto 2-year-old VCV-free 'Beta'grapevine seedlings with four replicates, the leaves of the first bud below the grafting site behaved chlorotic mottling symptoms (Figure S2) and tested positive for VCV two months after grafting. To further determine the incidence and distribution of VCV in China, 470 grapevine samples of 71 cultivars were collected from 21 provinces and tested by RT-PCR using primers VCV-RP1a/1b and VCV-CP1a/1b. The results showed that 2.6% (12/470) of the samples tested positive with both primers, including 10 'Jinhuanghou' grapevines (Jilin province), 1 'Zuoyouhong' (Jilin province) and 1 'Куртсет' grapevine (Liaoning province). This is the second report of VCV in the world, and confirm the graft transmissibility of VCV for the first time. Given the VCV infectivity in the two important cultivars in Jilin province and strong graft transmissibility, it is necessary to further study its pathogenicity and its effect on grapes. Unveiling the presence of VCV in China contributes to understanding the occurrence of the virus and developing management measures should they become necessary.

Interval Prediction of Building Foundation Settlement Using Kernel Extreme Learning Machine

Dynamic building foundation settlement subsidence threatens urban businesses and residential communities. In the temporal domain, building foundation settlement is often dynamic and requires real-time monitoring. Accurate quantification of the uncertainty of foundation settlement in the near future is essential to advanced risk management for buildings. Traditional models for predicting foundation settlement mostly utilize the point estimates approach, which provides a single value that can be close or distant from the actual one. However, such an estimation fails to quantify estimation uncertainties. The interval prediction, as an alternative, can provide a prediction interval for the ground settlement with high confidence bands. This study, proposes a lower upper bound estimation approach integrated with a kernel extreme learning machine to predict ground settlement levels with prediction intervals in the temporal domain. A revised objective function is proposed to further improve the interval prediction performance. In this study, the proposed method is compared to the artificial neural network and classical extreme learning machine. Building settlement data collected from Fuxing City, Liaoning Province in China was used to validate the proposed approach. The comparative results show that the proposed approach can construct superior prediction intervals for foundation settlement.

Luojia-HSSR: A high spatial-spectral resolution remote sensing dataset for land-cover classification with a new 3D-HRNet

ABSTRACT High Spatial and Spectral Resolution (HSSR) remote-sensing images can provide rich spectral bands and detailed ground information, but there is a relative lack of research on this new type of remote-sensing data. Although there are already some HSSR datasets for deep learning model training and testing, the data volume of these datasets is small, resulting in low classification accuracy and weak generalization ability of the trained models. In this paper, an HSSR dataset Luojia-HSSR is constructed based on aerial hyperspectral imagery of southern Shenyang City of Liaoning Province in China. To our knowledge, it is the largest HSSR dataset to date, with 6438 pairs of 256 × 256 sized samples (including 3480 pairs in the training set, 2209 pairs in the test set, and 749 pairs in the validation set), covering area of 161 km2 with spatial resolution 0.75 m, 249 Visible and Near-Infrared (VNIR) spectral bands, and corresponding to 23 classes of field-validated ground coverage. It is an ideal experimental data for spatial-spectral feature extraction. Furthermore, a new deep learning model 3D-HRNet for interpreting HSSR images is proposed. The conv-neck in HRNet is modified to better mine the spatial information of the images. Then, a 3D convolution module with attention mechanism is designed to capture the global-local fine spectral information simultaneously. Subsequently, the 3D convolution is inserted into the HRNet to optimize the performance. The experiments show that the 3D-HRNet model has good interpreting ability for the Luojia-HSSR dataset with the Frequency Weighted Intersection over Union（FWIoU） reaching 80.54%, indicating that the Luojia-HSSR dataset constructed in this paper and the proposed 3D-HRnet model have good applicable prospects for processing HSSR remote sensing images.

&lt;p&gt;Recovery Experience: A Concept for Maintaining Quality of Life and Its Mediating Effect Among Female Nurses in China&lt;/p&gt;

PurposeNurses are high-risk groups for job burnout, which affect their quality of life (QOL). Recovery experience, a conceptualization of positive psychological resources, can combat the negative impacts of job burnout on health and QOL. The aim of this study was to examine the mediating effect of recovery experience on the relationship between job burnout and QOL among female nurses in China.Participants and MethodsQOL information was captured from 1068 female nurses from December 2017 to February 2018 in tertiary hospitals in Shenyang, Liaoning Province of China. A structural equation model was employed to examine the mediating effect of recovery experience on the relationship between job burnout and QOL.ResultsJob burnout had a significant impact on both the mental component summary and the physical component summary of a 36-item Short-Form Health Survey. However, mental component summary scores were significantly lower than physical component summary scores in female nurses. Recovery experience played a mediating role in the relationship between job burnout and QOL.ConclusionJob burnout could result in a reduction in QOL among Chinese female nurses. Recovery experience, as a mediating factor, could alleviate the impact of job burnout on QOL. Recovery experience should be strengthened to attenuate job burnout and enhance QOL.

Evaluation of city sustainability using multi-criteria decision-making considering interaction among criteria in Liaoning province China

City sustainability is a complex system affected by economic, social, and environmental dimensions, with the existence of interaction and conflict among factor. However, there is a lack of real methodology on the measurement of interaction. Then, this article presents a method to calculate the interaction among multiple criteria, including static interaction and dynamic trend similarity, and to compute the weigh coefficient of each indicator induced by this interaction. In addition, the applicability of the proposed method is demonstrated by evaluating the sustainability performance of 14 cities in Liaoning province China in the context of the Triple Bottom Line (TBL) framework. Our results show that the sustainable development of 14 cities in Liaoning province experienced dramatically downward and has a crucial condition from 2013 to 2017. Only Dalian, Shenyang, Panjin, Benxi, and Yingkou could be classified as a Good level (Level Ⅱ), and none of cities was an Excellent level (Level Ⅰ). From spatial-temporal perspective, regional disparities of sustainability are demonstrated by spatial distributions of city sustainability. In detail, the comprehensive sustainability and subsystem exhibit a “cold-spot in West” feature. The scores for indicators reveal that the shortage of science expenditure, declining investment in fixed asset, lack of economic growth, and lagging public transportation are the main limit factor faced by most cities. Meanwhile, tertiary industry development, energy efficiency improvement, increase green coverage, and reduce pollutant emissions are primary driving factors for improving sustainability. Comparing with other methods, MCDM considering interaction among criteria is an appropriate method to evaluate city sustainability.

Epidemiology of Norovirus among outpatients presenting with acute diarrhea in Dalian, China

The aim of this study was to perform an epidemiological analysis of the viral strains isolated from outpatients with acute gastroenteritis in Dalian, Liaoning province, China to determine the epidemiology of Norovirus (NoV). Fecal samples were collected from 789 outpatients with acute gastroenteritis in the Xigang district of Dalian, Liaoning province, China from July 2015 to December 2016. Norovirus was detected by real-time reverse transcriptase-polymerase chain reaction (RT-PCR). A selection of the positive samples identified was subsequently sequenced, and these data were analyzed by using the Norovirus Typing tool. Results showed that 38.02% (300/789) of the fecal samples were positive for NoV, of which 95.67% (287/300) were identified as genotype GII with 1.33% (4/300) identified as GI. A further 3.00% (9/300) were combined infections with both GI and GII Norovirus. When analyzing the age distribution, the infections primarily occurred in adults especially the elderly whose NoV positive rate was much higher than the average. Winter was the season when most cases were recorded during 2015 and 2016; however, another infection peak was observed in July 2016. Thirty Norovirus positive samples were successfully sequenced, and results showed that GII.4 was the most commonly identified genotype, along with GII.3 and GII.17. Norovirus is the most common pathogen for acute gastroenteritis in Dalian, Liaoning province of China. The current NoV genotype prevalence in Dalian was found to be similar to that in other regions of China. Genotype GII.4 was the most common genotype in our study, GII.3 and GII.17 were also identified.

Recovery Experience as the Mediating Factor in the Relationship Between Sleep Disturbance and Depressive Symptoms Among Female Nurses in Chinese Public Hospitals: A Structural Equation Modeling Analysis.

PurposeNurses are suffering from considerable work-related stress, which can result in disturbed sleep and depressive symptoms. Whereas, recovery experience can alleviate sleep disturbance and help maintain well-being in the working environment. The aim of this study was to examine whether recovery experiences play a mediating role in the relationship between sleep disturbance and depressive symptoms of female nurses in Chinese public hospitals.MethodsFrom December 2017 to May 2018, the study with proportional sampling of cross-sectional design was carried out in the public tertiary hospitals from Shenyang of Liaoning Province in China. A total of 1500 female nurses who had been working for one or more years participated in this study. A structural equation model (SEM) was applied to test the assumption that recovery experiences might function as a mediator in the relationship between sleep disturbance and symptoms of depression.ResultsSleep disturbance contributed most to the variance (32.9%) of depressive symptoms and had a significantly positive correlation with depressive symptoms (P<0.01) among nurses. Psychological detachment in recovery experience had a significantly positive correlation with sleep disturbance (P<0.01) and depressive symptoms (P<0.01). Whereas, relaxation, mastery experience, and control in recovery experience were significantly and negatively correlated with sleep disturbance (P<0.01) and depressive symptoms (P<0.01). Recovery experience served as a mediator between sleep disturbance and depressive symptoms (a * b = 0.066, BCa 95% CI: 0.045, 0.095).ConclusionSleep disturbance was the predictor of depressive symptoms for female nurses. Moreover, recovery experience could combat the detrimental impacts of sleep disturbances on symptoms of depression. This study suggested that nurses might benefit from interventions on improving sleep quality to relieve depressive symptoms through mediating path of recovery experience.

Joint Support Technology and Its Engineering Application to Deep Soft Rock Tunnel with Strong Creep

Deformation control of soft rock in deep roadways has always been a challenge in coal mining. The strain softening and rheological properties of high-stress soft rock not only cause large deformation of the surrounding rocks, but also lead to a long duration of deformation. Based on previous research results obtained here in China as well as abroad, this study focused on the S2S2 mining roadway in the Xiaokang Coal Mine of Liaoning Province in China for research and studied the characteristics and damage of its surrounding rock deformation. Furthermore, the sectional form that should be used in roadway construction, as well as the support structure types and parameters were proposed to control the excessive deformation of the surrounding rock. It is suggested that a circular section should be adopted as the mining roadway section, and the high-strength rock should be bolted together, employing the combination of the anchor cable support method. Industrial tests have verified that the circular roadway under the new support mode can enable relative distance changes between the roadway walls, make the roof and floor relatively flat, and reduce the convergence speed to a value lesser than that of the original support mode. The most important advantage is that under this joint support mode, the deformation and damage of the circular roadway would be less affected by mining activity, so the deformation and damage of the mining roadway can be controlled effectively. Therefore, the research results of this study can provide a reference value for similar engineering projects.

Pattern recognition of UAV flight data based on semi-supervised clustering

UAV is an unmanned aerial vehicle controlled by a remote radio signal or a trajectory planning software carried itself. It is widely used in military, civil and scientific research fields. However, due to the lack of real-time decision-making ability, the UAV has high fault rate. The flight quality assessment of UAV and the construction of fault prediction model can be used for debugging and fault-removing to customer’s aircraft, and also to increase the added value of the civilian UAV products. Before building a fault prediction model, a very important step is to identify the pattern of sampled data. For each group of flight data, the efficiency and accuracy rate of manual quality evaluation and fault identification are not acceptable. Based on the UAV flight data accumulated in the big data platform of an UAV production company in Shenyang, Liaoning Province of China, this paper proposes a semi-supervised clustering technique to do automatic pattern recognition for the sampling points. According to the characteristics of UAV flight data, two different methods are designed to choose initial centroids. Meanwhile, we use the existing normal flight data to train distance thresholds to combine some clusters to eliminate the resulting error clustering. Real flight data or flight test data with manually added labels are used to run the proposed algorithms to verify the recognition results. The experimental results show that the proposed methods greatly improve the efficiency and accuracy of adding precise labels to the historical flight data and play a role in assisting the manual recognition of sampling points while strengthening the management and statistics.

The mediating role of psychological capital on the association between workplace violence and professional identity among Chinese doctors: a cross-sectional study.

Background: Workplace violence (WPV) and psychological capital (PsyCap) are linked to professional identity, however, little research has examined how WPV is associated with professional identity via PsyCap. This study is aimed to examine the association between WPV and professional identity, and to further explore whether PsyCap can serve as a mediator between WPV and professional identity among Chinese doctors.Materials and methods: A cross-sectional study was conducted from November to December in Liaoning Province in China, in 2017. The study used a questionnaire consisting of Workplace Violence Scale (WVS), Occupational Identity Scale (OIS), Psychological Capital Questionnaire (PCQ), as well as questions about demographic characteristics. Out of 1200 doctors, 995 (effective response rate of 82.92%) completed the questionnaire survey and became our final subjects. Hierarchical multiple regression and the asymptotic and resampling strategies were conducted to explore the mediating role of PsyCap in the relationship between WPV and professional identity.Results: After adjusting for demographic characteristics, WPV was negatively associated with professional identity (β=−0.37; P<0.01). Mediation analysis indicated that PsyCap was a mediator in the relationship between WPV and professional identity. Two dimensions of PsyCap: self-efficacy (a*b =−0.04, BCa 95% CI: (−0.08, −0.01); P<0.01) and hope (a*b =−0.04, BCa 95% CI: (−0.08, −0.01); P<0.01) also did exhibit mediating effects in the relationship between WPV and professional identity. The proportion of self-efficacy, hope and PsyCap mediation was 10.73%, 10.77%, 36.22% for professional identity respectively.Conclusion: These results provided evidence that PsyCap could mediate the association between WPV and professional identity. To increase the level of professional identity, positive interventions targeting PsyCap should be taken, with a focus on self-efficacy and hope.

GNSS/MET Station Equipment Maintenance and Product Application

Based on the use of Global Navigation Satellite System (GNSS) for meteorological detection in the world, we used the GNSS/MET detection equipment in the meteorological departments of Liaoning Province of China and its data to study and summarize the maintenance methods of GNSS/MET (Global Navigation Satellite System Meteorology) detection equipment and the application of water vapor products in operational systems. The results show that: 1) For GNSS/MET failures, specific inspections and classifications can be performed according to different phenomena; 2) The GNSS water vapor measurement station samples every 30 seconds, forming one set of GNSS data every hour, and can detonate the atmospheric precipitation by solving the original data; 3) Using the “Navigation Satellite Remote Sensing Water Vapor Application Management System”, the GNSS/MET water vapor products can be directly displayed. We can get the conclusion that GNSS/MET has far-reaching significance for studying the law of atmospheric water vapor changes and enhancing the ability to monitor severe weather such as heavy rain and strong convection.

Empirical Research on the Present Situation of Football Development for Primary Schools Students of Liaoning Province in China

Nowadays, a significant idea of the new round curriculum reform in China is to promote the quality-oriented education in an all-round way. That is to say, education should pay attention to the individual value, embody the principal status, and cultivate innovation and practice ability of students. As one of the football important provinces in China, Liaoning has prepared a large number of talents for the country. However, there are still some obvious problems with the relative research on the operation system of football talents cultivation in Liaoning province. For this reason, on the basis of studying the present situation of campus football in some big cities in Liaoning, this paper aims to analyze the advantages and problems of cultivating the campus football talents from an objective perspective, thus to provide some practical suggestions for the further promotion of football development in Liaoning province for reference.

Design of sponge city and its inspiration to landscape ecology: A case of Liaodong Bay area of Panjin City, Northeast China

With the expansion of urban area, many cities are facing urban water environment issues, i.e., water resources shortage, lack of groundwater reserves, water pollution, urban waterlogging. For resolving these urban issues, 'sponge city' was proposed in 2015 in China. Liaodong Bay area of Panjin City in Liaoning Province of China was chosen as case study. Based on 'Sponge City Construction Technology Guide: Low Impact Development Rainwater System Building (Trial)', the underlying surface and types of land use in the typical area were analyzed. Sponge city plan of the study area was designed through combining topography, hydrology, rainfall intensity and other factors, and selecting LID measures. The results showed that when the study area reached the ove-rall target control rate (the control rate of the total annual runoff was ＞75%), the subsidence greenbelt rate was 1%-31%, with a total area of 13.73 km2; the pervious pavement rate was 1%-13%, with a total area of 2.29 km2. This study could provide a case study for planning and designing of 'sponge city', proposing new ideas and methods for the research on landscape pattern and process.

Stability analysis of a simple rheonomic nonholonomic constrained system**Project supported by the National Natural Science Foundation of China (Grant Nos. 11272050, 11202090, 11472124, 11572034, and 11572145), the Science and Technology Research Project of Liaoning Province, China (Grant No. L2013005), China Postdoctoral Science Foundation (Grant No. 2014M560203), and the Doctor Start-up Fund in Liaoning Province of China (Grant No. 20141050).

It is a difficult problem to study the stability of the rheonomic and nonholonomic mechanical systems. Especially it is difficult to construct the Lyapunov function directly from the differential equation. But the gradient system is exactly suitable to study the stability of a dynamical system with the aid of the Lyapunov function. The stability of the solution for a simple rheonomic nonholonomic constrained system is studied in this paper. Firstly, the differential equations of motion of the system are established. Secondly, a problem in which the generalized forces are exerted on the system such that the solution is stable is proposed. Finally, the stable solutions of the rheonomic nonholonomic system can be constructed by using the gradient systems.

Crust structure beneath Jilin Province and Liaoning Province in China based on seismic ambient noise tomography

We imaged the crust structure beneath Jilin Province and Liaoning Province in China with fundamental mode Rayleigh waves recorded by 60 broadband stations deployed in the region. Surface-wave empirical Green's functions were retrieved from cross-correlations of inter-station data and phase velocity dispersions were measured using a frequency–time analysis method. Dispersion measurements were then utilized to construct 2D phase velocity maps for periods between 5 and 35s. Subsequently, the phase-dispersion curves extracted from each cell of the 2D phase velocity maps were inverted to determine the 3D shear wave velocity structures of the crust. The phase velocity maps at different periods reflected the average velocity structures corresponding to different depth ranges. The maps in short periods, in particular, were in excellent agreement with known geological features of the surface. In addition to imaging shear wave velocity structures of the volcanoes, we show that obvious low-velocity anomalies imaged in the Changbaishan-Tianchi Volcano, the Longgang-Jinlongdingzi Volcano, and the system of the Dunmi Fault crossing the Jingbohu Volcano, all of which may be due to geothermal anomalies.

Sex Partnership and Self-Efficacy Influence Depression in Chinese Transgender Women: A Cross-Sectional Study.

BackgroundTransgender women often suffer from transition-related discrimination and loss of social support due to their gender transition, which may pose considerable psychological challenges and may lead to a high prevalence of depression in this population. Increased self-efficacy may combat the adverse effects of gender transition on depression. However, few available studies have investigated the protective effect of self-efficacy on depression among transgender women, and there is a scarcity of research describing the mental health of Chinese transgender women. This study aims to describe the prevalence of depression among Chinese transgender women and to explore the associated factors.MethodsA cross-sectional study was conducted in Shenyang, Liaoning Province of China by convenience sampling from January 2014 to July 2014. Two hundred and nine Chinese transgender women were interviewed face-to-face with questionnaires that covered topics including the Zung Self-Rating Depression Scale (SDS), demographic characteristics, transition status, sex partnership, perceived transgender-related discrimination, the Multidimensional Scale of Perceived Social Support (MSPSS) and the adapted General Self-efficacy Scale (GSES). A hierarchical multiple regression analysis was performed to explore the factors associated with SDS scores.ResultsThe prevalence of depression among transgender women was 45.35%. Transgender women with regular partners or casual partners exhibited higher SDS scores than those without regular partners or casual partners. Regression analyses showed that sex partnership explained most (16.6%) of the total variance in depression scores. Self-efficacy was negatively associated with depression.ConclusionsChinese transgender women experienced high levels of depression. Depression was best predicted by whether transgender women had a regular partner or a casual partner rather than transgender-related discrimination and transition status. Moreover, self-efficacy had positive effects on attenuating depression due to gender transition. Therefore, interventions should focus on improving the sense of self-efficacy among these women to enable them to cope with depression and to determine risky sex partnership characteristics, especially for regular and casual partners.

A new rhamphorhynchid pterosaur (Pterosauria) from Jurassic deposits of Liaoning Province, China.

Compared to pterosaurs from the Early Cretaceous from China, Late Jurassic pterosaurs are relatively rare. A new rhamphorhynchid pterosaur, Orientognathus chaoyngensis gen. et sp. nov., is erected based on an incomplete skeleton from the Upper Jurassic Tuchengzi Formation of Chaoyang, Liaoning Province, China. It is identified by the following characters: the toothless tip of the lower jaw is slightly pointed; the length ratio of wing metacarpal to humerus is 0.38, the ulna is shorter than each wing phalanx and the tibia is nearly equal to femur in length. A phylogenetic analysis recovers Orientognathus chaoyngensis as a rhamphorhynchid pterosaur. Orientognathus chaoyngensis is perhaps the youngest Jurassic pterosaur from western Liaoning Province of China.