Leafroll Disease Research Articles

Elucidating the Subcellular Localization of GLRaV-3 Proteins Encoded by the Unique Gene Block in N. benthamiana Suggests Implications on Plant Host Suppression.

Grapevine leafroll-associated virus 3 (GLRaV-3) is a formidable threat to the stability of the global grape and wine industries. It is the primary etiological agent of grapevine leafroll disease (GLD) and significantly impairs vine health, fruit quality, and yield. GLRaV-3 is a member of the genus Ampelovirus, Closteroviridae family. Viral genes within the 3' proximal unique gene blocks (UGB) remain highly variable and poorly understood. The UGBs of Closteroviridae viruses include diverse open reading frames (ORFs) that have been shown to contribute to viral functions such as the suppression of the host RNA silencing defense response and systemic viral spread. This study investigates the role of GLRaV-3 ORF8, ORF9, and ORF10, which encode the proteins p21, p20A, and p20B, respectively. These genes represent largely unexplored facets of the GLRaV-3 genome. Here, we visualize the subcellular localization of wildtype and mutagenized GLRaV-3 ORFs 8, 9, and 10, transiently expressed in Nicotiana benthamiana. Our results indicate that p21 localizes to the cytosol, p20A associates with microtubules, and p20B is trafficked into the nucleus to carry out the suppression of host RNA silencing. The findings presented herein provide a foundation for future research aimed at the characterization of the functions of these ORFs. In the long run, it would also facilitate the development of innovative strategies to understand GLRaV-3, mitigate its spread, and impacts on grapevines and the global wine industry.

Present Status of Viral Diseases of Grapevine (<i>Vitis Vinifera</i> L.) and their Management Strategies in India

Grapevine is an important fruit crop cultivated in temperate, subtropical and tropical conditions in India. The maximum share in area, production, and productivity of grapes is governed by four states viz. Maharashtra, Karnataka, Tamil Nadu and Andhra Pradesh. The sudden and drastic changes in climatic conditions and the emergence of diseases have made grapevine cultivation more challenging. Fungal and bacterial diseases are the major constraints in the grapevine production. Besides, some viral diseases like Grapevine Leafroll Disease (GLD) and Rupestris Stem Pitting Associated Diseases (RSPD) are reported in Indian vineyards. Although the presence of Grapevine Leafroll-Associated Viruses (GLRaVs) viz., GLRaV-1, GLRaV-3, and GLRaV-4 are known the impact on yield and quality of the grapes is not yet studied. Similarly, the Rupestris Stem Pitting Associated Virus (RSPaV) is known to infect the Indian vineyards of different locations but a complete understanding of their overall impact on vineyards is lacking. Therefore, it is presumed that fewer or no losses occur due to GLD and RSPD diseases. There is a strong need for hours to study the impact of known viruses on physiological and yield contributing parameters. In addition to this, robust, rapid and reliable diagnostic techniques are required for the detection of known and unknown viruses. The presence of new and emerging viruses in the Indian vineyards cannot be overlooked. Further, for the management of the viruses and avoiding their spread, the availability of Disease-Free Quality Planting Material (DFQPM) is a prerequisite. To produce DFQPM, various tissue culture techniques need to be standardized for the elimination of the virus/es from the diseased vines. The Tissue Culture-Raised Quality Planting Material (TCQPM) needs to be further tested for genetic purity (true-to-type) and virus indexing to confirm DFQPM. By considering the importance of DFQPM, recently, the National Horticulture Board (NHB), Govt. of India in association with the Asian Development Bank (ADB) has initiated a National Mission on Clean Plant Programme. The implementation of this initiative is more challenging and expected to open different avenues of research and development in the production of DFQPM for the growers. This is an important and timely beginning of the production of DFQPM.

Influence of mixed and single infection of grapevine leafroll-associated viruses and viral load on berry quality.

Grapevine leafroll disease is a viral disease that affects grapevines (Vitis vinifera L.) and has a severe economic impact on viticulture. In this study, the effect of grapevine leafroll-associated viruses (GLRaV) on berry quality was investigated in clones of cultivar cv. Crimson Seedless table grapes infected with GLRaV. RT-PCR confirmed the identity of the clones: clone 3236, infected only with GLRaV-3 (termed single); clone 3215, infected with GLRaV-3, GLRaV-4 strain 9 and grapevine virus A (termed mixed); and a viral free clone of the same genetic background of the infected clones (termed control). The berry quality indices of size, sugar, acidity and anthocyanin content were measured at harvest maturity. RT-qPCR was used to determine the viral load. The study was repeated over 2year. A two-way, multivariate analysis of variance was applied with clone and year as independent variables and the measured berry quality parameters as a dependent variable. All dependent variables were significantly affected by viral infection (Wilks, λ, (2,33)=0.033895, P-value<0.001), while only titratable acidity was affected by year. The average berry dry mass decreased (P-value<0.001). The water content of both infected clones was greater than that of the control (P-value<0.001). Both infected clones displayed reduced sugar content as a fraction of the berry dry mass (P-value<0.001). The anthocyanin and the phenol content of the infected clones were significantly reduced compared with the control clone (P<0.001, P<0.05, clone 3236 and clone 3215, respectively). Finally, the viral load was highly variable, and no quantitative relationship between viral load and berry composition was found.

The New Zealand perspective of an ecosystem biology response to grapevine leafroll disease.

Grapevine leafroll-associated virus 3 (GLRaV-3) is a major pathogen of grapevines worldwide resulting in grapevine leafroll disease (GLD), reduced fruit yield, berry quality and vineyard profitability. Being graft transmissible, GLRaV-3 is also transmitted between grapevines by multiple hemipteran insects (mealybugs and soft scale insects). Over the past 20 years, New Zealand has developed and utilized integrated pest management (IPM) solutions that have slowly transitioned to an ecosystem-based biological response to GLD. These IPM solutions and combinations are based on a wealth of research within the temperate climates of New Zealand's nation-wide grape production. To provide context, the grapevine viruses present in the national vineyard estate and how these have been identified are described; the most pathogenic and destructive of these is GLRaV-3. We provide an overview of research on GLRaV-3 genotypes and biology within grapevines and describe the progressive development of GLRaV-3/GLD diagnostics based on molecular, serological, visual, and sensor-based technologies. Research on the ecology and control of the mealybugs Pseudococcus calceolariae and P. longispinus, the main insect vectors of GLRaV-3 in New Zealand, is described together with the implications of mealybug biological control agents and prospects to enhance their abundance and/or fitness in the vineyard. Virus transmission by mealybugs is described, with emphasis on understanding the interactions between GLRaV-3, vectors, and plants (grapevines, alternative hosts, or non-hosts of the virus). Disease management through grapevine removal and the economic influence of different removal strategies is detailed. Overall, the review summarizes research by an interdisciplinary team working in close association with the national industry body, New Zealand Winegrowers. Teamwork and communication across the whole industry has enabled implementation of research for the management of GLD.

Identification of a receptor for the sex pheromone of the vine mealybug, Planococcus ficus

The vine mealybug, Planococcus ficus, is a significant pest of vineyards in all major grape growing regions of the world. This pest causes significant aesthetic damage to berry clusters through its feeding behavior and secretion of "honeydew", which leads to significant decreases in crop marketability. More importantly, the vine mealybug is a vector of several grapevine viruses which are the causal agent of grapevine leafroll disease, one of the most destructive and economically devastating diseases of the grape industry worldwide. As there is no cure for grapevine leafroll disease, the only control measures available to reduce its spread are to remove infected vines whilst simultaneously controlling mealybug populations. Using transcriptomic libraries prepared from male and female mealybugs and a draft genome, we identified and evaluated expression levels of members of the odorant receptor gene family. Interestingly, of the 50 odorant receptors identified from these P. ficus genetic resources, only 23 were found to be expressed in females, suggesting this flightless life stage has a decreased reliance on the olfactory system. In contrast, 46 odorant receptors were found to be expressed in the alate male life stage. Heterologous expression of eight of these receptors, along with the obligate co-receptor, Orco, in HEK293 cells allowed for the identification of two receptors that respond to lavandulyl senecioate, the sole constituent of the sex pheromone used by this species. Interestingly, one of these receptors, PficOR8, also responded to the sex pheromone used by the Japanese mealybug, Planococcus kraunhiae. The data presented here represent the first report of odorant receptor gene family expression levels, as well as the identification of the first sex pheromone receptor, in soft-scale insects. The identification of a receptor for the vine mealybug sex pheromone will allow for the development of novel, species-specific pest control tools and monitoring devices.

Genetic Diversity of Grapevine Virus A in Three Australian Vineyards Using Amplicon High Throughput Sequencing (Amplicon-HTS).

Shiraz disease (SD) is one of the most destructive viral diseases of grapevines in Australia and is known to cause significant economic loss to local growers. Grapevine virus A (GVA) was reported to be the key pathogen associated with this disease. This study aimed to better understand the diversity of GVA variants both within and between individual SD and grapevine leafroll disease (LRD) affected grapevines located at vineyards in South Australia. Amplicon high throughput sequencing (Amplicon-HTS) combined with median-joining networks (MJNs) was used to analyze the variability in specific gene regions of GVA variants. Several GVAII variant groups contain samples from both vineyards studied, suggesting that these GVAII variants were from a common origin. Variant groups analyzed by MJNs using the overall data set denote that there may be a possible relationship between variant groups of GVA and the geographical location of the grapevines.

Investigating Protein-Protein Interactions Between Grapevine Leafroll-Associated Virus 3 and Vitis vinifera.

Grapevine leafroll disease (GLD) is a globally important disease that affects the metabolic composition and biomass of grapes, leading to a reduction in grape yield and quality of wine produced. Grapevine leafroll-associated virus 3 (GLRaV-3) is the main causal agent for GLD. This study aimed to identify protein-protein interactions between GLRaV-3 and its host. A yeast two-hybrid (Y2H) library was constructed from Vitis vinifera mRNA and screened against GLRaV-3 open reading frames encoding structural proteins and those potentially involved in systemic spread and silencing of host defense mechanisms. Five interacting protein pairs were identified, three of which were demonstrated in planta. The minor coat protein of GLRaV-3 was shown to interact with 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase 02, a protein involved in primary carbohydrate metabolism and the biosynthesis of aromatic amino acids. Interactions were also identified between GLRaV-3 p20A and an 18.1-kDa class I small heat shock protein, as well as MAP3K epsilon protein kinase 1. Both proteins are involved in the response of plants to various stressors, including pathogen infections. Two additional proteins, chlorophyll a-b binding protein CP26 and a SMAX1-LIKE 6 protein, were identified as interacting with p20A in yeast but these interactions could not be demonstrated in planta. The findings of this study advance our understanding of the functions of GLRaV-3-encoded proteins and how the interaction between these proteins and those of V. vinifera could lead to GLD.

Optimization of a Protocol for Launching Grapevine Infection with the Biologically Active cDNA Clones of a Virus.

Grapevine leafroll disease (GLRD) is the most globally prevalent and destructive disease complex responsible for significant reductions in grape yield and quality as well as wine production. GLRD is associated with several positive-strand RNA viruses of the family Closteroviridae, designated as grapevine leafroll-associated viruses (GLRaVs). However, the specific etiological role of any of these GLRaVs in GLRD has not been demonstrated. Even though GLRaV-3 is considered the chief GLRD agent, little is known about the molecular, cellular, and pathological properties of this virus. Such a knowledge gap is due to multiple factors, including the unavailability of biologically active virus cDNA clones and the lack of reliable experimental systems for launching grapevine infection using such clones. In this work, we tested four methods for inoculating tissue-cultured grapevine plantlets with cDNA clones of GLRaV-3: (i) vacuum agro-infiltration; (ii) agro-pricking; (iii) agro-drenching; and (iv) agro-injection. We showed that vacuum agro-infiltration was the most effective of these methods. Furthermore, we examined the impacts of different experimental conditions on the survival and infectivity rate of grapevines after infiltration. To verify the infectivity rate for different treatments, we used RT-PCR, RT-qPCR, and Western blotting. We found that humidity plays a critical role in the survival of plantlets after agro-infiltration and that the use of RNA silencing suppressor and dormancy treatment both had strong effects on the infection rates. To our knowledge, the experimental protocol reported herein is the most effective system for launching the infection of grapevine using cDNA clones of grapevine viruses featuring up to a 70% infection rate. This system has strong potential to facilitate grapevine virology research including the fulfillment of Koch's postulates for GLRD and other major virus diseases as well as identifying the molecular, cellular, and pathological properties of GLRaVs and, potentially, other important grapevine viruses.

Assessment of Symptoms of Grapevine Leafroll Disease and Relationship with Yield and Quality of Pinot Noir Grape Must in a 10-Year Study Period.

Grapevine leafroll disease (GLD) is caused by one or more of the Grapevine leafroll-associated viruses (GLRaVs). GLD's symptoms are expected to be evident in indicator cultivars, regardless of the GLRaV(s) involved. In the present study, disease incidence (I) and severity (S), symptoms before veraison (Sy < V), a disease severity index (DSI) and an earliness index (EI) (2013-2022) were recorded in order to examine the factors affecting the evolution of GLD in Pinot noir graft inoculated with scions infected with GLRaV-3 that, in origin, showed a diversity of GLD symptoms. Strong correlations between I and S (r = 0.94) and between Sy < V and EI (r = 0.94) were observed; early symptoms proved good predictors of incidence and severity after veraison and of yield and sugar content of the must. The environmental conditions and time after infection did not modify the wide range of symptoms (I: 0-81.5%; S: 0.1-4) that corresponded with the variation in losses (<0-88% for yield and <0-24% for sugar content). With all other factors being constant, the significant differences between plants were mainly due to the GLRaVs present. Plants infected with some GLRaV-3 isolates always had mild symptoms or remained asymptomatic 10 years after grafting but remained a source of infection for GLRaV vectors.

Spatio-Temporal Spread of Grapevine Leafroll Disease in Washington State Vineyards.

The spread of grapevine leafroll disease (GLD) to vineyards planted with certified planting stock is of significant concern to grape growers. In this study, the spatial and temporal spread of GLD was examined in three vineyard blocks planted with virus-tested wine grape (Vitis vinifera) cultivars adjacent to vineyard blocks heavily infected with GLD in two geographic locations in eastern Washington State. During each season, the position of vines showing GLD symptoms was recorded in a matrix representing the planting lattice. Symptomatic vines were positive only for Grapevine leafroll-associated virus 3 (GLRaV-3), the most common virus species consistently associated with GLD in Washington vineyards. The results from multiple seasons showed a gradual increase in disease incidence over time in all three blocks. Spatial and temporal mapping of GLD indicated a disease gradient in which the highest percentage of symptomatic vines was in rows proximal to infected old blocks. Spatial autocorrelation analysis using Moran's I values suggested random patterns of symptomatic vines in the three blocks during initial years, indicating primary spread of the virus not related to infected vines within the block. Clustering at the scale of neighboring vines during subsequent years suggested secondary spread within the block. Results of quadrat-based spatial analyses of GLD incidence were compared with previously reported data obtained from California and elsewhere for an improved understanding of the dynamics of GLD spread to facilitate area-wide disease management strategies.

A Chronological Study on Grapevine Leafroll-Associated Virus 2 in Australia.

Grapevine leafroll disease affects the health status of grapevines worldwide. Most studies in Australia have focused on grapevine leafroll-associated viruses 1 and 3, while little attention has been given to other leafroll virus types, in particular, grapevine leafroll-associated virus 2 (GLRaV-2). A chronological record of the temporal occurrence of GLRaV-2 in Australia since 2001 is reported. From a total of 11,257 samples, 313 tested positive, with an overall incidence of 2.7%. This virus has been detected in 18 grapevine varieties and Vitis rootstocks in different regions of Australia. Most varieties were symptomless on their own roots, while Chardonnay showed a decline in virus-sensitive rootstocks. An isolate of GLRaV-2, on own-rooted Vitis vinifera cv. Grenache, clone SA137, was associated with severe leafroll symptoms after veraison with abnormal leaf necrosis. The metagenomic sequencing results of the virus in two plants of this variety confirmed the presence of GLRaV-2, as well as two inert viruses, grapevine rupestris stem pitting-associated virus (GRSPaV) and grapevine rupestris vein feathering virus (GRVFV). No other leafroll-associated viruses were detected. Among the viroids, hop stunt viroid and grapevine yellow speckle viroid 1 were detected. Of the six phylogenetic groups identified in GLRaV-2, we report the presence of four groups in Australia. Three of these groups were detected in two plants of cv. Grenache, without finding any recombination event. The hypersensitive reaction of certain American hybrid rootstocks to GLRaV-2 is discussed. Due to the association of GLRaV-2 with graft incompatibility and vine decline, the risk from this virus in regions where hybrid Vitis rootstocks are used cannot be overlooked.

A Metagenomic Investigation of the Viruses Associated with Shiraz Disease in Australia.

Shiraz disease (SD) is an economically important virus-associated disease that can significantly reduce yield in sensitive grapevine varieties and has so far only been reported in South Africa and Australia. In this study, RT-PCR and metagenomic high-throughput sequencing was used to study the virome of symptomatic and asymptomatic grapevines within vineyards affected by SD and located in South Australia. Results showed that grapevine virus A (GVA) phylogroup II variants were strongly associated with SD symptoms in Shiraz grapevines that also had mixed infections of viruses including combinations of grapevine leafroll-associated virus 3 (GLRaV-3) and grapevine leafroll-associated virus 4 strains 5, 6 and 9 (GLRaV-4/5, GLRaV-4/6, GLRaV-4/9). GVA phylogroup III variants, on the other hand, were present in both symptomatic and asymptomatic grapevines, suggesting no or decreased virulence of these strains. Similarly, only GVA phylogroup I variants were found in heritage Shiraz grapevines affected by mild leafroll disease, along with GLRaV-1, suggesting this phylogroup may not be associated with SD.

Detecting Grapevine Virus Infections in Red and White Winegrape Canopies Using Proximal Hyperspectral Sensing.

Grapevine virus-associated disease such as grapevine leafroll disease (GLD) affects grapevine health worldwide. Current diagnostic methods are either highly costly (laboratory-based diagnostics) or can be unreliable (visual assessments). Hyperspectral sensing technology is capable of measuring leaf reflectance spectra that can be used for the non-destructive and rapid detection of plant diseases. The present study used proximal hyperspectral sensing to detect virus infection in Pinot Noir (red-berried winegrape cultivar) and Chardonnay (white-berried winegrape cultivar) grapevines. Spectral data were collected throughout the grape growing season at six timepoints per cultivar. Partial least squares-discriminant analysis (PLS-DA) was used to build a predictive model of the presence or absence of GLD. The temporal change of canopy spectral reflectance showed that the harvest timepoint had the best prediction result. Prediction accuracies of 96% and 76% were achieved for Pinot Noir and Chardonnay, respectively. Our results provide valuable information on the optimal time for GLD detection. This hyperspectral method can also be deployed on mobile platforms including ground-based vehicles and unmanned aerial vehicles (UAV) for large-scale disease surveillance in vineyards.

ON MATHEMATICAL MODELING OF THE TRANSMISSION OF GRAPEVINE LEAFROLL-ASSOCIATED VIRUS 3 BY THE VINE MEALYBUG, PLANOCOCCUS FICUS

Grapevine leafroll disease (GLD) is the most common and economically destructive grapevine viral disease in South African vineyards and throughout the world. There are many GLD-associated virus variants with Grapevine leafroll-associated virus 3 (GLRaV-3) being the main causative agent of GLD. The vine mealybug, Planococcus ficus, is the most widespread and problematic vector of GLRaV-3. Roguing, pesticides and sanitary measures are common control strategies used in South African vineyards. In this paper, we propose an age-structured mathematical model for the transmission of (GLRaV-3) by Planococcus ficus in the South African context. The model is investigated in terms of the transmission thresholds and control strategies. A simplified model is used to shed light into the qualitative dynamics of transmission and assess the effectiveness of roguing as the main control strategy for GLRaV-3 spread.

A Novel and Highly Inclusive Quantitative Real-Time RT-PCR Method for the Broad and Efficient Detection of Grapevine Leafroll-Associated Virus 1.

Grapevine (Vitis vinifera L.) is one of the most important crops in the world due to its economic and social impact. Like many other crops, grapevine is susceptible to different types of diseases caused by pathogenic microorganisms. Grapevine leafroll-associated virus 1 (GLRaV-1) is a virus associated with grapevine leafroll disease and it is considered at the national and European level as a pathogen that must be absent in propagative plant material. For this reason, the availability of specific, sensitive and reliable detection techniques to ascertain the sanitary status of the plants is of great importance. The objective of this research was the development of a new GLRaV-1 detection method based on a TaqMan quantitative real-time RT-PCR targeted to the coat protein genomic region and including a host internal control in a duplex reaction. To this end, three new GLRaV-1 full genomes were recovered by HTS and aligned with all sequences available in the databases. The method has been validated following EPPO standards and applied for the diagnosis of field plant material and transmission vectors. The new protocol designed has turned out to be highly sensitive as well as much more specific than the current available methods for the detection and absolute quantitation of GLRaV-1 viral titer.

Occurrence of grapevine-associated tymo-like virus in wine grapes in the United States.

Grapevine-associated tymo-like virus (GaTLV) was reported to infect several grapevine cultivars in France (Hily et al. 2018). Recently, GaTLV-specific reads were identified among high-throughput sequencing (HTS) outputs from a pooled sample of grapevines in Tennessee, but the virus presence in individual plants was not confirmed by the RT-PCR testing with specific primers (Hu et al. 2021). In Idaho, several viruses infect wine grapes, such as grapevine leafroll-associated virus 3 (GLRaV-3; Mekuria et al. 2009; Thompson et al. 2019a), grapevine fleck virus (Kanuya et al. 2012), grapevine red blotch virus (Thompson et al. 2019b), and grapevine rupestris vein feathering virus (Dahan et al. 2021), while GaTLV status was not tested for previously. In September 2020 leaf and petiole samples of six different cultivars were collected from six vineyards in Canyon and Nez Perce counties of Idaho, for a total of 16 samples. Most of the samples were selected based on symptoms of vine decline, grapevine leafroll disease (GLD), or other abnormalities. Ribodepleted total RNAs prepared from these samples as described previously (Thompson et al. 2019a) were subjected to a HTS analysis on a NovaSeq platform, producing between 15,095,042 and 31,500,611 250-bp paired-end reads per sample. Raw reads were adapter and quality cleaned and mapped against the Vitis vinifera L., reference genome. Unmapped paired-end reads were assembled, and contigs were analyzed using BLASTn and DIAMOND (Buchfink et al. 2021) programs. Three of the samples, two collected from own-rooted Chardonnay vines planted in 1981, and one from an own-rooted, 20-yr old Cabernet franc vine, yielded large, 6,005 to 6,024-nt contigs exhibiting 99.0% identity to the sequence of the GaTLV (MH383239) described in France (Hily et al. 2018). Conceivably, these 6,005 to 6,024-nt sequences represented nearly complete genomes of the Idaho isolates of GaTLV; they were designated GaTLV-ID1 to -ID3 and deposited in the GenBank database under the accession numbers ON853767-ON853769. Two specific primer pairs, GaT1_2009F (5'-GGCTGAGTTAAAGGACGAGAA-3') and GaT1_2648R (5'-CGCCACGCCAAGCCAATAATGCT - 3'), and GaT2_5499F (5' - GCCAGAGTTTTCGGAGGCAAA - 3') and GaT2_5905R (5'-CGCGGAAAAACAATTCAGCAA-3') amplifying 662-bp and 427-bp products, respectively, were used to test for GaTLV presence in these 2020 samples, and also in additional 18 samples collected in September 2021 from nine grapevine cultivars in three vineyards of Canyon County, Idaho. Twelve GaTLV-positive samples, out of the 34 total, were identified in five out of the seven tested vineyards located in Canyon and Nez Perce counties of Idaho (Supplementary Fig. S1), in Chardonnay (nine positives), Gewürztraminer (one positive), Cabernet franc (one positive), and an unknown cultivar (one positive). The two RT-PCR products were Sanger sequenced for ten GaTLV-positives and displayed 100% identity to the HTS-derived GaTLV-ID genomic sequences at the targeted regions. The exact role of GaTLV in the development of the symptoms of decline in Chardonnay or in GLD symptoms in Cabernet franc vines is not clear at the moment. These same Chardonnay and Gewürztraminer samples contained other GLD-associated viruses, such as GLRaV-3 (Dahan et al. 2021), while the GaTLV-positive Cabernet franc had only common viroids, hop stunt viroid and grapevine yellow speckle viroid 1, not normally associated with GLD symptoms in wine grapes (Di Serio et al. 2017). To the best of our knowledge, this is the first report of GaTLV in Idaho, and, given the lack of RT-PCR amplifications of GaTLV sequences reported by Hu et al. (2021), also the first confirmed report of GaTLV presence in wine grapes in the United States.

Detection and molecular identification of a 16SrI group phytoplasma associated with sisal purple leafroll disease

Sisal purple leafroll disease (SPLD) is a destructive disease affecting sisal in China, however, its etiology remains unknown. This disease is characterized by purple margins and rolling and yellowing of the leaves. Recently, phytoplasma was found to be present in SPLD-affected sisal according to PCR assay. To further verify the presence of phytoplasma, determine its association with SPLD and identify the possible pathogenic phytoplasma infecting sisal, 80 symptomatic and 65 asymptomatic sisal samples were collected from the main sisal farms in three Chinese provinces, including Hainan, Guangdong and Guangxi provinces, from 2018 to 2021. PCR assays and transmission electron microscopy further revealed the presence of phytoplasma. Nested PCR using the universal primer R16mF2/R16mR1 followed by R16F2n/R16R2 was confirmed as the most effective molecular method for the detection of phytoplasma in sisal. A comparison of the detection rate of phytoplasma in symptomatic (83%) versus asymptomatic (17%) sisal populations showed some association between phytoplasma and SPLD. Sequencing analyses, phylogenetic analyses, and virtual restriction fragment length polymorphism analyses confirmed the presence of phytoplasma in sisal belonging to 16SrI-B. This is the first report of 16SrI-B phytoplasma infecting sisal in China.

A Survey of Grapevine Leafroll-Associated Virus 1 and 3 in the South of Ukraine and Development of Primers for GLRaV-3 Identification

Viticulture is one of the most intensive and complex branches of Ukraine agriculture. Grapevine virus diseases are responsible for considerable economic losses to grape productivity and wine industries. One of the most notable and widespread viruses associated with vine leafroll disease is grapevine leafroll-associated viruses (GLRaV), belonging to the genus Ampelovirus, family Closteroviridae. Thus, the aim of this study was to conduct a survey targeting two viruses involved in the grapevine leafroll, namely grapevine leafroll-associated virus 1 (GLRaV-1) and virus 3(GLRaV-3) distributed in commercial wine grapes growing in the vineyards of the Ovidiopol and Bolhrad districts of the Odesa region. For efficient and accurate virus detection, we aimed to design universal primers based on conserved nucleotide sequences. Methods. Virus surveys of vineyards, visual diagnosis, immunoassay (ELISA), polymerase chain reaction with reverse transcription (RT-PCR), and Sanger sequencing of partial genome sequences of GLRaV. Results. The results obtained indicate that grapevine leafroll disease symptoms in field-grown grapevines in the south of Ukraine are caused by GLRaV-3. GLRaV-1 was not detected in any of the samples tested. To confirm the presence of GLRaV-3 in the samples, specific primers were designed targeting the coat protein region (GLRaV3-7f 5’-AGTAGGGGATGCAGCACAAG-3’; GLRaV3-7r 5’-ATCCAAAGCTATTCCCTTGC-3’) of the virus. A new set of primers (GLRaV3-7f / GLRaV3-7r) has been validated for sensitive detection of GLRaV-3 by RT-PCR and may be useful for routine virus detection in the laboratory as well as for large-scale testing. The partial coat protein gene of the isolate, GLRaV-3 ukr, distributed in the south of Ukraine, was sequenced, and the obtained sequence was deposited in GenBank under Acc. No. ON015835. The phylogenetic study demonstrated that GLRaV-3 ukr was closely related to isolates from Russia (MZ065372 and MZ065370).

Development of a Specific Nested PCR Assay for the Detection of 16SrI Group Phytoplasmas Associated with Sisal Purple Leafroll Disease in Sisal Plants and Mealybugs.

Sisal purple leafroll disease (SPLD) is currently the most destructive disease affecting sisal in China, yet its aetiology remains unclear. In our previous research, it was verified to be associated with phytoplasmas, and nested PCR based on the 16S rRNA gene using universal primers R16mF2/R16mR1 followed by R16F2n/R16R2 was confirmed as the most effective molecular method for the detection of phytoplasmas associated with SPLD (SPLDaP). However, the method has a shortcoming of inaccuracy, for it could produce false positive results. To further manage the disease, accurate detection is needed. In this study, we developed a specific nested PCR assay using universal primers R16F2n/R16R2, followed by a set of primers designed on 16Sr gene sequences amplified from SPLDaP, nontarget bacteria from sisal plants, and other phytoplasma subgroups or groups. This established method is accurate, specific, and effective for detection of 16SrI group phytoplasma in sisal, and its sensitivity is up to 10 fg/μL of total DNA. It also minimized the false positive problem of nested PCR using universal primers R16mF2/R16mR1 followed by R16F2n/R16R2. This method was further used to verify the presence of phytoplasma in Dysmicoccusneobrevipes, and the results showed that D. neobrevipes could be infected by SPLDaP and thus could be a candidate for vector transmission assays.

Adoption of Best Management Practices for Grapevine Leafroll and Red Blotch Diseases: A Survey of West Coast Growers

Grapevine leafroll disease (GLD) and red blotch disease (RBD) threaten the sustainability of the U.S. wine grape industry. To understand the factors influencing the adoption of disease management practices, we surveyed wine grape industry professionals in California, Oregon, and Washington ( n = 154). Economic factors were the fundamental cost of implementing management practices and the ability to sell products from diseased vines (salability). Respondents who encountered reduced salability were more likely to adopt virus testing, replace infected vines, and view these practices as economically favorable. Salability was a strong driver for adoption among Californian respondents but less so in Washington, where wineries appeared more willing to accept infected products. Respondents who had acquired technical knowledge of disease ecology were more likely to adopt management practices and to perceive them as economical. Conversely, when there was a lack of knowledge of GLD ecology, notably that mealybugs transmit the pathogen, adoption was reduced, and practices were considered less economical. Factors affecting adoption were broadly generalizable across diseases. However, knowledge of GLD ecology was more strongly associated with adoption, likely reflecting the remaining knowledge gaps in RBD related to vector ecology and field spread. An emphasis on grower knowledge acquisition and the development of economical disease management practices can improve adoption of best management practices for viral diseases of grapevine. [Formula: see text] Copyright © 2022 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license .