Leaf Aphid Research Articles

Loss-of-function of LIGULELESS1 activates the jasmonate pathway and promotes maize resistance to corn leaf aphids.

Corn leaf aphids (Rhopalosiphum maidis) are highly destructive pests of maize (Zea mays) that threaten growth and seed yield, but resources for aphid resistance are scarce. Here, we identified an aphid-resistant maize mutant, resistance to aphids 1 (rta1), which is allelic to LIGULELESS1 (LG1). We confirmed LG1's role in aphid resistance using the independent allele lg1-2, allelism tests and LG1 overexpression lines. LG1 interacts with, and increases the stability of ZINC-FINGER PROTEIN EXPRESSED IN INFLORESCENCE MERISTEM (ZIM1), a central component of the jasmonic acid (JA) signalling pathway, by disturbing its interaction with the F-box protein CORONATINE INSENSITIVE 1a (COI1a). Natural variation in the LG1 promoter was associated with aphid resistance among inbred lines. Moreover, a loss-of-function mutant in the LG1-related gene SPL8 in the dicot Arabidopsis thaliana conferred aphid resistance. This study revealed the aphid resistance mechanism of lg1, providing a theoretical basis and germplasm for breeding aphid-resistant crops.

An ideal model of plant-vector-phytopathogen interaction and the management of the vector

Maize (Zea mays L.) is a vital cereal crop worldwide, crucial for global food security and various industrial applications. Its cultivation faces significant challenges from a diverse array of insect pests and pathogens, notably including the maize leaf aphid (Rhopalosiphum maidis) and the maize dwarf mosaic virus (MDMV). This paper explores the intricate interactions among maize, its insect vectors, and MDMV, emphasizing the urgent need for a deeper understanding to develop sustainable management strategies. Maize exhibits vast genetic diversity and is cultivated across diverse environments, making it susceptible to a range of pests and diseases. The transmission of MDMV by aphids, particularly R. maidis, poses a significant threat to maize production globally. The complex tripartite interaction between maize, aphids, and MDMV serves as an ideal model system for studying plant-insect-phytopathogen interactions. Understanding the components of this interaction is critical for developing effective management strategies. Despite significant research efforts, there remains a knowledge gap in the molecular mechanisms underlying vector-borne diseases. Further research on the molecular level is essential for identifying specific targets for genetic pest control and disrupting pathogen transmission by insect vectors. Developing countries, in particular, require intensified research efforts to address the growing challenges to food security and agricultural sustainability. Thus, unraveling the complexities of plant-insect-phytopathogen interactions is essential for devising effective strategies to combat vector-borne diseases and sustain global food systems. Enhanced scientific research, especially in developing regions, is crucial for addressing these challenges and ensuring food security for future generations.

Unravelling the novel genetic diversity and marker-trait associations of corn leaf aphid resistance in wheat using microsatellite markers.

The study was conducted to identify novel simple sequence repeat (SSR) markers associated with resistance to corn aphid (CLA), Rhopalosiphum maidis L. in 48 selected bread wheat (Triticum aestivum L.) and wild wheat (Aegilops spp. & T. dicoccoides) genotypes during two consecutive cropping seasons (2018-19 and 2019-20). A total of 51 polymorphic markers containing 143 alleles were used for the analysis. The frequency of the major allele ranged from 0.552 (Xgwm113) to 0.938 (Xcfd45, Xgwm194 and Xgwm526), with a mean of 0.731. Gene diversity ranged from 0.116 (Xgwm526) to 0.489 (Xgwm113), with a mean of 0.354. The polymorphic information content (PIC) value for the SSR markers ranged from 0.107 (Xgwm526) to 0.370 (Xgwm113) with a mean of 0.282. The results of the STRUCTURE analysis revealed the presence of four main subgroups in the populations. Analysis of molecular variance (AMOVA) showed that the between-group difference was around 37 per cent of the total variation contributed to the diversity by the whole germplasm, while 63 per cent of the variation was attributed between individuals within the group. A general linear model (GLM) was used to identify marker-trait associations, which detected a total of 23 and 27 significant new marker-trait associations (MTAs) at the p < 0.01 significance level during the 2018-19 and 2019-20 crop seasons, respectively. The findings of this study have important implications for the identification of molecular markers associated with CLA resistance. These markers can increase the accuracy and efficiency of aphid-resistant germplasm selection, ultimately facilitating the transfer of resistance traits to desirable wheat genotypes.

Screening of wild and synthetic wheat genotypes for resistance against corn leaf aphid, Rhopalosiphum maidis (Fitch)

Screening of wild and synthetic wheat genotypes for resistance against corn leaf aphid, Rhopalosiphum maidis (Fitch)

Prevalence of insect pests on maize crop in District Mansehra, Khyber Pakhtunkhwa, Pakistan.

The maize crop is used as food for humans, livestock and poultries forms, it is also used in bread making, corn flakes, corn syrup, corn starch and corn oils. The field study consisted of one experimental trial, about the incidence of that insect pest complex on maize cultivar Azam during the Kharif season 2020 at the Agricultural, Research Station, Baffa, Mansehra. The trial was laid out in the Randomized Complete Block Design (RCBD), and then it was divided into three replications. The result obtained from the trial showed that a number of the pest species were recorded during the experimental period; however, the population was noticed at a low level. The obtained insect species were corn leaf aphid (6.90 ± 5.5) per square inch, corn leafhopper (1.32 ± 0.63), maize stem borer (0.63 ± 0.29), corn flea beetle (0.43 ± 0.28), Thrips (0.38 ± 0.22), Hairy caterpillar (0.21 ± 0.22), Grasshopper (0.17 ± 0.11) and shoot fly (0.11 ± 0.08) throughout the season.

Maize terpene synthase 1 impacts insect behavior via the production of monoterpene volatiles β-myrcene and linalool

Plant-derived volatiles are important mediators of plant-insect interactions as they can provide cues for host location and quality, or act as direct or indirect defense molecules. The volatiles produced by Zea mays (maize) include a range of terpenes, likely produced by several of the terpene synthases (TPS) present in maize. Determining the roles of specific terpene volatiles and individual TPSs in maize-insect interactions is challenging due to the promiscuous nature of TPSs in vitro and their potential for functional redundancy. In this study, we used metabolite GWAS of a sweetcorn diversity panel infested with Spodoptera frugiperda (fall armyworm) to identify genetic correlations between TPSs and individual volatiles. This analysis revealed a correlation between maize terpene synthase 1 (ZmTPS1) and emission of the monoterpene volatiles linalool and β-myrcene. Electroantennogram assays showed gravid S. frugiperda could detect both linalool and β-myrcene. Quantification of headspace volatiles in a maize tps1 loss-of-function mutant confirmed that ZmTPS1 is an important contributor to linalool and β-myrcene emission in maize. Furthermore, pairwise choice assays between tps1 mutant and wild-type plants showed that ZmTPS1, and by extension its volatile products, aid host location in the chewing insect S. frugiperda, yet repel the sap-sucking pest, Rhopalosiphum maidis (corn leaf aphid). On the other hand, ZmTPS1 had no impact on indirect defense via the recruitment of the parasitoid Cotesia marginiventris. ZmTPS1 is therefore an important mediator of the interactions between maize and its insect pests.

Synthesis and Insecticidal Assessment of Some Innovative Heterocycles Incorporating a Pyrazole Moiety

The compound 1,3-diphenyl-1H-pyrazole-4-carbaldehyde (1) was utilized as a fundamental component in the synthesis of novel N-phenyl pyrazole derivatives. Substituted N-phenyl pyrazole compounds including 2-cyano-3-(1,3-diphenyl-1H-pyrazol-4-yl)-N-Substituted-acrylamide derivatives (4a–h), 4-(hydrazineylidenemethyl)-1,3-diphenyl-1H-pyrazole (6) and 2-cyano-N'-((1,3-diphenyl-1H-pyrazol-4-yl)methylene)-acetohydrazide (11) were obtained in moderate yields through the reaction of 1 with 2-cyano-N-substituted acetamide derivatives 3a–h, hydrazine hydrate, and cyanoacetohydrazide under basic-catalyzed conditions, respectively. Moreover, hydrazinyl-pyarzole 6 reacted with 4,5,6,7-tetrabromoisobenzofuran-1,3-dione (7) to afford 4,5,6,7-tetrabromo-2-(((1,3-diphenyl-1H-pyrazol-4-yl)methylene)amino)- isoindoline-1,3-dione (8). Furthermore, pyrazoloacetohydrazide 11 is condensed with salicylaldehyde derivatives 12a–e to give pyrazolochromene carbohydrazide derivatives 13a–e. Also, acetohydrazide 11 refluxed with N, N-dimethylformamide dimethyl acetal to produce 2-cyano-3-(dimethylamino)-N'-((1,3-diphenyl-1H-pyrazol-4-yl)methylene)acrylohydrazide (15), which upon exposure to acidic conditions underwent cyclization to form 4-((dimethylamino)methylene)-6-(1,3-diphenyl-1H-pyrazol-4-yl)pyridazine-3,5(4H,6H)-dione (16). The newly synthesized compounds were identified and confirmed using elemental and spectral data analyses as IR, MS, 1H NMR, 13C NMR, and 2D NMR analysis (H-H COSY, HSQC, HMBC, and NOSEY), Also, DFT studies were done to prove the geometrical optimization and spatial distributions orbitals of compounds 4a and 11. The toxicity of N-phenylpyrazole compounds was tested against the corn leaf aphid (Rhopalosiphum maidis) and the mealy plum aphid (Hyalopterus pruni). Compounds 4c, 13c, and 13d were found to be the most potent to control the two insects compared with acetamiprid 20% SP recommended by the Ministry of Agriculture. The biochemical investigation of insects was studied to the most effective compounds on insects as well, and the toxicity of compounds 4c, 13c, and 13d was studied on the predators (Hippodamia variegata, Cydonia vicina isis, Cydonia vicina nilotica, and 4th instar larvae H. variegata) under laboratory conditions.

Risk Analysis of Sengon (Falcataria moluccana Miq.) Seedling Production Using Fault Tree Method

This research analyzed the sengon (Falcataria moluccana Miq.) seedling production risk and factors associated with the risks at the Research and Development Center for Forest Plant Seed Technology (BPPTPTH) Bogor. The data collection included interviews using questionnaires with 11 purposely selected respondents. This research employed the Fault Tree Analysis (FTA), a descriptive qualitative method, to analyze the seedling production risks. The results revealed two groups of risks, namely field and management production risks, that stemmed from eight primary roots. These eight primary roots included long seed storage time, far distance between the nursery and the researcher's office, lack of safety facilities, lack of employee skills, lack of employee appreciation, high frequency of employee absences for personal reasons, changes in seasons that cause changes in planting schedules, and changes in budget allocation. Inaddition to these eight main factors, leaf aphids and fungi attacks, including tumorrust(karat puru), could also increase seedling production risks.

Deciphering the genetic diversity and population structure of wild barley germplasm against corn leaf aphid, Rhopalosiphum maidis (Fitch)

Corn-leaf aphid (CLA-Rhopalosiphum maidis) is a major insect pest of barley (Hordeum vulgare) causing yield loss upto 30% under severe infestation. Keeping in view of the availability of very few sources of CLA resistance in barley, the present investigation was framed to assess the genetic diversity and population structure of 43 wild barley (H. vulgare subsp. spontaneum) genotypes using eight microsatellite markers against R. maidis. Three statistical methods viz. multivariate-hierarchical clustering, Bayesian clustering and PCoA, unanimously grouped genotypes into three subpopulations (K = 3) with 25.58% (SubPop1-Red), 39.53% (SubPop2-Green) and 34.88% (SubPop3-Blue) genotypes including admixtures. Based on Q ≥ 66.66%, 37.20% genotypes formed a superficial “Mixed/Admixture” subpopulation. All polymorphic SSR markers generated 36 alleles, averaging to 4.5 alleles/locus (2–7 range). The PIC and H were highest in MS31 and lowest in MS28, with averages of 0.66 and 0.71. MAF and mean genetic diversity were 0.16 and 89.28%, respectively. All these parameters indicated the presence of predominant genetic diversity and population structure amongst the studied genotypes. Based on AII, only 6 genotypes were found to be R. maidis resistant. SubPop3 had 91.66% (11) of the resistant or moderately resistant genotypes. SubPop3 also had the most pure genotypes (11), the least aphid infestation (8.78), and the highest GS (0.88), indicating its suitability for future R. maidis resistance breeding initiatives.

Bioinsecticidal Effect of Origanum vulgare subsp. hirtum (Link) Essential Oil Vapours on Myzus persicae Sulzer in Tobacco and Apis mellifera L.

The peach leaf aphid Myzus persicae Sulzer is a polyphagous species which causes economic damages to many agricultural crops in Bulgaria and worldwide. The aim of the study was to test the bioinsecticidal effect of the essential oil (EO) vapours of Origanum vulgare subsp. hirtum (Link) on M. persicae in tobacco and Apis mellifera L., as nontarget organism. The determination of the main EO contents was carried out on gas chromatograph. The chemical composition of the O. vulgare subsp. hirtum EO includes the terpenoid carvacrol – 67.4%, ρ-cymene – 13.7%, cineole + γ-terpinene – 8.3%, and α-pinene + β-pinene – 4.5%. The study was conducted in laboratory conditions. The study established efficacy of the oregano EO vapours against the peach leaf aphid. The findings indicated 100% efficacy of the O. vulgare subsp. hirtum EO vapours against M. persicae at a dose of 2 μl/l–1 air and 3 μl/l–1 air; 63.6% efficacy at 1 μ l/l–1 air and 31.2% at 0.5 μl/l–1 air. No phytotoxicity of the tobacco plants was found at any of the tested doses. The minimum dose with the highest efficacy tested on honey bees was also toxic to them.

Chemical composition and aphidicidal properties of castor-bean leaves against Rhopalosiphum maidis and Sipha flava (Hemiptera: Aphididae)

Plant extracts are a great source of molecules with insecticidal activity and are used to control pests in various crop production systems. In this study, we evaluated the aphidicidal properties in vitro of the n-hexane extract of leaves of castor-bean (Ricinus communis L.; Euphorbiaceae) at different concentrations (0.5, 1.0, 2.5, 5.0 and 10 kg m-3) against apterous adults of corn leaf aphid (Rhopalosiphum maidis Fitch) and the yellow sugarcane aphid (Sipha flava Forbes). The observed effects were dose-dependent, and the highest concentration evaluated (10 kg m-3) caused 82% mortality in R. maidis and 79% in S. flava. To identify chemical compounds, present in the extract we used mass gas chromatography, identifying 16 compounds. Palmitic acid was the major compound, with 45.34% abundance. The data obtained indicate the existence of insecticidal compounds in the castor-bean n-hexane extract, which could be used as an alternative bioinsecticide in the integrated management of these two aphid species.

Combining quantitative trait locus mapping with multiomics profiling reveals genetic control of corn leaf aphid (Rhopalosiphum maidis) resistance in maize.

The corn leaf aphid (Rhopalosiphum maidis) is a major maize pest that frequently causes substantial yield losses. Exploring the genetic basis of resistance to aphids is important for improving maize yield and quality. Here, we used a maize recombinant inbred line population derived from two parents with different susceptibility to aphids, B73 (susceptible) and Abe2 (resistant), and performed quantitative trait locus (QTL) mapping using aphid resistance scores as an indicator. We mapped a stable QTL, qRTA6, to chromosome 6 using data from 2 years of field trials, which explained 40.12-55.17% of the phenotypic variation. To further investigate the mechanism of aphid resistance in Abe2, we constructed transcriptome and metabolome libraries from Abe2 and B73 leaves with or without aphid infestation at different time points. Integrating QTL mapping and transcriptome data revealed three aphid resistance candidate genes (Zm00001d035736, Zm00001d035751, and Zm00001d035767) associated with the hypersensitive response, the jasmonic acid pathway, and protein ubiquitination. Integrated transcriptomic and metabolomic analysis revealed that the differentially expressed genes and metabolites were enriched in flavonoid biosynthesis. These findings extend our understanding of the molecular mechanisms controlling aphid resistance in maize, and the QTL and candidate genes are valuable resources for increasing this resistance.

Secondary symbionts affect aphid fitness and the titer of primary symbiont.

Bacterial symbionts associated with aphids are important for their ecological fitness. The corn leaf aphid, Rhopalosiphum maidis (Fitch), is one of the most damaging aphid pests on maize and has been reported to harbor Hamiltonella defensa and Regiella insecticola while the effects of the secondary symbionts (S-symbionts) on host ecology and primary symbiont Buchnera aphidicola remain unclear. Here, four aphid strains were established, two of which were collected from Langfang - Hebei Province, China, with similar symbiont pattern except for the presence of H. defensa. Two other aphid strains were collected from Nanning - Guangxi Province, China, with the same symbiont infection except for the presence of R. insecticola. Phylogenetic analysis and aphid genotyping indicated that the S-symbiont-infected and free aphid strains from the same location had identical genetic backgrounds. Aphid fitness measurement showed that aphid strain infected with H. defensa performed shortened developmental duration for 1st instar and total nymph stages, reduced aphid survival rate, offspring, and longevity. While the developmental duration of H-infected strains was accelerated, and the adult weight was significantly higher compared to the H-free strain. Infection with R. insecticola did not affect the aphid's entire nymph stage duration and survival rate. As the H-strain does, aphids infected with R. insecticola also underwent a drop in offspring, along with marginally lower longevity. Unlike the H-infected strain, the R-infected strain performed delayed developmental duration and lower adult weight. The B. aphidicola titers of the H-infected strains showed a steep drop during the aphid 1st to 3rd instar stages, while the augmentation of B. aphidicola titers was found in the R-infected strain during the aphid 1st to 3rd instar. Our study investigated for the first time the effect of the S-symbionts on the ecology fitness and primary symbiont in R. maidis, indicating that infection with secondary symbionts leads to the modulation of aphid primary symbiont abundance, together inducing significant fitness costs on aphids with further impact on environmental adaptation and trophic interactions.

Genetic Variation, DIMBOA Accumulation, and Candidate Gene Identification in Maize Multiple Insect-Resistance.

Maize seedlings contain high amounts of 2,4-dihydroxy-7-methoxy-1,4-benzoxazin-3-one (DIMBOA), and the effect of DIMBOA is directly associated with multiple insect-resistance against insect pests such as Asian corn borer and corn leaf aphids. Although numerous genetic loci for multiple insect-resistant traits have been identified, little is known about genetic controls regarding DIMBOA content. In this study, the best linear unbiased prediction (BLUP) values of DIMBOA content in two ecological environments across 310 maize inbred lines were calculated; and their phenotypic data and BLUP values were used for marker-trait association analysis. We identified nine SSRs that were significantly associated with DIMBOA content, which explained 4.30-20.04% of the phenotypic variation. Combined with 47 original genetic loci from previous studies, we detected 19 hot loci and approximately 11 hot loci (in Bin 1.04, Bin 2.00-2.01, Bin 2.03-2.04, Bin 4.00-4.03, Bin 5.03, Bin 5.05-5.07, Bin 8.01-8.03, Bin 8.04-8.05, Bin 8.06, Bin 9.01, and Bin 10.04 regions) supported pleiotropy for their association with two or more insect-resistant traits. Within the 19 hot loci, we identified 49 candidate genes, including 12 controlling DIMBOA biosynthesis, 6 involved in sugar metabolism/homeostasis, 2 regulating peroxidases activity, 21 associated with growth and development [(auxin-upregulated RNAs (SAUR) family member and v-myb avian myeloblastosis viral oncogene homolog (MYB)], and 7 involved in several key enzyme activities (lipoxygenase, cysteine protease, restriction endonuclease, and ubiquitin-conjugating enzyme). The synergy and antagonism interactions among these genes formed the complex defense mechanisms induced by multiple insect pests. Moreover, sufficient genetic variation was reported for DIMBOA performance and SSR markers in the 310 tested maize inbred lines, and 3 highly (DIMBOA content was 402.74-528.88 μg g-1 FW) and 15 moderate (DIMBOA content was 312.92-426.56 μg g-1 FW) insect-resistant genotypes were major enriched in the Reid group. These insect-resistant inbred lines can be used as parents in maize breeding programs to develop new varieties.

Analysis of the Genetic Diversity of Two Rhopalosiphum Species from China and Europe Based on Nuclear and Mitochondrial Genes.

Population genetic studies can reveal clues about the evolution of adaptive strategies of aphid species in agroecosystems and demonstrate the influence of environmental factors on the genetic diversity and gene flow among aphid populations. To investigate the genetic diversity of two Rhopalosiphum aphid species from different geographical regions, 32 populations (n = 535) of the bird cherry-oat aphid (Rhopalosiphum padi Linnaeus) and 38 populations (n = 808) of the corn leaf aphid (Rhopalosiphum maidis Fitch) from China and Europe were analyzed using one nuclear (elongation factor-1 alpha) and two mitochondrial (cytochrome oxidase I and II) genes. Based on the COI-COII sequencing, two obvious clades between Chinese and European populations and a low level of gene flow (Nm = 0.15) were detected in R. padi, while no geographical-associated genetic variation was found for EF-1α in this species. All genes in R. maidis had low genetic variation, indicating a high level of gene flow (Nm = 5.31 of COI-COII and Nm = 2.89 of EF-1α). Based on the mitochondrial result of R. padi, we concluded that the long distance between China and Europe may be interrupting the gene flow. The discordant results of nuclear gene analyses in R. padi may be due to the slower evolution of nuclear genes compared to mitochondrial genes. The gene exchange may occur gradually with the potential for continuous migration of the aphid. This study facilitates the design of control strategies for these pests.

Efficacy of different organic formulations against corn leaf aphid in wheat

Efficacy of different organic formulations against corn leaf aphid in wheat

Evaluation of insecticidal efficacy against maize leaf aphid [Rhopalosiphum maidis (Fitch)] under inner terai condition of Nepal

Field experiments were carried out at the National Maize Research Program in Rampur, Chitwan, with the objective of comparing the effectiveness of insecticides in the field for controlling maize leaf aphid (Rhopalosiphum maidis Fitch) during the winter season of 2019 and 2020. The design of the experiment was randomized complete block with four replications. The plot size was 6 rows of 5 m long with the spacing of 60cm × 25cm. Maize hybrid Rampur Hybrid-14 (RML-86/RML-96) was used as experimental variety. The efficacies of five insecticides viz., thiomethoxam 25% w/w 0.2g/L (T1), acetamiprid 20%WP 2g/L (T2), flonicamid 50% WG 0.5g/L (T3), neemix 3ml/L(T4), imidacloprid 0.5ml/L(T5) and untreated control (T6) were used as experimental treatments. The recommended dose of fertilizer was 180: 60: 40 N: P2O5: K2O kg/ ha with farm yard manure 10 t/ha and seed rate was 20kg/ha. Data on aphid incidence, severity, yield and yield components were recorded. All the tested insecticides significantly (P≤0.05) reduced the plant infestation caused by maize aphid, and thereafter increased the grain yield of maize compared to control. However, newer insecticide flonicamid 50% WG 0.5g/L was found as the most effective insecticide with lower aphid colony per plant (2.85), aphid score (2.63), aphid infested plant (7.33%) and higher crop yield (7904.79kg/ha). The application of insecticides prior to their severe infestations is necessary for the efficient control of the maize leaf aphid. The research findings will assist maize farmers in choosing and applying the best insecticide to ensure efficient management of maize leaf aphid with high yield.

Trophic networks associated with the aphid, Rhopalosiphum maidis (Fitch) (Hemiptera: Aphididae) in a cornfield, Manabí, Ecuador

The corn leaf aphid is considered an important pest associated with maize. This study aimed to discover the trophic associations around Rhopalosiphum maidis in Manabí, Ecuador. Maize leaves were sampled to determine the numbers of parasitized aphids, and the identities of predators and parasitoids. Nine taxa of natural enemies were detected: the primary parasitoid was Lysiphlebus testaceipes Cresson, 1880 (Hymenoptera: Braconidae); the hyperparasitoid Syrphophagus aphidivorus (Mayr, 1876) (Hymenoptera: Encyrtidae); the predatory hoverfly Ocyptamus dimidiatus (Fabricius, 1781) (Diptera: Syrphidae), four species of coccinellids, Cheilomenes sexmaculata (Fabricius, 1781), Cycloneda sanguinea (Linnaeus, 1763), Hippodamia convergens Guerin-Meneville, 1842 and Paraneda pallidula guticollis (Coleoptera: Coccinellidae) and an assassin bug, Zelus sp. (Hemiptera: Reduviidae). A parasitoid, Pachyneuron formosum Walker, 1833 (Hymenoptera: Pteromalidae) emerged from hoverfly pupae. This study reports the presence of the parasitoids S. aphidivorus and P. formosum in Ecuador for the first time. These results increase the knowledge of a four-trophic level relationship (host plant – pest – parasitoids, predators – hyperparasitoids) in a maize agroecosystem as a fundamental basis for biological control programs.

Comparative transcriptome analysis of wheat in response to corn leaf aphid, Rhopalosiphum maidis F. infestation.

Aphids are one of the most important insect pests of wheat crop in all wheat growing regions of the world. Amongst various aphid species, the corn leaf aphid (Rhopalosiphum maidis F.) is considered one of the most destructive insect pests of wheat in the North Western Plains region of India. Transcriptome profiling of highly susceptible wheat Triticum durum genotype, A-9-30-1 and tolerant wheat Triticum aestivum genotype, HD2967 was performed to investigate aphid-host interactions. The results obtained from differential gene expression analysis of R. maidis on the highly susceptible genotype, A-9-30-1 plants, when compared with the tolerant genotype, HD2967, showed that 212 genes were significantly upregulated and 1009 genes were significantly downregulated. Our findings demonstrated that the genes associated with defense were significantly higher in response to R. maidis on HD2967 as compared to A-9-30-1. Additionally, various genes with physiological attributes were expressed during aphid attack. Based on gene ontology classification, three classifications, such as, cellular components (CC), molecular function (MF), and biological processes (BP) of sequences were identified. KEGG enrichment analysis revealed that twenty-five pathway genes were differentially expressed during the infestation of wheat with R. maidis. Notable changes were observed in A-9-30-1 and HD2967 transcriptomic profiling after infestation. The results obtained in the present study will help to elucidate the mechanism governing host-pest interaction and may lead to the development of new methods for increasing the resistance level of wheat against R. maidis, including over-expression of defense-related genes.

First report of maize yellow mosaic virus causing maize reddening in Henan,China.

A novel polerovirus maize yellow mosaic virus (MaYMV) has been discovered in Asia (Chen et al. 2016; Lim et al. 2018; Sun et al. 2019; Wang et al. 2016), East Africa (Guadie et al. 2018; Massawe et al. 2018) and South America (Gonçalves et al. 2017). MaMYV was first reported to infect maize (Zea mays L.) showing yellow mosaic symptoms on the leaves in Yunnan, Guizhou, and yellowing and dwarfing symptoms on the leaves in Anhui provinces of China in 2016 (Chen et al. 2016; Wang et al. 2016). An East African isolate of MaYMV has recently been shown to induce leaf reddening in several maize genotypes (Stewart et al. 2020). To our knowledge the leaf reddening symptoms in maize was not reported in China and MaYMV was not reported in Henan province, China. A survey of viral diseases on maize was carried out during the autumn of 2021 in Zhengzhou (Henan province), China. During the survey, the leaves showing reddening symptoms were observed on maize plants in all four fields investigated. Symptomatic leaves of 12 plants from four fields of Xingyang county, Zhengzhou (n=12) were collected and mixed for metatranscriptomics sequencing, and total RNA was extracted and subjected to an rRNA removal procedure using a Ribo-zero Magnetic kit according to the manufacturer's instructions (Epicentre, an Illumina® company). cDNA libraries were constructed using a TruSeq™ RNA sample prep kit (Illumina). Barcoded libraries were paired-end sequenced on an Illumina HiSeq X ten platform at Shanghai Biotechnology Co., Ltd. (Shanghai, China) according to the manufacturer's instructions (www.illumina.com). In total 67607392 clean reads were de novo assembled using CLC Genomics Workbench (version:6.0.4). 105796 contigs were obtained. The assembled contigs were queried by homology search tools (BLASTn and BLASTx) against public database(GenBank). One 5,457 nucleotide (nt) long contig with the most reads of 558826 was obtained and blast analysis showed it shared 99.3% nt sequence identity (99% coverage) with MaYMV Yunnan4 isolate (KU291100).. According to the sequencing data no other plant viruses except MaYMV were present in the sequencing data. To confirm the presence of this virus, twelve leaf samples showing reddening symptoms were detected by RT-PCR using specific primer pairs for CP full length open reading frame (F: ATGAATACGGGAGGTAGAAA, R: CTATTTCGGGTTTTGAACAT). Amplicons with expected size of 594 bp were gained in seven samples and three of them were cloned into pMD18T vector and sequenced. The three isolates (OM417795, OM417796, and OM417797) shared 99.16% to 99.83% nt sequence identity with MaYMV-Yunnan3 isolate (KU291100). Further P0 sequence analysis of the three samples (OM417798, OM417799, and OM417800) with primer pairs F: ATGGGGGGAGTGCCTAAAGC/R: TCATAACTGATGGAATTCCC showed they shared 99.5% to 99.62% nt sequence identity with MaYMV-Yunnan3 isolate.To our knowledge, this is the first report of the occurrence of MaYMV infecting maize in Henan, China. Besides, our finding firstly discovered reddening symptoms caused by MaYMV on maize in China which is different from the previous symptoms observed in the other three provinces of China possibly due to the different maize varieties grown in different areas. According to our investigation, maize showing reddening symptoms was common in the fields. Henan province is the main corn production area in China. Corn leaf aphid (Rhopalosiphum maidis), the insect vector of MaYMV, is an important pest of corn in Henan province, thereby the occurrence of MaYMV might cause potential threat to maize production in China.