Cutaneous Leiomyomatosis Research Articles

A sporadic diffuse multiple cutaneous leiomyomatosis mimicking plexiform neurofibromatosis: A surgical challenge

AbstractA 32‐year‐old male presented with diffuse plaques accompanied by multiple large, painful swellings predominantly distributed over the trunk, face and both upper and lower extremities for 11 years. There was no family history of similar complaints. The histopathological examination (HPE), supplemented with special stains confirmed the diagnosis of cutaneous leiomyoma (CL). The immunohistochemical analysis showed a strong expression of smooth muscle actin. The final diagnosis of sporadic diffuse multiple cutaneous leiomyomatosis was made. This presentation of CL is uncommon and resembled plexiform neurofibroma. The clinical diagnosis of this presentation was challenging. Therefore, HPE combined with special stains aided in confirming this surgically challenging rare tumour. In resource‐poor settings regular screening is required for early detection of renal cancer and other associated complications.

Familial multiple cutaneous leiomyomatosis in siblings: A rare case report

Piloleiomyoma, also known as Leiomyoma cutis, is a rare and benign smooth muscle tumour developing from the arrector pili muscle. It typically manifests as reddish-brown papules or nodules that are commonly present over the trunk and extremities, and are frequently associated with episodic pain. Familial multiple cutaneous leiomyomatosis have been reported in twins, siblings and multiple generations in a family which have a genetic predisposition and are found to be closely associated with uterine leiomyomas and renal cell carcinomas. In this article, we report a rare case of multiple cutaneous leiomyomatosis in siblings aged 54 years and 58 years respectively, diagnosed clinically and further confirmed with histopathological examination revealing typical features of cutaneous leiomyoma and positive immuno-histochemical testing for smooth muscle actin (SMA).

Cutaneous Leiomyomatosis – Case Report and Literature Review

Cutaneous leiomyomas are uncommon benign smooth muscle tumors that comprise of three distinct types such as piloleiomyoma, angioleiomyoma, and genital leiomyoma. The discovery in 2001 of the association between cutaneous leiomyomas, uterine leiomyomas in women, and an aggressive form of renal cell cancer (RCC) underscores the importance of accurate dermatologic diagnosis of CL so that appropriate cancer screening and counseling of patients and at-risk relatives can be instituted. The present case report will discuss the pathogenesis, clinical manifestations, diagnosis, and management of a piloleiomyoma.

Reed's Syndrome - A Rare Case of Multiple Cutaneous and Uterine Leiomyomatosis With Renal Cyst.

Reed's Syndrome - A Rare Case of Multiple Cutaneous and Uterine Leiomyomatosis With Renal Cyst.

Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase.

Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle.

Identification of novel fumarate hydratase gene alterations in prostate cancer.

11585 Background: Fumarate hydratase (FH), an enzyme involved in the Krebs cycle, plays a crucial role in the generation of energy and oxygenation of cells. Genomic alterations (GAs) of FH, a tumor suppressor gene, have been shown to cause chronic hypoxia that encourages tumor formation and have been linked to hereditary leiomyomatosis and renal cell cancer. Only few reports have associated FH mutations with other cancers, and none in prostate cancer. Methods: Identification of an FH V435M pathogenic alteration, which likely changes fumarate binding kinetics, in a prostate cancer patient, with negative family history for renal cancer and cutaneous leiomyomatosis, led to review of a database of 1781 prostate cancer patients, whose tissue was assayed by hybrid-capture based comprehensive genomic profiling (CGP) in the course of clinical care to evaluate genomic alterations (GA: base substitutions, indels, amplifications, copy number alterations, fusions/rearrangements) and targeted therapy opportunities. Tumor mutational burden (TMB) was calculated from a minimum of 1.11 Mb sequenced DNA and reported as mutations/Mb. Results: Profiling identified 49 prostate adenocarcinoma patients (3%) with FH gene alterations, 2 of which harbored the V435M GA identified in the original prostate patient. Ten of 40 alterations were H476_k477 insertions, in the C terminus domain, and 14 were amplifications. The rest were variants of unknown significance (VUS). Conclusions: A FH GA, known to impact other cancers, found in a prostate cancer, led to the discovery of a frequency that suggests deregulation of metabolic pathway activation may contribute to prostate cancer pathogenesis for a subset of patients. The somatic FH GA’s are likely to be substantially more common than germline mutations, and identifying metabolic-enzyme mutations that are pathogenic in prostate cancer could lead to pharmacologic manipulations that are more effective and less toxic than existing therapies. No FDA approved therapies currently exist for this patient’s tumor type nor of any other tumor type with FH GA’s. In our case, alterations in the C-terminal binding domain of FH might inform drug development.

Successful treatment of multiple cutaneous leiomyomas with carbon dioxide laser ablation.

Successful treatment of multiple cutaneous leiomyomas with carbon dioxide laser ablation.

Gastrointestinal Stromal Tumour in a Patient with Multiple Cutaneous and Uterine Leiomyomatosis- Implications and Anaesthetic Management

Multiple cutaneous leiomyomatosis have been associated with uterine leiomyomatosis and known as Reed's syndrome or Multiple Cutaneous and Uterine Leiomyomatosis (MCUL). Gastrointestinal Stromal Tumours (GIST) have been reported to be associated with this syndrome only once previously in literature to the best of our knowledge. Here we report a rare case of GIST and multiple uterine leiomyomatosis in a middle aged patient with longstanding cutaneous leiomyomatosis who underwent GIST excision and hysterectomy. A 35year old female patient with multiple cutaneous leiomyomatosis for the past 20years was diagnosed to have gastrointestinal stromal tumour and multiple uterine leiomyomatosis for which she underwent laparotomy for GIST excision and hysterectomy. In the report we have elaborated the clinical and pathological observations as well as the anaesthetic management. This case report further substantiates the association of GIST with multiple cutaneous and uterine leiomyomatosis and also reminds us that cutaneous lesions can be clues to the diagnosis of underlying malignancy.

Cutaneous leiomyomatosis in a mother and daughter

A 34-year-old woman with no known medical history was evaluated for multiple painful brown nodules and papules on the anterior aspect of the trunk. She mentioned a history of similar cutaneous findings on her mother. Biopsies of three lesions revealed piloleiomyomata. Renal and adrenal ultrasound revealed an isolated simple cortical cyst, and pelvic and endovaginal ultrasound revealed two uterine myomata. The clinical diagnosis of hereditary leiomyomatosis and renal cell cancer was corroborated by the identification of a heterozygous variant on exon 5 of the fumarate hydratase gene (c.578C>T p.T193I). Identification of the tumor piloleiomyoma should alert the dermatologist to this rare genodermatosis, which is associated with an increased risk of renal cell tumors, demanding multidisciplinary follow-up, and personal and family counseling.

Familial leiomyomatosis cutis affecting nine family members in two successive generations including four cases of Reed′s syndrome

Reed's syndrome or familial leiomyomatosis cutis et uteri is an autosomal dominant disorder, characterized by multiple cutaneous and uterine leiomyomas. We report here a case of a 53-year-old woman who presented to us with multiple painful nodules over different parts of her body. Based on the histopathological examination, imaging, and past medical records, a diagnosis of Reed's syndrome was made. Three of her sisters had similar disease. Subsequently, it was found that a total of nine members of their family in two successive generations were affected with cutaneous leiomyomas. The present case series has been reported for its interesting clinical presentations and rarity.

Disseminated cutaneous leiomyomatosis treated with oral amlodipine

Disseminated cutaneous leiomyomatosis treated with oral amlodipine

Fumarate hydratase gene mutation in two young patients with sporadic uterine fibroids

Fumarate hydratase (FH) is a key enzyme of the Krebs cycle. Germline mutations in the FH gene encoding fumarate hydratase cause autosomal dominant syndromes multiple cutaneous and uterine leiomyomata and hereditary leiomyomatosis and renal cell cancer (HLRCC). Few data have been published on the role of FH gene mutation in development of uterine fibroids outside the context of multiple cutaneous and uterine leiomyomata /HLRCC. We report two FH gene mutations, one novel and one previously described, in two young patients with sporadic uterine fibroids and decreased fumarate hydratase activity in lymphocytes. In patient 1, a novel heterozygous mutation c.892G>C was found. In patient 2 we detected heterozygous mutation c.584T>C. Both the patients had a negative family history for renal cancer and cutaneous leiomyomatosis. None of the relatives, however, underwent renal imaging at the time of writing. FH mutation carriers may be easily identified by analysis of fumarate hydratase activity in blood lymphocytes. We suggest performing fumarate hydratase activity or FH mutation screening in women with onset of uterine fibroids in their 20s and family history of uterine fibroids or other HLRCC-associated malignancies.

Gastric Leiomyoma and Hyperplastic Polyposis Coli in a Patient with Multiple Cutaneous and Uterine Leiomyomatosis

Cutaneous leiomyomatosis has been associated with multiple uterine myomas and, more recently, with germline heterozygous mutations of the FH gene and certain types of renal cancer. Despite the growing amount of knowledge concerning this genodermatosis, its clinical spectrum remains incompletely characterized. We report the observation of a patient with multiple cutaneous and uterine leiomyomatosis (MCUL) with unusual gastrointestinal manifestations. A gastric leiomyoma was diagnosed on a 38-year-old female MCUL patient on endoscopy performed because of mild dyspepsia. Furthermore, routine colonoscopy disclosed hyperplastic polyposis. Genetic testing revealed a previously not reported mutation of the FH gene. Gastrointestinal lesions such as the present ones are frequently asymptomatic and probably underdiagnosed. As the phenotypical spectrum associated with mutations of the FH gene keeps expanding, clinicians should keep in mind that, besides renal cancer, other unexpected tumors could also arise in this setting.

Hereditary cutaneous leiomyomatosis

The occurrence of multiple cutaneous leiomyomas can be indicative of hereditary cutaneous leiomyomatosis. This autosomal dominant disorder is due to germline mutations in the fumarate hydratase (FH) gene. Associations with uterine myomas and renal cell carcinomas have been described and are referred to as Multiple Cutaneous and Uterine Leiomyomas (MCUL) or Hereditary Leiomyomatosis and Renal Cell Cancer (HLRCC), respectively. A 34-year-old man presented with multiple red-brown papules and nodules. After histopathologic confirmation of piloleiomyomas, we made the diagnosis of hereditary cutaneous leiomyomatosis. Taking into consideration the aforementioned complications, close interdisciplinary management of these patients and regular screening examinations within affected families are mandatory.

Você conhece esta síndrome?

Piloleiomyoma, a benign smooth-muscle tumor arising from the arrectores pilorum muscles of the skin, affects males and females in the third decade of life. It presents as asymmetrical, reddish-brown nodules or papules with a firm consistency, predominantly located on the limbs. When multiple lesions are present, they may be tender or painful. Their association with uterine fibroids, referred to as Reed syndrome or familial leiomyomatosis cutis et uteri, is rare and may be associated with renal cell carcinoma. The approach consists of surgical excision in cases presenting few lesions and pharmacological treatment if symptomatic. The present paper describes a case of Reed syndrome in which a decision was made to monitor the patient in view of the absence of symptoms.

Hereditary multiple cutaneous leiomyomatosis

Review on Hereditary multiple cutaneous leiomyomatosis, with data on clinics, and the genes involved.

Reed syndrome: Familial cutaneous and uterine leiomyomatosis

Reed syndrome: Familial cutaneous and uterine leiomyomatosis

NovelFHmutation in a patient with cutaneous leiomyomatosis associated with cutis verticis gyrata, eruptive collagenoma and Charcot-Marie-Tooth disease

Multiple cutaneous and uterine leiomyomatosis (MCUL)/hereditary leiomyomatosis and renal cell cancer (HLRCC) (OMIM 150800/OMIM 605839) is a rare hereditary disorder leading to the development of benign cutaneous and uterine smooth muscle tumours in young adults.(1,2) This disease is characterized by an increased risk of developing renal cell carcinomas.(3) It results from dominantly inherited autosomal mutations in the fumarate hydratase (FH) gene.(4) This gene encodes a Krebs cycle enzyme, present in both cytosolic and mitochondrial compartments, and probably acts as a tumour suppressor gene. We report a 22-year-old man affected by cutaneous leiomyomatosis associated with cutis verticis gyrata, disseminated collagenoma and Charcot-Marie-Tooth disease, who was harbouring the novel FH gene mutation c.821C > T, p.Ala274Val.

Absence of fumarate hydratase mutation in a family with cutaneous leiomyosarcoma and renal cancer

A 41-year-old man was diagnosed with a cutaneous leiomyosarcoma on the left shoulder. Family history revealed that his brother had died of a metastatic kidney tumor at young age. Although apparently rare, the familial occurrence of cutaneous leiomyosarcoma with renal cancer has been described in the context of hereditary cutaneous leiomyomatosis and renal cell cancer (HLRCC). This rare genetic syndrome is caused by heterozygous mutations in the fumarate hydratase (FH) gene. Hence, the manifestation of these two rare malignancies within one family was strongly suggestive of a common underlying genetic defect. However, mutation analysis in the FH gene excluded HLRCC in this family. Although the familial occurrence of these rare tumors might be coincidental, it cannot be ruled out that, beside FH, mutations in another as yet unknown gene could give rise to both leiomyosarcoma and kidney cancer.

Single Base Mutation in the Fumarate Hydratase Gene Leading to Segmental Cutaneous Leiomyomatosis

Single Base Mutation in the Fumarate Hydratase Gene Leading to Segmental Cutaneous Leiomyomatosis