Macrophage Inflammatory Protein-2 Levels Research Articles

Abstract 7478: Unveiling the role of two-pore channel 2 (TPC2) in cancer immunity from monocyte differentiation to cytokine production

Abstract Background: The study of TPC2 is of great interest in the field of cancer and immune diseases, as it plays a crucial role in various cellular processes, and there is substantial evidence that TPC2 sustains several cancer hallmarks (angiogenesis, autophagy, and metastasis). The expression and role of TPC2 and its relevance to cancer in the innate immune system remain unknown. Methods: U937 TPCN2 knockdown (KD) cells were developed by nucleofection-based transfection of CRISPR-Cas9 gene editing tools. sgRNA (single guide RNA): CGUGCUGGUGAGUGAGGAUG was designed to target the fourth exon of the TPCN2 gene (Transcript ID: ENST00000294309). The model was used in tandem with pharmacological modulators of TPC2 channel activity to underpin its function in monocyte differentiation, macrophage development, and IL-8 production. Molecular biology techniques, including Sanger sequencing, qPCR, ELISA, and WB, were utilized. Proteins of murine TPC2 WT and TPC2 KO cells were extracted and sent to the Discovery Proteomics Facility of the Target Discovery Institute for label-free quantification and proteomics analysis using mass spectrometry. Results: We developed TPC2-deficient human monocytes (U937 cells) with a 75% reduction in TPCN2 expression levels, and we demonstrated that TPCN2 genetically modified U937 monocytes were resistant to monocyte differentiation after treatment with increasing concentrations of PMA ranging from 100 ng/mL to 400 ng/mL. TPC2-deficient U937 monocytes were not differentiated into Mϕ. TPC2 acts as a major regulator of monocyte differentiation by modulating PKC-alpha via calpain. In addition, the levels of IL-8 were significantly reduced after treating U937 cells with Ned 19 (an NAADP antagonist) or TPC2 KD. Keratinocyte-derived chemokine (KC) and Macrophage inflammatory protein-2 (MIP-2) are the murine IL-8 homologues. Notably, the levels of MIP-2, but not KC, were significantly reduced in the TPC2 KO murine cells compared to the WT controls. Thus, TPC2 appears to be involved in IL-8 secretion in both humans and mice. In contrast to KC at the protein level, the KC expression level was significantly reduced in TPC2-deficient murine cells. TPC2 in EE/RE is involved in lipopolysaccharide (LPS)-mediated IL-8 production in U937 cells. TPC2 modulates immune targets involving CD38, PKC-alpha, and AKT.We found that 28 different proteins that play roles in cancer immunity showed significant changes in expression in TPC2-deficient murine cells (three overexpressed proteins and 25 down-expressed proteins), compared to WT. Conclusion: Our data provide the first preclinical proof of concept for TPC2 as a potential target for blocking macrophage development and modulating CD38/IL8 levels as therapeutic strategies for cancer patients, raising questions regarding the clinical utility of TPC2 as a biomarker or immunotherapy target to modulate immune responses. Citation Format: Abeer Alharbi, John Parrington. Unveiling the role of two-pore channel 2 (TPC2) in cancer immunity from monocyte differentiation to cytokine production [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 7478.

Immunotherapeutic treatment of inflammation in mice exposed to methamphetamine.

Currently, there are no FDA-approved medications to treat methamphetamine addiction, including the inflammatory, neurotoxic, and adverse neuropsychiatric effects. We have shown that partial (p)MHC class II constructs (i.e., Recombinant T-cell receptor Ligand - RTL1000), comprised of the extracellular α1 and β1 domains of MHC class II molecules linked covalently to myelin oligodendrocyte glycoprotein (MOG)-35-55 peptide, can address the neuroimmune effects of methamphetamine addiction through its ability to bind to and down-regulate CD74 expression, block macrophage migration inhibitory factor (MIF) signaling, and reduce levels of pro-inflammatory chemokine ligand 2 (CCL2). The present study evaluated the effects of our third-generation pMHC II construct, DRmQ, on cognitive function and concentration of inflammatory cytokines in the frontal cortex, a region critical for cognitive functions such as memory, impulse control, and problem solving. Female and male C57BL/6J mice were exposed to methamphetamine (or saline) via subcutaneous (s.c.) injections administered four times per day every other day for 14 days. Following methamphetamine exposure, mice received immunotherapy (DRmQ or ibudilast) or vehicle s.c. injections daily for five days. Cognitive function was assessed using the novel object recognition test (NORT). To evaluate the effects of immunotherapy on inflammation in the frontal cortex, multiplex immunoassays were conducted. ANOVA was used to compare exploration times on the NORT and immune factor concentrations. Post hoc analysis revealed increased novel object exploration time in MA-DRmQ treated mice, as compared to MA-VEH treated mice (non-significant trend). One-way ANOVA detected a significant difference across the groups in the concentration of macrophage inflammatory protein-2 (MIP-2) (p = 0.03). Post hoc tests indicated that mice treated with methamphetamine and DRmQ or ibudilast had significantly lower levels of MIP-2 in frontal cortex, as compared to mice treated with methamphetamine and vehicle (p > 0.05). By specifically targeting CD74, our DRQ constructs can block the signaling of MIF, inhibiting the downstream signaling and pro-inflammatory effects that contribute to and perpetuate methamphetamine addiction.

Maternal Allergic Asthma Induces Prenatal Neuroinflammation.

Autism spectrum disorder (ASD) is a class of neurodevelopmental disorders characterized by impaired social interactions and communication skills and repetitive or stereotyped behaviors. Rates of ASD diagnosis continue to rise, with current estimates at 1 in 44 children in the US (Maenner 2021). Epidemiological studies have suggested a link between maternal allergic asthma and an increased likelihood of having a child diagnosed with ASD. However, a lack of robust laboratory models prevents mechanistic research from being carried out. We developed a novel mouse model of maternal asthma-allergy (MAA) and previously reported that offspring from these mothers exhibit behavioral deficits compared to controls. In addition, it was shown that epigenetic regulation of gene expression in microglia was altered in these offspring, including several autism candidate genes. To further elucidate if there is neuroinflammation in the fetus following MAA, we investigated how allergic asthma impacts the maternal environment and inflammatory markers in the placenta and fetal brain during gestation. Female C57Bl/6 mice were primed with ovalbumin (OVA) prior to allergic asthma induction during pregnancy by administering aerosolized ovalbumin or PBS control to pregnant dams at gestational days (GD)9.5, 12.5, and 17.5. Four hours after the final induction, placenta and fetal brains were collected and measured for changes in cytokines using a Luminex bead-based multiplex assay. Placental MAA tissue showed a decrease in interleukin (IL)-17 in male and female offspring. There was a sex-dependent decrease in female monocyte chemoattractant protein 1 (MCP-1). In male placentas, IL-4, C–X–C motif chemokine 10 (CXCL10)—also known as interferon γ-induced protein 10 kDa (IP-10)—and chemokine (C-C motif) ligand 5 (RANTES) were decreased. In fetal brains, elevated inflammatory cytokines were found in MAA offspring when compared to controls. Specifically, interferon-gamma (IFN-γ), granulocyte-macrophage colony-stimulating factor (GM-CSF), interleukin 1α (IL-1α), IL-6, and tumor necrosis factor α (TNFα) were elevated in both males and females. In contrast, a decrease in the cytokine IL-9 was also observed. There were slight sex differences after OVA exposures. Male fetal brains showed elevated levels of macrophage inflammatory protein-2 (MIP-2), whereas female brains showed increased keratinocytes-derived chemokine (KC). In addition, IL-1𝛽 and IP-10 in male fetal brains were decreased. Together, these data indicate that repeated exposure to allergic asthma during pregnancy alters cytokine expression in the fetal environment in a sex-dependent way, resulting in homeostatic and neuroinflammatory alterations in the fetal brain.

Huayu Sanjie Enema Liquid Relieves Pain in Endometriosis Model Rats by Inhibiting Inflammation, Peripheral Sensitization, and Pelvic Adhesion.

The objective of this study is to observe the effect of relieving pain of Huayu Sanjie enema liquid (HYSJ-EL) on endometriosis model rats and to explore its mechanism of action. Of 24 female Sprague Dawley rats, six were randomly selected as the sham operation group (normal control group). The remaining rats were used to establish rat models of endometriosis through autologous endometrial transplantation combined with estrogen injection. Successfully modeled rats were randomly divided into the model, indomethacin (Western medicine group), and HYSJ-EL (Chinese herbs group) treatment groups. The thermal pain threshold of rats was measured, and hematoxylin and eosin staining was used to observe pathological changes after sampling. Serum levels of prostaglandin E2 (PGE2), interleukin-6 (IL-6), macrophage inflammatory protein-2 (MIP-2), plasminogen activator inhibitor-1 (PAI-1), and transforming growth factor-β (TGF-β) were measured using an enzyme-linked immunosorbent assay (ELISA). Furthermore, the protein and mRNA expression levels of transient receptor potential vanilloid-1 (TRPV1) and tumor necrosis factor-α (TNF-α) in the endometrium and endometriotic lesions were measured using Western blotting and quantitative real-time PCR assays, respectively. Compared to the model group, the heat pain threshold of rats in the HYSJ-EL group was significantly increased (P < 0.01), and the serum levels of PGE2, IL-6, MIP-2, PAI-1, and TGF-β were significantly decreased (P < 0.01), as well as the expression of TRPV1 and TNF-α protein and mRNA in the tissue of the ectopic lesion was significantly decreased (P < 0.05). These results indicate that the Huayu Sanjie enema liquid exerts analgesic effects on endometriosis by inhibiting inflammation, peripheral nerve sensitization, and pelvic adhesion.

Serum‐based inflammatory biomarker profiles and structural brain measures in older adults without dementia

AbstractBackgroundInflammatory markers may play a crucial role in early stages of Alzheimer’s disease (AD). We previously found C‐reactive protein (CRP) was associated with reduced brain volumes. Whether systemic inflammation profiles using multiple inflammatory biomarkers are associated with brain measures remains unclear.MethodThe study included 662 older (mean age=75.6 years) participants without dementia from the community‐based, multiethnic Washington Heights‐Inwood Columbia Aging Project. Thirty‐six cytokines in serum collected at baseline were quantified with multiplex technology. High‐resolution structural MRI was collected approximately 4 years later. Global brain volumetric measurements, including total brain volume (TBV), total gray matter volume (TGMV), and total white matter volume (TWMV), were quantified from T1‐weighted images via Freesurfer and adjusted for intracranial volume in the analyses. Mean cortical thickness was estimated by the average cortical thickness of 68 regions of interest. Principal component analyses were run to derive cytokine patterns (CPs). Multivariable linear regression models were used to assess the association between cytokines and brain MRI measures, adjusted for demographic and clinical factors.ResultEight different cytokine patterns were derived. The CP8, characterized by high (&gt;0.3) positive loadings of α2‐Macroglobulin (A2MG) (loading=0.55), CRP (0.76), and IP‐10 (0.32), was positively correlated with increasing age (r=0.11, p=0.005). In adjusted model, the CP8 was associated with reduced TBV [β (95% confidence interval), p‐value: ‐6.88 (‐13.17, ‐0.58), 0.032], TGMVR [‐5.34 (‐8.61, ‐2.07), 0.001], and TWMV [‐4.69 (‐8.62, ‐0.76), 0.019]. Other CPs were not associated with any of the brain measures. In secondary analyses on individual cytokines, we found CRP was associated with reduced brain volumetric measures and reduced cortical thickness, but no association with brain was found for A2MG or IP‐10. Additionally, compared to the lowest tertile, moderate level (middle tertile) of platelet‐derived growth factor (PDGF‐AB/BB) was associated with larger TGMV; moderate level of macrophage inflammatory protein 1‐alpha was associated with smaller TBV and TWMV; and moderate level of PDGF‐AA was associated with smaller TWMV.ConclusionIn this cross‐sectional study of non‐demented older adults, we found a cytokine pattern characterized by high CRP, A2MG, and IP‐10 was associated with reduced brain volume, which seemed to be mainly driven by CRP.

Evaluation of Anti-inflammatory Activity after Treatment with the Biofield Energy Treated Proprietary Test Formulation on Combination of Cecal Slurry, LPS and E. Coli Induced Systemic Inflammatory Response Syndrome (SIRS) in Sprague Dawley Rats

The aim of this study was to evaluate the anti-inflammatory response of the Biofield Energy Treated Proprietary Test Formulation and Biofield Energy Treatment per se to the animals on Cecal Slurry, LPS and E. coli-induced systemic inflammatory response syndrome (SIRS) model in Sprague Dawley rats using serum inflammatory biomarkers. In this experiment, various inflammatory biomarkers such as monokine induced by gamma interferon (MIG), regulated on activation, normal T cell expressed and secreted (RANTES), macrophage inflammatory protein-2 (MIP-2), matrix metallopeptidase 9 (MMP-9), troponin-1, procalcitonin, fibrinogen degradation product (FDP) were analysed using ELISA assay. A test formulation was formulated including minerals (magnesium, zinc, calcium, selenium, and iron), vitamins (ascorbic acid, pyridoxine HCl, vitamin E, cyanocobalamin, and cholecalciferol), Panax ginseng extract, β-carotene, and cannabidiol isolate. The constituents of the test formulation were divided into two parts; one section was defined as the untreated test formulation, while the other portion of the test formulation and three group of animals received Biofield Energy Healing Treatment remotely for about 3 minutes by a renowned Biofield Energy Healer, Mr. Mahendra Kumar Trivedi. The results showed that the level of MIG was significantly (p≤0.01) reduced by 48.57%, 56.14%, 47.95%, 51.92%, and 47.83% in the G5 (Cecal Slurry, LPS and E. coli along with the Biofield Energy Treated test formulation); G6 (Cecal Slurry, LPS and E. coli along with Biofield Energy Treatment per se to animals from day -15); G7 (Cecal Slurry, LPS and E. coli along with the Biofield Energy Treated test formulation from day -15); G8 (Cecal Slurry, LPS and E. coli along with Biofield Energy Treatment per se plus the Biofield Energy Treated test formulation from day -15), and G9 (Cecal Slurry, LPS and E. coli along with Biofield Energy Treatment per se animals plus the untreated test formulation) groups, respectively as compared to the disease control (G2) group. Additionally, the level of regulated on activation, normal T cell expressed and secreted (RANTES) was significantly (p≤0.001) decreased by 47.35%, 46.32%, 40.73%, 50.47%, and 39.96% in the G5, G6, G7, G8, and G9 groups, respectively as compared to the G2 group. The level of macrophage inflammatory protein-2 (MIP-2) was significantly (p≤0.001) decreased by 91.74%, 93.54%, 92.70%, 94.46%, and 93.80% in the G5, G6, G7, G8, and G9 groups, as compared to the G2 group. The level of MMP-9 was significantly (p≤0.001) decreased by 18.74%, 35.54%, 26.48%, 38.16%, and 22.52% in the G5, G6, G7, G8, and G9 groups, respectively as compared to the G2 group. Moreover, the level of troponin-1 was decreased by 28.53%, 28.50%, 14.14%, 30.68%, and 36.34% in the G5, G6, G7, G8, and G9 groups, respectively as compared to the untreated test formulation (G4) group. Additionally, the level of procalcitonin was significantly (p≤0.001) decreased by 27.27%, 51.73%, 46.40%, 54.65%, and 39.08% in the G5, G6, G7, G8, and G9 groups, respectively as compared to the G2 group. Further, the level of fibrinogen degradation product (FDP) was significantly (p≤0.001) decreased by 66.7%, 62.5%, 31.5%, 51.6% and 40.1% in the G5, G6, G7, G8, and G9 groups, respectively as compared to the G2 group. Overall, the data suggested anti-inflammatory potentials of the Biofield Energy Treated test formulation and Biofield Energy Treatment per se along with preventive measure on the animal with respect to various inflammatory conditions that might be beneficial various types of systemic inflammatory disorders specially sepsis, trauma, septic shock or any types of injuries. Therefore, the results showed the significant slowdown the inflammation-related disease progression and its complications/symptoms in the preventive Biofield Energy Treatment group per se and/or Biofield Energy Treated Test formulation groups (viz. G6, G7, G8, and G9) comparatively with the disease control group.

Antioxidant and Anti-Inflammatory Activities of Biofield Energy Treated Proprietary Test Formulation in Brain Tissues in Cecal Slurry, LPS and E. Coli-Induced Systemic Inflammatory Response Syndrome (SIRS) in Sprague Dawley Rats

The study was aimed to evaluate the antioxidant and anti-inflammatory activity of the Biofield Energy Treated Proprietary Test Formulation and Biofield Energy Treatment per se to the animals on Cecal Slurry, LPS and E. coli-induced systemic inflammatory response syndrome (SIRS) model in Sprague Dawley rats. In this experiment, different antioxidants biomarkers such as myeloperoxidase (MPO), superoxide dismutase (SOD), lipid peroxidase (LPO) and cytokines like interleukin-6 (IL-6), tumor necrosis factor-α (TNF-α), macrophage inflammatory protein-2 (MIP-2) were analysed using ELISA assay in brain homogenate. A test formulation was formulated including minerals (magnesium, zinc, calcium, selenium, and iron), vitamin C, B6, E, B12, D3, β-carotene, cannabidiol isolate,and Panax ginseng extract. The component of the test formulation were divided into two parts; one section was defined as the untreated, while the other portion of each constituent and three group of animals received Biofield Energy Healing/Blessing Treatment remotely for about 3 minutes by Mr. Mahendra Kumar Trivedi, a renowned spiritual Energy Healer. The level of MPO was significantly (p≤0.001) reduced by 19.43%, 34.91%, 25.43%, 25.29% and 30.33% in the G5 (Cecal Slurry, LPS and E. coli + Biofield Energy Treated test formulation); G6 (Cecal Slurry, LPS and E. coli + Biofield Energy Treatment per se to animals from day -15); G7 (Cecal Slurry, LPS and E. coli + Biofield Energy Treated test formulation from day -15); G8 (Cecal Slurry, LPS and E. coli + Biofield Energy Treatment per se + Biofield Energy Treated/Blessed test formulation from day -15), and G9 (Cecal Slurry, LPS and E. coli + Biofield Energy Treatment per se animals + untreated test formulation) groups, respectively as compared to the untreated test formulation (G4) group. Moreover, the level of SOD was significantly increased by 45.02% (p≤0.001), 16.59%, and 35.99% (p≤0.001) in the G6, G7, and G9 groups, respectively as compared to G4 group. The level of TNF-α was significantly decreased by 12.66%, 46.92% (p≤0.001), 26.57% (p≤0.001), 23.22% (p≤0.001), and 54.28% (p≤0.001) in G5, G6, G7, G8, and G9 groups, correspondingly with reference to G4 group. Moreover, the level of IL-6 was significantly (p≤0.001) decreased by 37.51%, 20.28%, 21.55%, and 33.4% in the G6, G7, G8, and G9 groups, respectively as compared to the G4 group. Additionally, the level of MIP-2 was significantly (p≤0.001) reduced by 47.97%, 17.08%, 20.16% and 26.84% in the G6, G7, G8, and G9 groups, respectively as compared to the G4 group. Together, the data imply the antioxidant and anti-inflammatory potential of the Biofield Energy Treated test formulation and Biofield Energy Treatment per se along with preventive measure on the animal with respect to various inflammatory conditions that might be beneficial various types of systemic inflammatory disorders specially sepsis, trauma, septic shock or any types of injuries. Therefore, the results described a significant reduction of inflammation-related disease progression rate and its complications in the preventive maintenance groups (viz. G6, G7, G8, and G9).

Anti-Inflammatory Activity of Biofield Energy Treated Proprietary Test Formulation on Cecal Slurry, LPS and E. coli Induced Systemic Inflammatory Response Syndrome (SIRS) Model in Sprague Dawley Rats

The aim of this experiment was to evaluate the anti-inflammatory potential of the Biofield Energy Treated Proprietary Test Formulation and Biofield Energy Treatment per se to the animals on Cecal Slurry, LPS, and E. coli-induced systemic inflammatory response syndrome (SIRS) model in Sprague Dawley rats. The parameters studies in this experiment includes tumour necrosis factor alpha (TNF-α), interleukin-6 (IL-6), macrophage inflammatory protein-2 (MIP-2), matrix metallopeptidase 9 (MMP9), fibrin degradation products (FDP), Substance P, inducible nitric oxide synthase (iNOS) were analysed using ELISA assay. A test formulation was formulated including minerals (magnesium, zinc, calcium, selenium, and iron), vitamins (ascorbic acid, pyridoxine HCl, vitamin E, cyanocobalamin, and cholecalciferol), Panax ginseng extract, β-carotene, and cannabidiol isolate. The constituents of the test formulation were divided into two parts; one section was defined as the untreated test formulation, while the other portion of the test formulation and three group of animals received Biofield Energy Healing Treatment (prayer) remotely for about 3 minutes by a renowned Biofield Energy Healer, Mr. Mahendra Kumar Trivedi. The level of TNF-α was significantly (p≤0.001) decreased by 46.94% and 55.91% in the G6 (Cecal Slurry, LPS and E. coli along with Biofield Energy Treatment per se to animals from day -15) group as compared to the disease control group (G2) and the untreated test formulation (G4), respectively. The level of IL-6 was significantly (p≤0.001) reduced by 51.44% and 42.92% in the G6 group as compared to the disease control (G2) group and untreated test formulation group, respectively. The level of MIP-2 was significantly reduced by 21.52% and 31.54% (p≤0.001) in the G6 group as compared to the G2 and G4 groups, respectively. The level of MMP-9 was significantly decreased by 40.13% (p≤0.001) and 20.92% in the G6 and G8 groups, respectively as compared to the G2 group. Moreover, the level of FDP was significantly (p≤0.001) decreased by 38.22% and 50.53% in the G6 group as compared to the G2 and G4 groups, respectively. The level of substance P was significantly (p≤0.001) decreased by 36.96% and 38.20% in the G6 group as compared to the G2 and G4, groups, respectively. The level of iNOS was significantly (p≤0.001) decreased by 35.41% in the G6 group as compared to the G4 group. Overall, the data suggested the anti-inflammatory potentials of the Biofield Energy Treated test formulation and Biofield Energy Treatment per se along with preventive measure on the animal with respect to various inflammatory conditions that might be beneficial various types of systemic inflammatory disorders specially sepsis, trauma, septic shock or any types of injuries. Therefore, the results showed the significant slowdown the inflammation-related disease progression and its complications/symptoms in the preventive Biofield Energy Treatment group per se group (G6) comparatively with the disease control group.

Antioxidant and Anti-Inflammatory Activities of Biofield Energy Treated Proprietary Test Formulation in Intestinal Tissues on Combination of Cecal Slurry, LPS and E. coli Induced Systemic Inflammatory Response Syndrome (SIRS) in Sprague Dawley Rats

The study was aimed to evaluate the antioxidant and anti-inflammatory activity of the Biofield Energy Treated Proprietary Test Formulation and Biofield Energy Treatment per se to the animals on Cecal Slurry, LPS and E. coli-induced systemic inflammatory response syndrome (SIRS) model in Sprague Dawley rats. In this experiment, different antioxidants biomarkers such as myeloperoxidase (MPO), superoxide dismutase (SOD), lipid peroxidase (LPO) and proinflammatory cytokines such as tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6), macrophage inflammatory protein-2 (MIP-2) were analysed using ELISA assay in intestines. A test formulation was formulated including minerals (magnesium, zinc, calcium, selenium, and iron), vitamins (ascorbic acid, pyridoxine HCl, vitamin E, cyanocobalamin, and cholecalciferol), Panax ginseng extract, β-carotene, and cannabidiol isolate. The constituents of the test formulation were divided into two parts; one section was defined as the untreated test formulation, while the other portion of the test formulation and three groups of animals received Biofield Energy Healing Treatment remotely for about 3 minutes by a renowned Biofield Energy Healer, Mr. Mahendra Kumar Trivedi. The level of MPO was reduced by 21.16%, 15.9%, and 11.95% in the G5 (Cecal Slurry, LPS and E. coli along with the Biofield Energy Treated test formulation); G7 (Cecal Slurry, LPS and E. coli along with the Biofield Energy Treated test formulation from day -15); and G8 (Cecal Slurry, LPS and E. coli along with Biofield Energy Treatment per se plus the Biofield Energy Treated test formulation from day -15) groups, respectively as compared to the disease control (G2) group. Moreover, the level of SOD was increased by 30.34% (p≤0.001), 10.30%, and 13.62% in the G5, G6, and G8 group as compared to the untreated test formulation (G4) group. The level of lipid peroxidation (LPO) end product in terms of malondialdehyde (MDA) was significantly reduced by 23.58% (p≤0.001), 17.99% (p≤0.01), and 15.62% (p≤0.001) in the G5, G6, and G7 groups, respectively as compared to the G2 group. The level of TNF-α was decreased by 7.81% in the G5 group as compared to the G2 group. Moreover, the level of IL-6 was decreased by 38%, 40.4%, and 15.35% in the G7, G8, and G9 groups, respectively as compared to the G4 group. Additionally, the level of MIP-2 was reduced by 40.35%, 60.29%, 49.33%, and 42.43% in the G5, G7, G8, and G9 groups, respectively as compared to the G2 group. Overall, the data suggested the antioxidant and anti-inflammatory potentials of the Biofield Energy Treated test formulation and Biofield Energy Treatment per se along with preventive measure on the animal with respect to various inflammatory conditions that might be beneficial various types of systemic inflammatory disorders specially sepsis, trauma, septic shock or any types of injuries. Therefore, the results showed the significant slowdown the inflammation-related disease progression and its complications/symptoms in the preventive Biofield Energy Treatment group per se and/or Biofield Energy Treated Test formulation groups (viz. G6, G7, G8, and G9) comparatively with the disease control group.

Toll-like receptor 4 methylation grade is linked to depressive symptom severity

This study explores potential associations between the methylation of promoter-associated CpG sites of the toll-like receptor (TLR)-family, plasma levels of pro-inflammatory proteins and depressive symptoms in young female psychiatric patients. Ratings of depressive symptoms and blood samples were obtained from 92 young women seeking psychiatric care. Methylation of 32 promoter-associated CpG sites in TLR1 to TLR10 was analysed using the Illumina Infinium Methylation EPIC BeadChip. Expression levels of 91 inflammatory proteins were determined by proximity extension assay. Statistical correlations between depressive state, TLR1-10 methylation and inflammatory proteins were investigated. Four additional cohorts were studied to evaluate the generalizability of the findings. In the discovery cohort, methylation grade of cg05429895 (TLR4) in blood was inversely correlated with depressive symptoms score in young adults. After correction for multiple testing, plasma levels of macrophage inflammatory protein 1β (MIP-1β/CCL4) were associated with both TLR4 methylation and depressive symptom severity. A similar inverse association between TLR4 methylation in blood and affective symptoms score was also found in a cohort of 148 both males and females (<40 years of age) from the Danish Twin Registry. These findings were not, however, replicated in three other external cohorts; which differed from the first two cohorts by a higher age and mixed ethnicities, thus limiting the generalizability of our findings. However, TLR4 methylation inversely correlated with TLR4 mRNA expression in the Danish Twin Study indicating a functional significance of methylation at this particular CpG. Higher depression scores in young Scandinavian adults was associated with decreased methylation of TLR4 in blood.

Association of microsomal epoxide hydrolase gene (fast genotype) with lung functions impairment in wood workers.

Exposure to wood dust may lead to impairment of the lung functions. Microsomal epoxide hydrolase enzyme (EPHX1) was shown to take part in protection against oxidative stress. An alteration in enzyme activity might be associated with its gene polymorphisms. In vitro polymorphisms in exons 3 (His113Tyr) and 4 (Arg139His) lead to reduced activity (slow allele) and increased activity (fast allele). Macrophage inflammatory protein 2 (MIP-2) is produced in rat lung epithelial cells after exposure to fine particles. We aimed to investigate the associations between mEPHX1 polymorphisms (in exon 3 and 4) and lung function in furniture workers and assessment of MIP-2 effect. Our study was performed on 70 wood dust exposed male workers and 70 matched normal controls subjects. Ventilatory function tests were measured by spirometer, MIP-2 was performed by ELISA methods and EPHX gene was done by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) methods for each participant. Significant reduction in forced vital capacity (FVC%) and forced expiratory volume in the first second (FEV1) levels in Tyr-Tyr and Tyr-Hist genotypes of EPHX (exon 3) was observed. Reduced peak expiratory flow (PEF) levels and significant rise in MIP-2 levels were detected in Tyr-Tyr genotype. While high significant reduction in FVC% and FEV1 levels were shown in different genotypes in exon 4. Significant rise was observed in MIP-2 levels in Hist-Hist genotype of exon 4. An increase in duration of exposure showed positive correlation with fall in ventilatory functions. It was concluded that in Hist139Arg of EPHX gene, fast genotype (Arg-Arg) was associated with impaired ventilatory functions.

Suppression of Hypoxia-Inducible Factor 1α by Low-Molecular-Weight Heparin Mitigates Ventilation-Induced Diaphragm Dysfunction in a Murine Endotoxemia Model.

Mechanical ventilation (MV) is required to maintain life for patients with sepsis-related acute lung injury but can cause diaphragmatic myotrauma with muscle damage and weakness, known as ventilator-induced diaphragm dysfunction (VIDD). Hypoxia-inducible factor 1α (HIF-1α) plays a crucial role in inducing inflammation and apoptosis. Low-molecular-weight heparin (LMWH) was proven to have anti-inflammatory properties. However, HIF-1α and LMWH affect sepsis-related diaphragm injury has not been investigated. We hypothesized that LMWH would reduce endotoxin-augmented VIDD through HIF-1α. C57BL/6 mice, either wild-type or HIF-1α–deficient, were exposed to MV with or without endotoxemia for 8 h. Enoxaparin (4 mg/kg) was administered subcutaneously 30 min before MV. MV with endotoxemia aggravated VIDD, as demonstrated by increased interleukin-6 and macrophage inflammatory protein-2 levels, oxidative loads, and the expression of HIF-1α, calpain, caspase-3, atrogin-1, muscle ring finger-1, and microtubule-associated protein light chain 3-II. Disorganized myofibrils, disrupted mitochondria, increased numbers of autophagic and apoptotic mediators, substantial apoptosis of diaphragm muscle fibers, and decreased diaphragm function were also observed (p < 0.05). Endotoxin-exacerbated VIDD and myonuclear apoptosis were attenuated by pharmacologic inhibition by LMWH and in HIF-1α–deficient mice (p < 0.05). Our data indicate that enoxaparin reduces endotoxin-augmented MV-induced diaphragmatic injury, partially through HIF-1α pathway inhibition.

DNA Methylation and Transcription of HLA-F and Serum Cytokines Relate to Chinese Medicine Syndrome Classification in Patients with Chronic Hepatitis B.

To explore the molecular bases of Chinese medicine (CM) syndrome classification in chronic hepatitis B (CHB) patients in terms of DNA methylation, transcription and cytokines. Genome-wide DNA methylation and 48 serum cytokines were detected in CHB patients (DNA methylation: 15 cases; serum cytokines: 62 cases) with different CM syndromes, including dampness and heat of Gan (Liver) and gallbladder (CHB1, DNA methylation: 5 cases, serum cytokines: 15 cases), Gan stagnation and Pi (Spleen) deficiency (CHB2, DNA methylation: 5 cases, serum cytokines: 15 cases), Gan and Shen (Kidney) yin deficiency (CHB3, DNA methylation: 5 cases, serum cytokines: 16 cases), CHB with hidden symptoms (HS, serum cytokines:16 cases) and healthy controls (DNA methylation: 6 cases). DNA methylation of a critical gene was further validated and its mRNA expression was detected on enlarged samples. Genome-wide DNA methylation was detected using Human Methylation 450K Assay and furthered verified using pyrosequencing. Cytokines and mRNA expression of gene were evaluated using multiplex biometric enzyme-linked immunosorbent assay (ELISA)-based immunoassay and reverse transcription-quantitative polymerase chain reaction (RT-qPCR), respectively. Totally 28,667 loci, covering 18,403 genes were differently methylated among CHB1, CHB2 and CHB3 (P<0.05 and |Δβ value| > 0.17). Further validation showed that compared with HS, the hg19 CHR6: 29691140 and its closely surrounded 2 CpG loci were demethylated and its mRNA expressions were significantly up-regulated in CHB1 (P<0.05). However, they remained unaltered in CHB2 (P>0.05). Levels of Interleukin (IL)-12 were higher in CHB3 and HS than that in CHB1 and CHB2 groups (P<0.05). Levels of macrophage inflammatory protein (MIP)-1α and MIP-1β were higher in CHB3 than other groups and leukemia inhibitory factor level was higher in CHB1 and HS than CHB2 and CHB3 groups (P<0.05). IL-12, MIP-1α and MIP-1β concentrations were positively correlated with human leukocyte antigen F (HLA-F) mRNA expression (R2=0.238, P<0.05; R2=0.224, P<0.05; R=0.447, P<0.01; respectively). Furthermore, combination of HLA-F mRNA and differential cytokines greatly improved the differentiating accuracy among CHB1, CHB2 and HS. Demethylation of CpG loci in 5' UTR of HLA-F may up-regulate its mRNA expression and HLA-F expression was associated with IL-12, MIP-1α and MIP-1β levels, indicating that HLA-F and the differential cytokines might jointly involve in the classification of CM syndromes in CHB. ChiCTR-RCS-13004001.

Antioxidant and Anti-Inflammatory Activities of Biofield Energy Treated Proprietary Test Formulation in Lungs Tissues on Combination of Cecal Slurry, LPS and E. coli Induced Systemic Inflammatory Response Syndrome (SIRS) in Sprague Dawley Rats

The aim of this experiment was to evaluate the antioxidant and anti-inflammatory potential of the Biofield Energy Treated Proprietary Test Formulation and Biofield Energy Treatment per se to the animals on Cecal Slurry, LPS and E. coli-induced systemic inflammatory response syndrome (SIRS) model in Sprague Dawley rats using lungs antioxidants and cytokines. In this experiment, various antioxidants like myeloperoxidase (MPO), superoxide dismutase (SOD), lipid peroxidation (LPO) and proinflammatory cytokines such as tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6), macrophage inflammatory protein-2 (MIP-2) were analysed using ELISA assay in lungs. A test formulation was formulated including minerals (magnesium, zinc, calcium, selenium, and iron), vitamins (ascorbic acid, pyridoxine HCl, vitamin E, cyanocobalamin, and cholecalciferol), Panax ginseng extract, β-carotene, and cannabidiol isolate. The constituents of the test formulation were divided into two parts; one section was defined as the untreated test formulation, while the other portion of the test formulation and three group of animals received Biofield Energy Healing Treatment remotely for about 3 minutes by a renowned Biofield Energy Healer, Mr. Mahendra Kumar Trivedi. The level of MPO was reduced by 45.77%, 53.36%, 47.80%, 53.89%, and 57.72% in the G5 (Cecal Slurry, LPS and E. coli along with the Biofield Energy Treated test formulation); G6 (Cecal Slurry, LPS and E. coli along with Biofield Energy Treatment per se to animals from day -15); G7 (Cecal Slurry, LPS and E. coli along with the Biofield Energy Treated test formulation from day -15); G8 (Cecal Slurry, LPS and E. coli along with Biofield Energy Treatment per se plus the Biofield Energy Treated test formulation from day -15), and G9 (Cecal Slurry, LPS and E. coli along with Biofield Energy Treatment per se animals plus the untreated test formulation) groups, respectively as compared to the disease control (G2) group. Additionally, the level of SOD was increased by 7% in the G9 group as compared to the untreated test formulation (G4) group. The level of lipid peroxidation (LPO) end product in terms of malondialdehyde (MDA) was significantly reduced by 15.46% (p≤0.05), 14.53% (p≤0.05), and 11.88% in the G5, G6, G7, and G8 groups, respectively as compared to the G4 group. The level of TNF-α was decreased by 15.05%, 42.48% (p≤0.001), 48.73% (p≤0.001), and 42.85% (p≤0.001) in the G5, G6, G7, and G8 groups, respectively as compared to the G2 group. Moreover, the level of IL-6 was decreased by 29.44% (p≤0.001), 19%, 39.56% (p≤0.001), and 40.79% (p≤0.001) in the G5, G6, G7, and G8 groups, respectively as compared to the G2 group. Additionally, the level of MIP-2 was reduced by 10.99%, 14.37%, 40.16%, 16.75%, and 18.41% in the G5, G6, G7, G8, and G9 groups, respectively as compared to the G4 group. Overall, the data suggested the antioxidant and anti-inflammatory potentials of the Biofield Energy. Treated test formulation and Biofield Energy Treatment per se along with preventive measure on the animal with respect to various inflammatory conditions that might be beneficial various types of systemic inflammatory disorders specially sepsis, trauma, septic shock or any types of injuries. Therefore, the results showed the significant slowdown the inflammation-related disease progression and its complications/symptoms in the preventive Biofield Energy Treatment group per se and/or Biofield Energy Treated Test formulation groups (viz. G6, G7, G8, and G9) comparatively with the disease control group.

High-Dose Vitamin C Administration Inhibits the Invasion and Proliferation of Melanoma Cells in Mice Ovary.

Several studies have been conducted to explore the anticancer effects of vitamin C (VC). However, the effect of high-dose VC administration on melanoma is still unknown. Therefore, in this study, we investigated the effects of high-dose VC (4 g/kg) on the invasion and proliferation of melanoma cells in various organs of mice. B16 melanoma cells (1 × 106 cells/100 µL) were intravenously injected into the tails of female mice, and VC solution (4 g/kg) was orally administered once a day for 14 d. On the 15th day, samples from the liver, lungs, jejunum, and ovaries were collected and analyzed for invasion and proliferation of melanoma cells. Oral VC administration decreased the number of dihydroxyphenylalanine (DOPA)-positive cells and gp100-positive melanoma cells in the ovaries and suppressed the invasion and proliferation of melanoma. Compared to melanoma-administered mice, macrophage inflammatory protein-2 levels and number of neutrophils were increased in the VC + melanoma-administered mice. Furthermore, the concentrations of VC, iron, and hydrogen peroxide, and the number of terminal deoxynucleotidyl transferase mediated deoxyuridine triphosphate nick end labeling (TUNEL)-positive cells were significantly increased in the ovaries of VC + melanoma-administered mice compared to those of melanoma-administered mice. These results suggest that VC can reduce the invasion and proliferation of melanoma cells in the ovaries, and neutrophils in the ovaries play an important role in achieving this melanoma-suppressive effect.

Oral carbohydrate solution cause an inflammatory response when aspirated into the lungs in mice.

Many studies have been published on the beneficial effects of oral carbohydrate solutions (OCS) administered prior to surgery. However, the risk of pulmonary aspiration cannot be excluded in all patients undergoing anesthesia. But, there are few studies on the safety of OCS at lung aspiration. Experiments were conducted with mice (Nine- to ten-week-old male BALB/c mice weighted 23-26g). Lung aspiration was performed by intratracheal administration of OCS and its major constituents, fructose and maltodextrin. Bronchoalveolar lavage fluid (BALF) was collected 3 and 24h after lung aspiration. The level of Tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6) and macrophage inflammatory protein-2 (MIP-2) were measured in BALF. The total white blood cell, neutrophil counts, wet to dry ratio and histological examination were performed in BALF and lung tissue, respectively, at 24h after aspiration. The OCS increased the level of TNF-α, IL-6 and MIP-2 at 3h and the neutrophil count at 24h in BALFs, compared to a phosphate-buffered saline (PBS) group. The increase in IL-6 level induced by OCS was maintained for 24h. The OCS also increased the number of white blood cells and the percentage of neutrophils in BALFs. Compared to fructose, maltodextrin significantly increased the production of MIP-2 in BALFs. OCS and maltodextrin also increased neutrophil recruitment in lung tissue. Aspiration of OCS may cause inflammation of the lungs. The preoperative use of OCS may require caution under specific clinical conditions, such as patients at risk of lung aspiration.

Impact of Ozone, Sex, and Gonadal Hormones on Bronchoalveolar Lavage Characteristics and Survival in SP-A KO Mice Infected with Klebsiella pneumoniae.

Surfactant protein A (SP-A) plays an important role in innate immunity. The sex-dependent survival of infected SP-A knockout (KO) mice has been observed. Our goal was to study the impact of ozone (O3) and sex, as well as gonadal hormones, on the bronchoalveolar lavage (BAL) readouts and survival, respectively, of Klebsiella pneumoniae-infected SP-A KO mice. Male and female SP-A KO mice were exposed to O3 or filtered air and infected with K. pneumoniae. We studied markers of inflammation and tissue damage at 4, 24, and 48 h, as well as the survival over 14 days, of gonadectomized (Gx) mice implanted with control pellets (CoP) or hormone (5α-dihydrotestosterone (DHT) in female gonadectomized mice (GxF) or 17β-estradiol (E2) in male gonadectomized mice (GxM)). We observed: (1) an increase in neutrophil and macrophage inflammatory protein-2 levels as time progressed post-infection, and O3 exposure appeared to increase this response; (2) an increase in lactate dehydrogenase, total protein, oxidized protein, and phospholipids in response to O3 with no consistent sex differences in studied parameters; and (3) a reduction in survival of the GxM and CoP mice, the GxM and E2 mice, and the GxF and DHT mice but not for the GxF and CoP mice after O3. Without SP-A, (a) sex was found to have a minimal impact on BAL cellular composition and tissue damage markers, and (b) the impact of gonadal hormones on survival was found to involve different mechanisms than in the presence of SP-A.

Sophoricoside attenuates neuronal injury and altered cognitive function by regulating the LTR-4/NF-κB/PI3K signalling pathway in anaesthetic-exposed neonatal rats.

This study examined the protective effects of sophoricoside on neuronal injury and cognitive dysfunction in anaesthetic-exposed neonatal rats. Neuronal injury was induced in rat pups by exposure to isoflurane (0.75%) with 30% oxygen for 6 h on P7. The protective effects of sophoricoside were evaluated by assessing cognitive function using the neurological score and Morris water maze. Neuronal apoptosis was assessed in hippocampus tissue using a TUNEL assay. The cytokine and macrophage inflammatory protein levels were assessed by ELISA. Western blot assays and RT-PCR were performed to assess the expression of NF-κB, TLR-4, Akt, and PI3K proteins in neuronal tissues. Immunohistochemical and histopathological changes were observed in the brain tissues of isoflurane-induced neuronal injury rats. The sophoricoside treatment improved cognitive and neuronal function in rats exposed to isoflurane. Cytokine and MIP levels in the brain tissues of isoflurane-exposed rats decreased. However, sophoricoside treatment attenuated the expression of TLR-4, PI3K, and Akt protein in the brain tissues of isoflurane-exposed rats. The histopathology improved in the sophoricoside-treated isoflurane-exposed rats. Sophoricoside treatment protects against neuronal injury and reduced cognitive function in isoflurane-induced neuronal injury rats by regulating TLR-4 signalling.

Crocin has pharmacological effects against the pathological behavior of colon cancer cells by interacting with the STAT3 signaling pathway.

The aim of the present study was to investigate changes in proliferation, apoptosis, inflammation and chemokine release of colon cancer cells after treatment with crocin, as well as to investigate the signaling pathway that is regulated by crocin. The inhibition rates of different doses of crocin on the proliferation of HCT116 cells were measured by MTT assay. The IC50 was calculated from the inhibition rates at 48 h. Proliferation curves of HCT116 cells were plotted after treatment with 271.18 µM (high-dose group) or 135.6 µM (low-dose group) crocin. Flow cytometry and Hoechst 33342/propidium iodide double staining were used for detecting apoptosis. ELISA was used to measure the levels of macrophage inflammatory protein 2, interleukin (IL)-8, monocyte chemoattractant protein 1, tumor necrosis factor-α, IL-6 and IL-1β in the supernatant from cultured HCT116 cells following both high- and low-dose crocin treatment. Phosphorylated (P)-STAT3/STAT3 in HCT116 cells were measured by western blotting. Crocin inhibited the proliferation of HCT116 cells in a dose-dependent manner and the high-dose treatment with crocin resulted in a lower rate of proliferation. Additionally, crocin increased the apoptosis of HCT116 cells and the high-dose treatment with crocin led to a higher level of apoptosis. Notably, crocin decreased the secretion of chemokines and inflammatory factors from HCT116 cells and the high-dose treatment with crocin caused the greatest reduction in secretion of the factors. Crocin reduced the ratio of P-STAT3/STAT3, and thereby reduced the release of cytokines. The present study demonstrated that crocin may have pharmacological effects against the pathological behavior of colon cancer cells, and its mechanism of action may be related to the STAT3 signaling pathway.

Sevoflurane Preconditioning Prevents Septic Myocardial Dysfunction in Lipopolysaccharide-Challenged Mice.

Myocardial dysfunction accompanied by severe sepsis could significantly increase the mortality rate of septic patients. This study investigated the effects and the potential mechanisms of sevoflurane preconditioning on septic myocardial dysfunction, which was induced by lipopolysaccharide (LPS; from Escherichia coli O55:B5; 18 mg/kg) in mice. Results indicated that 1 hour after the administration, LPS induced a significant increase in cell-surface Toll-like receptor 4 (TLR4), cytoplasmic IKKα protein expression, and nuclear translocation of nuclear factor kappa-B (NF-κB) protein (P < 0.05), which was attenuated by preconditioning with sevoflurane. Two hours after the administration, inhalation of sevoflurane significantly reduced the serum levels of tumor necrosis factor-alpha (TNF-α), interleukin (IL)-1β, and IL-10 (P < 0.05). Twelve hours after administration, LPS caused pathological damage to the heart and elevated the serum levels of lactate dehydrogenase (LDH) and creatine kinase-MB (P < 0.05). Echocardiography indicated that sevoflurane preconditioning significantly improved systolic and diastolic function. The inhalation of sevoflurane inhibited increases in myeloperoxidase (MPO), macrophage inflammatory protein-2 (MIP-2), TNF-α, and IL-1β levels (P < 0.05) induced by endotoxemia, whereas IL-6 release was facilitated. Sevoflurane attenuated the myocardial levels of nitric oxide (P < 0.05) without an apparent influence on malondialdehyde (MDA) or superoxide dismutase (P > 0.05). In conclusion, our study indicates that exposure to 2% sevoflurane before LPS challenge is protective against myocardial dysfunction. Sevoflurane preconditioning may attenuate neutrophil infiltration and the release of inflammatory mediators during endotoxemia.