Leaf Blotch Symptoms Research Articles

The species, density, and intra-plant distribution of mites on red raspberry (Rubus idaeus L.).

The adoption of the European Green Deal will limit acaricide use in high value crops like raspberry, to be replaced by biological control and other alternative strategies. More basic knowledge on mites in such crops is then necessary, like species, density, and their role as vectors of plant diseases. This study had four aims, focusing on raspberry leaves at northern altitude: (1) identify mite species; (2) study mite population densities; (3) investigate mite intra-plant distribution; (4) investigate co-occurrence of phytophagous mites, raspberry leaf blotch disorder and raspberry leaf blotch virus (RLBV). Four sites in south-eastern Norway were sampled five times. Floricanes from different parts of the sites were collected, taking one leaf from each of the upper, middle, and bottom zones of the cane. Mites were extracted with a washing technique and processed for species identification and RLBV detection. Mites and leaves were tested for RLBV by reverse transcription polymerase chain reaction (RT-PCR) with virus-specific primers. Phytophagous mites, Phyllocoptes gracilis, Tetranychus urticae, and Neotetranychus rubi, and predatory mites, Anystis baccarum and Typhlodromus (Typhlodromus) pyri were identified. All phytophagous mites in cultivated raspberry preferred the upper zone of floricanes, while in non-cultivated raspberry, they preferred the middle zone. The presence of phytophagous mites did not lead to raspberry leaf blotch disorder during this study. RLBV was detected in 1.3% of the sampled plants, none of them with leaf blotch symptoms, and in 4.3% of P. gracilis samples, and in some spider mite samples, implying that Tetranychids could also be vectors of RLBV.

First report of Zymoseptoria tritici causing Septoria tritici blotch in wheat in Paraguay.

Wheat (Triticum aestivum) is the third most cultivated field crop in Paraguay; it is grown on over 450,000 hectares with an annual production of 927,776 tons (fao.org/faostat). In 1952, Septoria tritici blotch (STB) was associated with the fungus Septoria tritici solely based on microscopic observation of conidia (Viedma and Delgado 1987). However, no morphometric or molecular studies have been performed in Paraguay up to date. Over the following decades, STB epidemic outbreaks were recorded, with a reduction in wheat production of up to 70% (Viedma and Delgado 1987). During winter 2021, leaf blotch symptoms were observed with an incidence above 50% in wheat fields in Capitán Miranda, Itapúa, Paraguay. Scattered, spherical, buried, and light brown necrotic spots with dark edges were observed on the leaves. Pycnidia with prominent central ostiole were observed. Leaves with symptoms were washed with 1% sodium hypochlorite for 1 min, rinsed with sterile distilled water, and incubated in wet chambers to induce sporulation of the fungus. Pycnidia produced greyish to white cirri. Isolated conidia were thin, elongated, and hyaline, ranging from 26.9-72.7 × 1.5-2.9 μm with one to three septa. Monosporic colonies on potato dextrose agar (PDA, ; Difco laboratories, Detroit, MI) media varied in color from white to pink, dark gray to black, or black with stroma-like structures. Based on morphology, the fungus was characterized as Zymoseptoria tritici (Hoorne et al. 2002; Gilchrist-Saavedra et al. 2005). Fungal DNA was extracted from mycelia, and the internal transcribed spacer (ITS), translation elongation factor 1-α (TEF1-α), 28S rRNA gene (LSU), actin gene (act), calmodulin (CaM) were amplified using ITS1/ITS4, EF1-728F/EF-2, LSU1Fd/ LR5, ACT-512F/ACT-783R, CAL-228F/CAL737R primers, respectively. PCR amplicons were sequenced at Macrogen (Seoul, Republic of Korea) and deposited in the NCBI GenBank database (ITS: OQ360718; TEF1-α: OQ999044, LSU: OQ996413, act: OQ999046, CaM: OQ999045). Sequences were aligned with several isolates of Septoria spp. previously reported (Verkley et al. 2013; Stukenbrock et al. 2012) using ClustalW. The alignments were concatenated with Bioedit (Hall 1999). The UPGMA method with 1,000 bootstrap replications, was used to construct the phylogenetic tree using MEGA11 with Readeriella mirabilis as the outgroup. The isolate from Paraguay grouped into the Zymoseptoria tritici clade with 96% bootstrap support. To confirm pathogenicity, ten wheat plants cv. Itapúa 80 were grown in pots for three weeks in growth chambers (22 ± 2°C; 16 h photoperiod). Subsequently, these plants were inoculated with 1×107 conidia ml-1 suspension, and ten non-inoculated plants served as control. Seven days after inoculation (DAI), symptoms were observed displaying oval necrotic lesions and approximately 14 DAI abundant pycnidia were observed on and around the lesions. Segments of symptomatic leaves were placed in moisture chambers overnight to enhance cirri development. Conidia were mounted on a slide and observed under the compound microscope. Individual cirrhus were transferred to plates containing PDA and produced colonies like those used in the inoculation (Hoorne et al. 2002). We confirmed that the causal agent of STB from wheat fields in Paraguay was Zymoseptoria tritici. This pathogen causes annual wheat disease epidemics in Paraguay; therefore, optimizing surveillance for early detection and understanding its distribution will improve integrated management.

First Report of Leaf Blotch Caused by Phyllosticta capitalensis on Daphne odora in China.

Daphne odora Thunb. an evergreen shrub with scented flowers, is used for ornamental purposes but it also has medicinal benefits (Otsuki, et al. 2020). In August 2021, leaf blotch symptoms were observed on roughly 20% of leaves of D. odora var. marginata plants in Fenghuangzhou Citizen Park, Nanchang city (28°41'48.12″ N, 115°52'40.47″ E), Jiangxi Province, China. Brown lesions first appeared on the edges of leaves, which eventually dried and died (Fig. 1A). For fungal isolation, 12 symptomatic leaves were randomly collected, the edges between diseased area and healthy area were cut into small pieces (4×4 mm), surface-sterilized by dipping in 70% ethanol for 10 s and 1% sodium hypochlorite for 30 s, and then rinsed three times with sterile distilled water. Leaf pieces were then plated on potato dextrose agar (PDA) and incubated at 28 ℃ for 3-4 days. A total of 10 isolates were recovered from the diseased leaves. The pure colonies of all fungal isolates had similar characteristics, and three isolates were randomly selected (JFRL 03-249, JFRL 03-250 and JFRL 03-251) for further study. Colonies of this fungus were gray and uneven, with a granular surface, and irregular white edges, finally turning black on PDA (Fig. 1B, C). Pycnidia were black, globose and 54-222 μm in diameter (Fig. 1D). Conidia were hyaline, single-celled, and nearly elliptical, which ranged from 7 to 13 × 5 to 7 μm (n=40) (Fig. 1E). These morphological characteristics were consistent with those described for the fungus Phyllosticta spp. (Wikee et al. 2013a). To confirm the fungal identity, the internal transcribed spacer (ITS) region, actin (ACT), translation elongation factor 1-alpha (TEF1-a), glyceradehyde-3-phosphate dehydrogenase (GPD) and RNA polymerase II second largest subunit (RPB2) genes were amplified using primers ITS5/ITS4, ACT-512F/ACT-783R, EF-728F/EF2, Gpd1-LM/Gpd2-LM and RPB2-5F2 /fRPB2-7cR, respectively (Wikee et al. 2013b). The sequences of the selected isolates were 100% identical. Hence, sequences of one representative isolate JFRL 03-250 were deposited in GenBank (OP854673, ITS; OP867004, ACT; OP867007, TEF1-a; OP867010, GPD; and OQ559562, RPB2). BLAST search analysis in GenBank showed 100% similarity with those of P. capitalensis (GenBank accession nos. ITS, MH183391; ACT, KY855662; TEF1-a, KM816635; GPD, OM640050 and RPB2, KY855820). From a phylogenetic perspective, a maximum likelihood phylogenetic tree was constructed by using IQtree V1.5.6 based on multiple sequences (ITS, ACT, TEF1-a, GPD and RPB2) (Nguyen et al. 2015), and the cluster analysis resulted the representative isolate JFRL 03-250 within a clade comprising Phyllosticta capitalensis (Fig. 2). Based on morphological and molecular characters, the isolate was identified as P. capitalensis. To confirm pathogenicity and fulfill Koch's postulates, 6 healthy potted plants were inoculated with 1× 106 conidia/ml suspension of isolate JFRL 03-250 by spraying on the leaves, whereas 6 plants were sprayed with sterile distilled water to serve as control. All potted plants were incubated at 28°C, 80% relative humidity and 12-h light/12-h dark alternating conditions in a climate cabinet. After 15 days, similar symptoms were observed in the inoculated leaves as in the field (Fig. 1F), whereas control leaves remained asymptomatic (Fig. 1G) and P. capitalensis was successfully re-isolated from the symptomatic leaves. Previously, P. capitalensis has been reported to cause brown leaf spot disease of various host plants around the world (Wikee et al. 2013b). However, to our knowledge, this is the first report of brown leaf spot caused by P. capitalensis on D. odora in China.

Adaptation of pathogens to their local plant host, Silphium integrifolium, along a precipitation gradient

AbstractEmpirical evidence of the influence of climate on plant–pathogen coevolution is limited but crucial to understand, as anthropogenic pressures including fragmentation and climate change threaten biodiversity. In this study, we tested patterns of plant–pathogen coevolution using Silphium integrifolium Michx., a native tallgrass prairie species that is undergoing domestication, and its foliar pathogens. We collected seeds from four native prairie remnants from each of three regions along an east–west precipitation gradient in central North America and used these to create three common gardens in each region. In common gardens and remnant prairie populations, we measured symptoms of foliar disease (leaf rust and leaf blotch, both caused by fungal pathogens, and Silphium clear vein (SCV), which we have evidence is associated with a virus). While we did not observe greater disease in the East common garden, we did find that on average the East populations had greater resistance to disease than West populations, consistent with an evolutionary legacy of more rapid coevolution with high precipitation. We also found strong interactions between source region and region of planting for all diseases. The Silphium rust, caused by the specialist pathogen Puccinia silphii, was better able to infect plant populations from the same region. These patterns are consistent with local adaptation of specialist pathogens to their local hosts as expected from Red Queen dynamics. For the generalist fungal pathogen driving leaf blotch, we did not observe evidence of local adaptation. However, we observed a positive correlation in the average level of leaf blotch symptoms observed in individual populations in common gardens with the levels of disease in the S. integrifolium individuals in the prairie remnants of origin, consistent with S. integrifolium genetics determining symptoms in the field. Our results are consistent with pathogen ecology being a major driver of coevolutionary dynamics along productivity gradients. As S. integrifolium is being domesticated for oilseed production, our results identify distinct targets for resistance alleles in breeding efforts and can guide pathogen management strategies.

Population density of eriophyid mites (Acari: Eriophyidae) on raspberry (Rubus idaeus) and their association with leaf blotch symptoms

Red raspberry, Rubus idaeus, is known to be infested by at least six species of eriophyid mites. Among them, the raspberry leaf and bud mite, Phyllocoptes gracilis, (Figure 1, A–B) is the only known vector of a raspberry virus, namely the raspberry leaf blotch virus (RLBV) (Dong et al. 2016; McGavin et al. 2012; Tan et al. 2022). Raspberry leaf blotch (Figure 1, C), a leaf disorder displaying as leaf chlorosis, distortion and patchy necrosis, yellowing and thinning on lateral branches, has been attributed to the feeding of P. gracilis until RLBV was also found to be associated with these symptoms (McGavin et al. 2012). Previous sampling of eriophyid mites was often based on the presence of the leaf blotch symptom, and there is a reasonable doubt if the symptom was caused by RLBV infection or mite infestation. It could also be hypothesized that eriophyid mites are attracted to RLBV-infected plants as viruses could make host plants more attractive to vectors (Donnelly & Gilligan 2020; Shi et al. 2019). It is therefore important to improve the detection of both mites and RLBV to efficiently manage the virus. In addition, knowledge on the dominant infestation area of eriophyid mites on raspberry canes is essential to develop an effective pest management approach. Gordon and Taylor (1976) reported that P. gracilis on primocanes during late summer (mid-August) was dominantly found on the upper leaves, due to the presence of predatory mites on the lower and middle leaves. But mite behavior on floricanes is also important to study if the goal is to prevent mite migration and RLBV transmission to primocanes. This study aimed to investigate the population density of eriophyid mites on raspberry floricanes and the association of eriophyid mites, RLBV, and leaf blotch symptoms.

Protective Effects of Systiva® Seed Treatment Fungicide for the Control of Winter Wheat Foliar Diseases Caused at Early Stages Due to Climate Change

Foliar fungal diseases are a serious threat to winter wheat production and climate change appears to favor pathogens associated with leaf blotch and tan spot symptoms in the Mediterranean area. The present work aimed to highlight these risks and propose appropriate disease management strategies by evaluating the seed treatment with the Systiva® (BASF) fungicide as a means to protect the crop against foliar fungal infections during the early growing stages. Towards that aim, plant tissue symptoms affected by the pathogens Pyrenophora tritici-repentis and Septoria spp. were systematically recorded in a study field in the region of Larissa, central Greece for three years (2016–2018), and the findings were associated with the monthly weather anomalies. Consequently, for the growing period of 2021–2022, a field experiment was established in the same disease prone field, comparing different doses of the seed treatment with Systiva® fungicide against leaf blotch and tan spot diseases. The evaluation was made by visual disease assessments, remote sensing with an unmanned aerial vehicle (UAV) and metagenomics analysis. Parallel measurements on straw residues were also made to characterize the plant residues perithecia (pseudothecia). Visual leaf disease assessments and UAV remote sensing data showed that Systiva® treatments at doses of 125 cc and 150 cc per 100 kg of wheat seed can reduce the percentage of infected wheat plants caused by foliar fungal pathogens at wheat growth stages GS23-25 and GS30-31. Moreover, the metagenomics analyses performed on the microbial communities revealed that Systiva® can decrease the degree of infection by P. tritici-repentis and Z. tritici but do not provide sufficient protection against P. nodorum. Foliar diseases were influenced by the soil surface area covered with straw residue with a high proportion of natural inoculum (pseudothecia/ascospores).

Pseudodidymella fagi in Slovenia: First Report and Expansion of Host Range

The fungus Pseudodidymella fagi is spreading in Europe and causing leaf blotch of European beech, Fagus sylvatica. Between 2008 and 2017, outbreaks of P. fagi were observed on European beech in Switzerland, Germany (also on F. orientalis), Austria, and Slovakia. In Slovenia, leaf blotch symptoms were first observed on F. sylvatica in 2018. P. fagi was identified as the causal agent of the observed symptoms in Slovenia by morphological examinations together with sequencing of the internal transcribed spacer (ITS) region of the rDNA. This study links the fungus to the expansion of the known distribution of the disease to Slovenia, and based on in vitro pathogenicity trials, also to a new potential host, Quercus petraea. The pathogenicity tests confirmed F. sylvatica and F. orientalis as hosts for P. fagi, but not Castanea sativa, where pathogenicity to F. orientalis was proved for first time in vitro. Although Koch’s postulates could not be proven for C. sativa, it seems to be partially susceptible in vitro because some of the inoculation points developed lesions. Additionally, damage to Carpinus betulus related to P. fagi near heavily infected beech trees was observed in vivo but was not tested in laboratory trials. Based on the results and our observations in the field, it is likely that P. fagi has a wider host range than previously thought and that we might be witnessing host switching.

The effects of various plant protection methods on the development of Zymoseptoria tritici and Cephalosporium gramineum, grain yield and protein profile

ABSTRACTSeptoria leaf blotch progresses rapidly, leading to the development of Zymoseptoria titici forms resistant to fungicides. Cephalosporium stripe is caused by Cephalosporium gramineum. The aim of this study was to evaluate the effectiveness of selected pesticides in limiting the symptoms of both diseases on winter wheat leaves, and to determine their influence on grain yield and the content and composition of protein fractions in wheat kernels. Propiconazoles were most effective in inhibiting the development of Septoria leaf blotch (symptoms were reduced from 54.7% to 78.6%). Strobilurins were less effective due to the presence of isolates with the G143A mutation. Symptoms of Cephalosporium stripe were rarely observed, and protective treatments did not reduce their severity. The highest content of grain protein (14.81%) was found in plants most intensely protected with the fungicides containing fenpropimorph, pyraclostrobin and epoxiconazole. The principal component analysis revealed that the plant protection method influenced the grain protein profile. The accumulation of HMW glutenins and α/β gliadins was mutually interrelated and higher in high-input treatments; control grain was characterized by close relationships between ω-gliadins, LMW glutenins, albumins and globulins, whereas low-input treatments influenced mostly γ-gliadins.

First Report of Alternaria arborescens Species Complex Causing Leaf Blotch and Associated Premature Leaf Drop of ‘Golden Delicious’ Apple Trees in the Netherlands

Apple (Malus domestica) is an important fruit crop in the Netherlands, with a total production area of 7,600 ha in 2016, and 1,600 ha of fruit tree nurseries. For decades, fruit growers and nurseries have reported a leaf blotch, characterized by irregular light brown spots, bordered by a dark brown to purple margin, and premature leaf drop, mainly on ‘Golden Delicious’. The disease causes severe, sometimes almost complete defoliation. Leaf blotch typically appears in early July and is most severe in the latter part of the growing season. In a survey in August 2014, affected ‘Golden Delicious’ leaves were collected from different orchards and taken to the laboratory. Next, 20 leaves per location were rinsed with sterile water, sprayed with 70% ethanol until droplet runoff and rinsed again with sterile water, and tissue sections were excised from lesions using a sterile scalpel and placed onto potato dextrose agar (PDA). The PDA plates were incubated at 20°C in the dark, and single spore isolates were transferred to fresh PDA plates. These isolates produced fast-growing colonies of irregular shape, tan brown to black and felty. Sporulation patterns showed long conidiophores with extensive terminal branching. Conidia were ovoid with a tapering apical beak and a size range of 10 to 30 × 5 to 10 μm, with 1 to 5 septa. The isolated fungi were morphologically identical to small spored Alternaria spp. (Simmons 2007). However, small spored Alternaria spp. cannot be identified based on morphological characteristics (Woudenberg et al. 2015). The identity of 12 representative isolates from two different orchards in their 4th growing season, located in the central part of the Netherlands, was determined by multilocus gene sequencing. To this end, genomic DNA was extracted using the UltraClean Microbial DNA isolation kit (MoBio Laboratories, Carlsbad, CA). Sequences of the ITS region, the endoPG gene, and the anonymous region OPA10-2 locus were amplified and sequenced as described in Woudenberg et al. (2013, 2015) and deposited under GenBank accession numbers MG744449–MG744460 (ITS), MG744473–MG744484 (endoPG), and MG744461–MG744472 (OPA10-2). MegaBLAST analysis revealed that our ITS, endoPG, and OPA10-2 sequences matched with >99 to 100% identity to Alternaria arborescens species complex (SC) isolates in GenBank (AF347033 and KP124400 [ITS], AY295028 and KP124104 [endoPG], and KP124712 and KP124714 [OPA10-2]). Subsequently, Koch’s postulates for three A. arborescens SC isolates were performed in the laboratory on ‘Golden Delicious’ leaves. Surface sterilized leaves were inoculated on the abaxial side with 10 μl of a suspension of 10⁵ conidiospores ml–¹ water, prepared from a 14-day-old PDA culture, after wounding with a needle, with four inoculations per leaf. Inoculated leaves were sealed in a plastic box and incubated in darkness at 20°C. The experiment was carried out in five replicates. Symptoms appeared within 7 days on 100% of the leaves, while mock-inoculated controls with water remained symptomless. Fungal colonies isolated from the lesions cultured on PDA morphologically resembled the original isolate from the infected leaves. The identity of the reisolations was confirmed as A. arborescens SC by sequencing. To our knowledge, this is the first report of A. arborescens SC causing leaf blotch and subsequent premature leaf drop of apple cultivars in the Netherlands. Multiple Alternaria species groups are associated with leaf blotch diseases of apple in Australia and Italy (Harteveld et al. 2012; Rotondo et al. 2012). A. arborescens-like isolates are most prevalent in Australia and are mostly associated with leaf blotch symptoms (Harteveld et al. 2012).

Identification and characterization of privet leaf blotch-associated virus, a novel idaeovirus.

A novel virus has been identified by next-generation sequencing (NGS) in privet (Ligustrum japonicum L.) affected by a graft-transmissible disease characterized by leaf blotch symptoms resembling infectious variegation, a virus-like privet disease with an unclear aetiology. This virus, which has been tentatively named 'privet leaf blotch-associated virus' (PrLBaV), was absent in non-symptomatic privet plants, as revealed by NGS and reverse transcription-polymerase chain reaction (RT-PCR). Molecular characterization of PrLBaV showed that it has a segmented genome composed of two positive single-stranded RNAs, one of which (RNA1) is monocistronic and codes for the viral replicase, whereas the other (RNA2) contains two open reading frames (ORFs), ORF2a and ORF2b, coding for the putative movement (p38) and coat (p30) proteins, respectively. ORF2b is very probably expressed through a subgenomic RNA starting with six nucleotides (AUAUCU) that closely resemble those found in the 5'-terminal end of genomic RNA1 and RNA2 (AUAUUU and AUAUAU, respectively). The molecular signatures identified in the PrLBaV RNAs and proteins resemble those of Raspberry bushy dwarf virus (RBDV), currently the only member of the genus Idaeovirus. These data, together with phylogenetic analyses, are consistent with the proposal of considering PrLBaV as a representative of the second species in the genus Idaeovirus. Transient expression of a recombinant PrLBaV p38 fused to green fluorescent protein in leaves of Nicotiana benthamiana, coupled with confocal laser scanning microscopy assays, showed that it localizes at cell plasmodesmata, strongly supporting its involvement in viral movement/trafficking and providing the first functional characterization of an idaeovirus encoded protein.

First Report of Leaf Blotch Caused by Pestalotiopsis clavispora on Rosa chinensis in China.

Rosa chinensis Jacq, a traditional Chinese ornamental flower, is an important landscaping plant in northern China. Since July 2013, leaf blotch symptoms were observed in the Tianjin flower nursery (117°09' E 39°17' N). The garden exhibited 40% disease incidence with observable symptoms on basal leaves that were yellowed from the edge to the inside area on infected leaves, in the shape of a V. Yellow lesions covered one third to one half of the leaf. Yellow halos were observed at the junction of the healthy and diseased tissues. Small tissue pieces from the edges of lesions were disinfected in 70% ethyl alcohol for 30 s and 1% hypochlorite for 1 min, rinsed thrice in sterile water, plated on potato dextrose agar (PDA), and incubated at 25°C in lighted incubator for 4 days. Fungal colonies that developed on PDA were white and cottony with concentric rings. Black and globular acervuli appeared after 10 days at 25°C. Conidia (n = 20), which were fusiform, were 9.20 to 31.31 (avg. 26.5) × 4.83 to 9.11 (avg. 6.9) μm. Conidia of all isolates were five celled. Apical and basal cells were colorless, while the three median cells were dark brown. The single basal appendage of conidia was 2.85 to 16.05 μm in length and the two to three apical appendages were 5.93 to 36.23 μm in length. According to colony and conidia morphology (number of cells, number of appendages), the isolates were initially identified as Pestalotiopsis spp (2). A 525-bp band was produced in a conventional PCR assay. Primers ITS1 (5'TCCGTAGGTGAACCTGCGC3') and ITS4 (5'TCCTCCGCTTATTGATATGC3') were used to amplify and sequence the internal transcribed spacer region of rDNA. A BLAST search of the NCBI databases showed that isolate YJYK-1 had 99% homology with Pestalotiopsis clavispora isolate hz-067 (Accession No. FJ517545.1). Pathogenicity tests of the novel isolate YJYK-1 were conducted by placing agar plugs (5 mm in diameter) from an actively growing colony on PDA on surface-disinfected (70% ethyl alcohol, 30 s) leaves (1). Control leaves were inoculated with sterile PDA plugs. Plants with inoculated leaves (five per treatment) were placed in lighted growth chambers at 25°C for 10 days and watered as needed. Symptoms on inoculated leaves were similar to those previously described in the nursery. Black acervuli were easily found on the necrotic tissues. Control plants did not show any symptoms. Cultures isolated from the lesions were similar to those isolated previously from leaves in the nursery. Koch's postulates were confirmed after re-isolation. Although the diversity of endophytic Pestalotiopsis species and its distribution was investigated and the host plants were also listed in China (3), to our knowledge, this is the first report of P. clavispora causing leaf blotch on rose R. chinensis in China.

First Report of Infection of Cherry Rusty Mottle Associated Virus in Portuguese Laurel (Prunus lusitanica) in Washington State.

During late spring of 2012 in Snohomish County of Washington State, chlorotic yellow leaf blotch symptoms suggestive of a virus infection were observed on Portuguese laurel (Prunus lusitanica) planted in a hedge row. Leaf samples from representative trees were initially tested for the presence of Cherry leaf roll virus (CLRV) and Plum pox virus (PPV) by ELISA with antibodies specific to CLRV and general potyvirus, respectively (Agdia, Inc., Elkhart, IN). The ELISA test yielded negative results for both viruses. Reverse transcription (RT)-PCR was pursued to detect other viruses known to infect Prunus spp., namely American plum line pattern virus (APLPV), Apple chlorotic leafspot virus (ACLSV), Cherry mottle leaf virus (CMLV), Cherry raspleaf virus (CRLV), Cherry virus A (CVA), Prune dwarf virus (PDV), and Prunus necrotic ringspot virus (PNRSV), as well as CLRV and PPV. None of these viruses were detected. However, RT-PCR with a generic primer pair Fovea2/AdPr (3) that amplifies the coat protein (CP) coding sequence and 3'-untranslated regions (3'-UTR) of several members of the family Betaflexiviridae yielded a 1.4-kb amplicon that was cloned into pCR2.1 (Invitrogen, Carlsbad, CA) and sequenced (GenBank Accession No. KF356396). The sequences from three clones were 99.8% identical to each other at the nucleotide level. Comparison of the consensus CP coding region with the nucleotide sequence database revealed 86 to 93% identity to Cherry rusty mottle associated virus (CRMaV), and only 73 to 75% identities to Cherry necrotic rusty mottle virus (CNRMV) (1) and 71 to 76% identities to Cherry green ring mottle virus (CGRMV) (4) isolates from sweet cherry (P. avium). This result suggested that the cloned fragment represents a strain of CRMaV. Prunus avium 'Bing' and 'Sam,' and P. serrulata 'Kwanzan' were grafted with bark patches from the symptomatic tree and observed for induction of cherry rusty mottle disease (CRMD) symptoms. Ninety days after grafting, symptoms typical of CRMD consisting of chlorotic yellow mottle appeared on 'Bing,' 'Sam,' and 'Kwanzan' indicators. Small necrotic spots also appeared on the leaves of the latter. Angular necrotic lesions on 'Sam' and epinasty of 'Kwanzan' that are diagnostic symptoms of cherry necrotic rusty mottle disease (CNRMD) and cherry green ring mottle disease (CGRMD), respectively, were absent from graft inoculated indicators. Further RT-PCR tests on the indicators using primers specific to CNRMV, CGRMV, and CRMaV (2) yielded negative results for CNRMV and CGRMV but showed positive amplification for CRMaV. The results of the woody indexing corroborate the presence of CRMaV but the absence of CNRMV and CGRMV in the symptomatic Portuguese laurel. To our knowledge, this is the first report of CRMaV in Portuguese laurel in the United States and the first description of symptoms associated with CRMaV in this host. As a potential reservoir of CRMaV, Portuguese laurel could play an important component in management of CRMD in cherry production areas where this ornamental cherry is also present.

First Report of Raspberry leaf blotch virus in Raspberries in Finland.

Raspberry (Rubus idaeus L.) is a valuable and widely grown softfruit that is a host for 40 viruses and virus-like agents, of which many are not characterized at the molecular level. Recently, Raspberry leaf blotch virus (RLBV, putative emaravirus species) was described from raspberries (cv. Glen Ample) in the United Kingdom and Serbia. Plants displayed conspicuous yellow blotches on leaves and abnormal development of leaf hairs in the corresponding areas of the abaxial side (3). Similar symptoms were observed in 'Glen Ample' grown in protective plastic tunnels and open fields in the main berry growing area in eastern Finland in June 2011. In three farms, leaves were sampled from symptomatic and symptomless plants of 'Glen Ample' and also cv. Polka displaying no symptoms. Total RNA was extracted using CTAB reagent. Equal amounts of RNA were pooled from 13 samples and subjected to small-RNA (sRNA) deep sequencing (Fasteris SA, Plan-les-Ouates, Switzerland) to detect viruses without advance information (2). Contigs were built on 21- to 24-nt sRNA reads using Velvet. Contigs larger than 50 nt were used to search homologous sequences in GenBank by BLAST and significant similarity (up to 99%) was observed with RLBV RNA3 and RNA4. Mapping sRNA reads to the genome of RLBV (1) by MAQ resulted in significant coverage of RNA1 (16%), RNA2 (37%), RNA3 (46%), RNA4 (65%), and RNA5 (27%). cDNA was synthesized on RNA of one symptom-expressing plant using random hexamer primers and the cDNA tested by PCR with a forward primer (RLBV-F 5'-TCAAATCCACTTGCATAGAACC-3', nt 723 to 744) and reverse primer (RLBV-R1 5'-CCTCAAACCTTGCAAACACA-3', nt 1,318 to 1,337) designed according to the nucleocapsid (NP) gene of the Scottish RLBV isolate (3). The sequence of the amplified partial NP gene (576 nt; GenBank Accession No. JQ684678) was 92.8% and 94.8% identical to the Scottish isolate at nt and amino acid levels, respectively. The forward primer RLBV-F and a new reverse primer (RLBV-R2 5'-GCCGAAAGTCAAACCTGGTG-3', nt 943 to 962) were used to test additional plants for RBLV and to make a probe (198 nt) to detect RLBV using digoxigen-labeled sense and antisense RNA probes, as described for European mountain ash ringspot associated virus (1). RLBV was detected in all tested plants of 'Glen Ample' with yellow leaf blotch symptoms in the three farms, but not in any symptomless plants of 'Glen Ample' and 'Polka.' The sense probes gave strong signals, in contrast to the antisense probes, which gave only weak or no detectable signals in the virus-positive plants, consistent with the negative RNA strand of RLBV being encapsidated in virus particles. The results show RLBV is associated with severe, distinct, and characteristic symptoms in raspberries of cv. Glen Ample grown in plastic tunnels and open fields in Finland and has an apparent negative impact on plant growth and yield. Our observations in 2011 also suggest that the incidence of diseased plants is much higher in plastic tunnels than in open fields, perhaps because the conditions for the vector of RLBV (raspberry leaf and bud mite, Phyllocoptes gracilis Nalepa) (1) are more favorable in plastic tunnels. These results clarify the etiology of raspberry leaf blotch disease in Finland and emphasize the need to inspect raspberry planting materials for RLBV for better control of the disease.

Leaf Spot of Nymphoides peltata Caused by Septoria villarsiae in Korea

Nymphoides peltata (syn. Limnanthemum nymphoides, Villarsia nymphaeoides) is an aquatic flowering plant in the family Menyanthaceae, and commonly called fringed water-lily or water fringe. The plants are widely cultivated for ornamental purposes in ponds and water gardens in Korea. In June 2008, plants showing typical symptoms of leaf spots with yellowing were first found in a pond in Osan, Korea. Simple microscopic examination suggests that the spots are associated with infections by a species of Septoria (Shin and Sameva, 2004). Further surveys of water gardens in Korea were made in 2008 and 2009, and we confirmed the occurrence of the disease in Daejeon, Incheon, Pocheon, Pyeongchang and Suwon. The leaf spots frequently occurred, detracting from the beauty of glossy leaves of the plant (Fig. 1A). Under certain circumstances, leaves were heavily infected even before they unfold at the water surface, devastating whole host populations. Initial symptoms were circular, pale greenish to brownish, later expanding to form larger lesions without definite margin. Numerous black conidiomata were formed on the surface of the lesion (Fig. 1B). Under humid condition and also by placing the infected leaves in humid chamber, white to cream-colored conidial horns were produced from conidiomata (Fig. 1C). Microscopic examination of the lesions from fresh materials was performed under a microscope. Conidiomata were pycnidial, epiphyllous, scattered to confluent, sometimes 2-3(-5) pycnidia touched with their walls, dark brown to rusty brown, globose, immersed in host tissue or somewhat erumpent, 40-90 μm in diameter, with an ostiole of 15-30 μm in diameter. Conidia were substraight, guttulate, hyaline, 25-55×2-2.5 μm, (0-)1-5-septate (Fig. 1D). Single conidial isolates formed dark greyish colonies on potato dextrose agar (Fig. 1E). Based on the morphological characteristics, the causal fungus was identified as Septoria villarsiae Desm. (Radulescu et al., 1973; Paul and Singh, 2003). Voucher specimens are housed at Korea University (KUS-F23403, F24594) and isolates were deposited in the Korean Agricultural Culture Collection of the National Academy of Agricultural Science (KACC43773, KACC44794). Conidiomata matured after 5 weeks when plates were incubated under fluorescent illumination for 12 hrs photoperiods at 25oC, producing abundant conidia. Pathogenicity was confirmed by inoculating the leaves of three plants with a conidial suspension (ca. 2×105 conidia/ml). Three non-inoculated plants served as controls. The plants were covered with plastic bags for maintaining 100% relative humidity for 48 hrs. After 8 days, typical leaf blotch symptoms, identical to the ones observed in the field, started to develop on the leaves of inoculated plants. No symptoms were observed on control plants. Septoria villarsiae was reisolated from the lesions of inoculated plants, fulfilling Koch’s postulates. The leaf spot diseases associated with S. villarsiae have previously been recorded on N. peltata in Romania (Radulescu et al., 1973), the Netherlands (Van der Velde et al., 1982), and India (Paul and Singh, 2003). To our knowledge, this is the first report of this fungus as well as its host plant in East Asia.

Occurrence of leaf blotch disease (<i>Botryosphaeria</i> Sp.) in <i>Ficus religiosa</i> in Sri Lanka

This paper reports the occurrence of a leaf blotch disease in Ficus religiosa in Sri Lanka. The disease first appears as small, irregular, yellow specks in leaves at later stages of maturity and with time the infected areas become necrotic and gradually enlarge. At advanced stages the whole leaf turns yellow with brown blotches and is shed. The causal agent was identified as Botryosphaeria sp. The necrotic blotches are associated with erumpent fruiting bodies of the fungus, ascomata. Ascomata are solitary or botryose and are found on both sides of leaves. Asci are with numerous pseudoparaphyses and ascospores were observed. Colony developed on water agar medium showed hyaline, aseptate conidia and mature brown conidia. In the presence of leaf blight caused by Glomerella cingulata, the leaf blotch symptoms appeared much later, about 10-12 weeks after the new flush. The diseased leaves do not last long as F. religiosa, being a deciduous species, sheds leaves seasonally. However, the fallen leaves, unless eliminated, may provide a good source of inoculum for infection of the new flush. Commercial fungicide, BULLET 50, inhibited the in vitro growth of Botryosphaeria sp. This is the first report on a blotch disease attacking leaves of F. religiosa in Sri Lanka. Key words: sacred fig; fungal disease DOI: 10.4038/cjsbs.v38i2.1858 Cey. J. Sci. (Bio. Sci.) 38 (2): 51-56, 2009

First Report of Leaf Blotch Caused by Septoria phalaridis on Phalaris paradoxa.

Phalaris paradoxa (hood canarygrass) is one of the most abundant weeds in wheat fields of Iran. In a survey conducted from 2005 to 2007 in Ilam (Dehloran City) and Golestan (Gorgan City) provinces, leaf blotch symptoms were prevalent on P. paradoxa. Initial symptoms were pale brown and necrotic lesions that were 3 to 4 mm long on the leaves. Severity of the disease on the lower leaves was higher than on the upper leaves. Pycnidia were observed on the adaxial surface of infected leaves, scattered or sometimes in clusters, dark brown, globose, and 70 to 90 μm in diameter, with the ostiole approximately 10 μm in diameter. Conidia were filiform, hyaline, 0 to 3 septate (mostly 1 septate), and 17 to 40 × 1.5 to 2.0 μm. Conidiogenesis type was holoblastic. On the basis of the above morphological characters, this species was identified as Septoria phalaridis Cocc. & Morini (2,3). Sequencing the internal transcribed spacer (ITS) region of the fungus (GenBank Accession No. GU123926) showed 98% homology to Mycosphaerella graminicola strain 687 and 97% to S. passerinii strain ATCC26515 (GenBank Accession Nos. AB435068.1 and AF181696.1). To confirm pathogenicity of the fungus, 25 P. paradoxa seedlings were inoculated at the three-leaf stage with 20 ml of 1 × 107 spores/ml suspension with a hand sprayer. Plants were covered with a clear polyethylene bag to increase humidity and prevent cross contamination. After 72 h, bags were removed and plants were kept in a greenhouse at 21 ± 2/16 ± 2°C (day/night) and a 16-h photoperiod. Control plants received sterilized distilled water only. Leaves of each plant were visually inspected every day and the appearance of disease symptoms was recorded. After 1 month, all inoculated leaves showed symptoms and signs of the disease such as chlorosis, necrosis, and pycnidia, whereas control plants showed no symptoms or signs of disease. The infected plant tissues were examined with a microscope, the pycnidia and pycnidiospores were measured, and S. phalaridis was reisolated from leaf lesions. The first description of S. phalaridis was on P. brachystachys (1); however, to our knowledge, this is the first report of this pathogen on P. paradoxa. In addition, this is a new fungal species for the mycobiota of Iran. Two voucher specimens (IRAN 14078 F and IRAN 14218 F) were deposited in the Fungus Collection of the Ministry of Jihad-e Agriculture, Tehran, Iran.

First report of Septoria pachyspora causing leaf blotch of Zanthoxylum schinifolium

Zanthoxylum schinifolium is cultivated for its seed oil in Korea. The oil is used for medicinal purposes and in special cuisines and consequently is highly valued in the market. Rust caused by Coleosporium zanthoxyli is the only disease recorded on this tree in Korea so far (Cho & Shin, 2004). In 2001, several Z . schinifolium leaves with leaf-blotch symptoms were found in Goseong, Korea. The pathogen was identified as a Septoria sp. by preliminary microscopy; however, pathogenicity was not confirmed. In August 2005, a number of 10 to 15 year-old trees in Hongcheon, Korea, were found to have typical leaf blotch symptoms, causing premature defoliation. Initial symptoms were circular, brown to dark brown leaf spots, later expanding to occupy half of the leaf. Numerous black conidiomata with conidial horns were formed on the surface of the lesion. Single conidial isolates formed dark greyish colonies on potato dextrose agar. Conidiomata matured after 5 weeks when plates were incubated under fluorescent illumination for 12 h photoperiods at 25 ° C. Conidiomata were pycnidial, amphigenous, 85–140 μ m in diameter. Conidia were curved to substraight, guttulate, subhyaline, 30–64 × 2–3 μ m, 2–7 septate. Based on the morphological and cultural characteristics, the isolates were identified as Septoria pachyspora (Saccardo, 1895; Greene, 1964). The collection from 2001 coincided with the 2005 collection in terms of leaf symptoms as well as morphology of conidiomata and conidia. Voucher specimens are housed at Korea University (SMK 18664, 21293) and a conidial isolate is kept in the Korean Agricultural Culture Collection of the National Institute of Agricultural Biotechnology (KACC 42510). Pathogenicity was confirmed by wound-inoculating the leaves of three 2-year-old seedlings with a conidial suspension ( ca . 2 × 10 5 conidia/mL). Three non-inoculated seedlings served as controls. The plants were maintained in a glasshouse at 100% relative humidity for 48 h. After 8 days, typical leaf blotch symptoms, identical to the ones observed in the field, started to develop on the leaves of inoculated plants. No symptoms were observed on control plants. Septoria pachyspora was reisolated from the lesions of inoculated plants. A leaf spot disease associated with S. pachyspora has previously been recorded on Z. americanum in North America (Greene, 1964) and on Z. ailanthoides in Japan (Kobayashi et al ., 1983). This is the first report of S. pachyspora causing leaf blotch on Z . schinifolium worldwide.

Cladosporium leaf-blotch and stem rot of Paeonia spp. caused by Dichocladosporium chlorocephalum gen. nov.

Cladosporium chlorocephalum (= C. paeoniae) is a common, widespread leaf-spotting hyphomycete of peony (Paeonia spp.), characterised by having dimorphic conidiophores. During the season, one stage of this fungus causes distinct, necrotic leaf-blotch symptoms on living leaves of Paeonia spp. In late autumn, winter or after overwintering, a second morphologically distinct conidiophore type occurs on dead, blackish, rotting stems. Conspecificity of the two morphs, previously proposed on the basis of observations in culture, was supported by DNA sequence data from the ITS and LSU gene regions, using cultures obtained from leaf-blotch symptoms on living leaves, as well as from dead stems of Paeonia spp. Sequence data were identical, indicating a single species with two morphs. On account of its distinct conidiogenous loci and conidial hila, as well as its sequence-based phylogenetic position separate from the Davidiella/Cladosporium clade, the peony fungus has to be excluded from Cladosporium s. str., but still belongs to the Davidiellaceae (Capnodiales). The leaf-blotching (cladosporioid) morph of this fungus morphologically resembles species of Fusicladium, but differs in having dimorphic fruiting, and is phylogenetically distant from the Venturiaceae. The macronematous (periconioid) morph resembles Metulocladosporiella (Chaetothyriales), but lacks rhizoid conidiophore hyphae, and has 0-5-septate conidia. Hence, C. chlorocephalum is assigned to the new genus Dichocladosporium.

Phylogenetic reassessment of Mycosphaerella spp. and their anamorphs occurring on Eucalyptus. II.

Species of Eucalyptus are widely planted as exotics in the tropics and Southern Hemisphere and to some extent in southern Europe, for timber and fibre production. Species of Mycosphaerella are commonly associated with leaves and twigs of Eucalyptus and can result in defoliation, dieback, and even tree death. In the present study, numerous isolates of Mycosphaerella species were collected from leaf litter, living leaves exhibiting leaf spot symptoms or severe Mycosphaerella leaf blotch symptoms. Isolates were compared based on DNA sequence data for the internal transcribed spacer region (ITS1 & ITS2) and the 5.8S gene. These data, together with characteristics of the fungal growth on three different media, morphology of the anamorph and teleomorph structures as well as ascospore germination patterns were used to describe 21 new species.

Cropload Affects Fruit Quality of Honeycrisp Apple

In 2001 and 2002, we imposed a wide range of croploads (0-15 fruits/cm2 of TCA) on 4- and 5-year-old Honeycrisp/M.9 trees by manual hand thinning soon after bloom to define appropriate croploads that give adequate repeat bloom and also the best fruit quality. At harvest each year we evaluated fruit ripening and quality. Samples were stored for 5 months in air at 38 °F and 33 °F and evaluated for fruit firmness and storage disorders. Cropload was negatively correlated with tree growth, return bloom, fruit size, fruit red color, fruit sugar content, fruit starch content, fruit firmness, fruit acidity, fruit bitter pit, fruit senescent breakdown, fruit rot and fruit superficial scald, but was positively correlated with leaf blotch symptoms, fruit internal ethylene concentration at harvest, and fruit soggy breakdown. There was a strong effect of cropload on fruit size up to a cropload 7, beyond which there was only a small additional effect. Although there was considerable variation in return bloom, a relatively low cropload was required to obtain adequate return bloom. Fruit red color was reduced only slightly up to a cropload of 8 beyond which it was reduced dramatically. The reduced fruit color and sugar content at high croploads could indicate a delay in maturity of but, fruits from high croploads were also softer, had less starch and greater internal ethylene. It that excessive croploads advance maturity. Overall, croploads greater than 10 resulted in no bloom the next year, and poor fruit size, color and flavor, but these fruits tended to have the least storage disorders. Moderate croploads (7-8) resulted in disappointing return bloom and mediocre fruit quality. For optimum quality and annual cropping, relatively low croploads of 4-5 were necessary.