Lateral Loop Research Articles

Solution-State Structure of a Long-Loop G-Quadruplex Formed Within Promoters of Plasmodium falciparum B var Genes.

We report the high-resolution NMR solution-state structure of an intramolecular G-quadruplex with a diagonal loop of ten nucleotides. The G-quadruplex is formed by a 34-nt DNA sequence, d[CAG3T2A2G3TATA2CT3AG4T2AG3T2], named UpsB-Q-1. This sequence is found within promoters of the var genes of Plasmodium falciparum, which play a key role in malaria pathogenesis and evasion of the immune system. The [3+1]-hybrid G-quadruplex formed under physiologically relevant conditions exhibits a unique equilibrium between two structures, both stabilized by base stacking and non-canonical hydrogen bonding. Unique equilibrium of the two closely related 3D structures originates from a North-South repuckering of deoxyribose moiety of residue T27 in the lateral loop. Besides the 12 guanines involved in three G-quartets, most residues in loop regions are involved in interactions at both G-quartet-loop interfaces.

Abstract 5775: Structure and dynamics of the major PDGFR-β oncogene promoter G-quadruplex and insights into its cellular regulation

Abstract Overexpression of the receptor tyrosine kinase PDGFR-β promotes cancer growth and metastasis. PDGFR-β is a validated cancer target but PDGFR-β kinase inhibitors suffer from lack of selectivity and side effects. G-quadruplexes are an exciting class of non-B DNA secondary structures with functional importance. The G-quadruplex formed in the PDGFR-β promoter is a transcription repressor and targetable by small molecules. Therefore, the PDGFR-β promoter G-quadruplex is an attractive molecular target for anticancer drugs. Structural information of the PDGFR-β promoter G-quadruplex is crucial for understanding its cellular function and rational drug design. Herein, we used nuclear magnetic resonance (NMR) spectroscopy and biophysical methods to determine the structure and dynamics of the major G-quadruplex formed in the human PDGFR-β promoter. Unlike canonical G-quadruplexes formed by four runs of three continuous guanines (G), the major PDGFR-β G-quadruplex adopts a novel broken-strand structure where a two-G segment is continued by a non-adjacent guanine. The broken-strand G-quadruplex has a vacancy-G-tetrad (vG4) which is filled-in intramolecularly by a distal guanine. Interestingly, we discovered that the major PDGFR-β G-quadruplex is a novel mixture of two equilibrating broken-strand G-quadruplexes. Both structures adopt overall parallel-stranded folding with all 1-nt chain-reversal loops. However, a different 3’-filled-in guanine is delivered by a lateral loop, which forms structurally similar hairpin with a unique capping G-G base-pair. The formation of the equilibrating broken-strand G-quadruplexes and unique capping structures are both specific to the PDGFR-β promoter sequence. Intriguingly, the observed dynamic equilibrium between the two co-existing structures with different intramolecular fill-in guanines indicates a novel vG4 intermediate, which could be filled-in by cellular guanine metabolites such as cGMP. Therefore, our study provides critical insights into how the dynamics of the major PDGFR-β G-quadruplex lead to vG4 formation and potential regulation of gene transcription by cellular guanine metabolites. The determined molecular structures of the novel broken-strand G-quadruplexes provide a structural basis for rational design of small molecules to specifically target the major PDGFR-β promoter G-quadruplex for cancer therapeutics. Citation Format: Yichen Han, Jonathan Dickerhoff, Danzhou Yang. Structure and dynamics of the major PDGFR-β oncogene promoter G-quadruplex and insights into its cellular regulation [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 5775.

Structural Differences at Quadruplex-Duplex Interfaces Enable Ligand-Induced Topological Transitions.

Quadruplex-duplex (QD) junctions, which represent unique structural motifs of both biological and technological significance, have been shown to constitute high-affinity binding sites for various ligands. A QD hybrid construct based on a human telomeric sequence, which harbors a duplex stem-loop in place of a short lateral loop, is structurally characterized by NMR. It folds into two major species with a (3+1) hybrid and a chair-type (2+2) antiparallel quadruplex domain coexisting in a K+ buffer solution. The antiparallel species is stabilized by an unusual capping structure involving a thymine and protonated adenine base AH+ of the lateral loop facing the hairpin duplex to form a T·AH+·G·C quartet with the interfacial G·C base pair at neutral pH. Addition and binding of Phen-DC3 to the QD hybrid mixture by its partial intercalation at corresponding QD junctions leads to a topological transition with exclusive formation of the (3+1) hybrid fold. In agreement with the available experimental data, such an unprecedented discrimination of QD junctions by a ligand can be rationalized following an induced fit mechanism.

Inverted strand polarity yields thermodynamically stable G-quadruplexes and prevents duplex formation within extended DNA.

DNA G-quadruplexes (G4) formed in guanine-rich sequences play a key role in genome function and maintenance, interacting with multiple proteins. However, structural and functional studies of G4s within duplex DNA have been challenging because of the transient nature of G4s and thermodynamic preference of G-rich DNA to form duplexes with their complementary strand rather than G4s. To overcome these challenges, we have incorporated native nucleotides in G-rich sequences using commercially available inverted 3'-O-DMT-5'-O-phosphoramidites of native nucleosides, to give 3'-3' and 5'-5' linkages in the centre of the G-tract. Using circular dichroism and 1H nuclear magnetic resonance spectroscopies and native gel electrophoresis, we demonstrate that these polarity-inverted DNA sequences containing four telomeric repeats form G4s of parallel topology with one lateral or diagonal loop across the face of the quadruplex and two propeller loops across the edges of the quadruplex. These G4s were stable even in the presence of complementary C-rich DNA. As an example, G4 assemblies of inverted polarity were shown to bind to the hinge region of Heterochromatin Protein 1α (HP1α), a known G4-interacting domain. As such, internal polarity inversions in DNA provide a useful tool to control G4 topology while also disrupting the formation of other secondary structures, particularly the canonical duplex.

Modified application of interface screw in femoral side during anterior cruciate ligament reconstruction

To compare clinical effects of the improved interface screw fixation of femoral end of anterior cruciate ligament with classic femoral lateral loop plate fixation. A retrospective analysis of 65 patients who underwent arthroscopic anterior cruciate ligament reconstruction from January 2019 to September 2021 were performed. According to the different fixation methods of the femoral side, 35 patients were divided into loop plate fixation(loop plate group), including 27 males and 8 females, aged from 18 to 50 years old with an average of (35.00±7.60) years old;30 patients in interface screw fixation(interface screw group), including 20 males and 10 females, aged from 18 to 50 years old with an average of (32.00±8.50) years old. Hospital stay, hospital expenses, operation time, complications, C-reactive protein at 1, 3, 6 days after operation, and postoperative Lysholm score and International Knee Documentation Committee(IKDC) score at 18 months were compared between two groups. All patients were successfully operated, and obtained follow-up from 18 to 36 months with an average of (25.16±4.50) months. Anterior drawer test and Lachman test of all patients turned to negative. There were no statistical differences in hospital stay, hospital expenses and complications between two groups(P>0.05);operation time in loop plate group was (74.00±6.84) min, and (91.67±6.34) min in interface screw group, and had difference between two groups(P<0.05). C-reactive protein on the 1st and 3rd day after operation was (40.00±10.10), (20.00±8.23) mg·L-1 in loop plate group, and (60.00±8.93), (30.00±8.66) mg·L-1 in interface nail group, had statistical difference between two groups (P<0.05);while there was no difference in C-reactive protein on the 6th day after operation(P>0.05). At 18 months after operation, Lysholm and IKDC scores showed no significant difference between two groups (P>0.05). In loop plate group, medullary enlargement on coronal and sagittal views were (2.75±0.19) mm, (1.55±0.25) mm, and (2.81±0.22) mm, (1.61±0.20) mm in interface screw group, and had statistical difference between two groups(P<0.05). In the reconstruction of anterior cruciate ligament, the common interface screw on the femoral side is changed to the sheath interface screw, and intramedullary screw is changed to the compression and fixation of tendon from outside to inside of joint. Although the operation procedure is relatively complicated and operation time is slightly longer, it has advantages of no residual metal foreign body after operation, and clinical effect is no different from classical loop plate suspension fixation, which is still a good choice.

The anterolateral triangle as window on the foramen lacerum from transorbital corridor: anatomical study and technical nuances

ObjectiveNeurosurgical indications for the superior eyelid transorbital endoscopic approach (SETOA) are rapidly expanding over the last years. Nevertheless, as any new technique, a detailed knowledge of the anatomy of the surgical target area, the operative corridor, and the specific surgical landmark from this different perspective is required for a safest and successful surgery. Therefore, the aim of this study is to provide, through anatomical dissections, a detailed investigation of the surgical anatomy revealed by SETOA via anterolateral triangle of the middle cranial fossa. We also sought to define the relevant surgical landmarks of this operative corridor.MethodsEight embalmed and injected adult cadaveric specimens (16 sides) underwent dissection and exposure of the cavernous sinus and middle cranial fossa via superior eyelid endoscopic transorbital approach. The anterolateral triangle was opened and its content exposed. An extended endoscopic endonasal trans-clival approach (EEEA) with exposure of the cavernous sinus content and skeletonization of the paraclival and parasellar segments of the internal carotid artery (ICA) was also performed, and the anterolateral triangle was exposed. Measurements of the surface area of this triangle from both surgical corridors were calculated in three head specimens using coordinates of its borders under image-guide navigation.ResultsThe drilling of the anterolateral triangle via SETOA unfolds a space that can be divided by the course of the vidian nerve into two windows, a wider “supravidian” and a narrower “infravidian,” which reveal different anatomical corridors: a “medial supravidian” and a “lateral supravidian,” divided by the lacerum segment of the ICA, leading to the lower clivus, and to the medial aspect of the Meckel’s cave and terminal part of the horizontal petrous ICA, respectively. The infravidian corridor leads medially into the sphenoid sinus. The arithmetic means of the accessible surface area of the anterolateral triangle were 45.48 ± 3.31 and 42.32 ± 2.17 mm2 through transorbital approach and endonasal approach, respectively.ConclusionSETOA can be considered a minimally invasive route complementary to the extended endoscopic endonasal approach to the anteromedial aspect of the Meckel’s cave and the foramen lacerum. The lateral loop of the trigeminal nerve represents a reliable surgical landmark to localize the lacerum segment of the ICA from this corridor. Nevertheless, as any new technique, a learning curve is needed, and the clinical feasibility should be proven.

LAPAROSCOPIC COLORECTAL SURGERY: ANALYSIS OF THE FIRST OPERATIONS

The aim of the research: to analyze the initial experience of the introduction of laparoscopic technologies in the surgical treatment of patients with colorectal cancer (CRC).&#x0D; Materials and Methods. Our experience in performing laparoscopic operations includes 7 patients (3 men and 4 women) on CRC who underwent laparoscopic operations in the Ternopil Regional Clinical Hospital from December 2021 to July 2022. The mean age of patients was 64,42 ± 10,87 (range 46-75). All patients underwent preoperative 3D-CT angiography and vascular anatomy of the mesentery. 4 patients had previously undergone surgery and had a connective tissue laparoscopic viscerolysis. In 2 patients, the tumor grew into the lateral abdominal wall, pelvic lateral wall and loop of the small intestine, respectively, combined operations were performed. D3 lymphadenectomy was performed in 2 cases and D2 lymphadenectomy was performed in 5 cases. Stapler intracorporeal anastomosis was applied to 3 patients, manual extracorporeal anastomosis was applied to 3 patients. 3 patients receive adjuvant chemotherapy. Statistical analysis was performed using Statistica 64 software. Ordinal data were calculated using the median.&#x0D; Results. The average blood loss was 120±73,7 ml (range 40-250 ml). Intraoperative time was 242,86±45,44 minutes (interval 180-300 minutes). The average number of removed lymph nodes was 16,57 ± 8, (range 12-35). According to the TNM classification, stage T1 was detected in 1 patient, T2 -2, T3 - 3, T4a - 2, T4b – 1. Three patients were diagnosed with a high (G1) degree of adenocarcinoma differentiation, 2 patients were diagnosed with a moderate (G2) degree, while a low (G3) degree was diagnosed in 2 patients. Metastasis to regional lymph nodes were detected in 3 patients. In 3 cases, the macrodrug was removed through a 4-cm Pfanenstiel incision, in 2 cases through a 5-cm incision above the umbilicus, in 1 case through access in the left mesogastric area, where a sigmoid was later formed, and in 1 case through the perineum. We did not observe any cases of anastomosis leakage or 30-day mortality. In 1 patient the postoperative period was complicated by the development of pseudomembranous colitis. R0 resection was achieved in all patients. During the laparoscopic resection of the sigmoid colon in a patient with a T1 tumor, there were difficulties in locating the tumor, the situation was resolved by intraoperative colonoscopy. In the future, we plan to use the technique of endoscopic marking with the help of special stewed paints. The treatment of 3 patients at the pre- and postoperative stages was carried out according to the fast-track protocol, respectively, the patients were discharged from the hospital 3-4 days after the operation&#x0D; Conclusions. Laparoscopic surgery is safe and feasible for colorectal cancer and has resulted in improved short-term outcomes and equivalent oncological outcomes compared with open surgery, even in the setting of colon obstruction. Good selection of patients, preoperative 3D CT-angiography and management of patients according to the program of accelerated rehabilitation are the keys to reducing postoperative complications and faster recovery of patients.

The Subthalamic Nucleus: A Hub for Sensory Control via Short Three- Lateral Loop Connections with the Brainstem?

The subthalamic nucleus (STN) is classically subdivided into sensori-motor, associative and limbic regions, which is consistent with the involvement of this structure in not only motor control, but also in cognitive and emotional tasks. However, the function of the sensory inputs to the STN's sensori-motor territory is comparatively less well explored, although sensory responses have been reported in this structure. There is still a paucity of information regarding the characteristics of that subdivision and its potential functional role in basal ganglia processing and more widely in associated networks. In this perspective paper, we summarize the type of sensory stimuli that have been reported to activate the STN, and describe the complex sensory properties of the STN and its anatomical link to a sensory network involving the brainstem, characterized in our recent work. Analyzing the sensory input to the STN led us to suggest the existence of previously unreported threelateral subcortical loops between the basal ganglia and the brainstem which do not involve the cortex. Anatomically, these loops closely link the STN, the substantia nigra pars reticulata and various structures from the brainstem such as the superior colliculus and the parabrachial nucleus. We also discuss the potential role of the STN in the control of sensory activity in the brainstem and its possible contribution to favoring sensory habituation or sensitization over brainstem structures to optimize the best selection of action at a given time.

GaN-Based Multichip Half-Bridge Power Module Integrated on High-Voltage AlN Ceramic Substrate

Power electronic systems employing wide-bandgap GaN transistors promise high efficiency operation and power density but require minimized parasitic circuit elements and an effective cooling concept. This article presents a half-bridge module integrating two 600 V/170 mΩ gallium nitride (GaN) high-electron mobility transistors with their gate drive stages and a fraction of the dc-link capacitance on a patterned multilayer polycrystalline AlN-substrate. The high-voltage isolation at a layer distance of 10 μm and a dense chip-by-chip integration on the GaN half-bridge module enable a compact lateral commutation loop design combined with improved cooling capability of the power transistors. Consequently, the GaN half-bridge module allows for higher load currents at lower device temperature while most parasitic circuit elements are reduced compared to a conventional printed circuit board (PCB) design. The parasitic circuit elements of the GaN half-bridge module and a reference four-layer PCB half-bridge are evaluated using 3D-FEM field simulation and in-circuit measurements. Selected finite element method (FEM) simulation results are validated by <italic xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink">S</i> -parameter measurements and further used to parametrize a lumped commutation loop model. The thermal characterization of the GaN half-bridge module validates the improved cooling capability of the GaN half-bridge power module. Transient switching characteristics are studied in hard-switching mode. The device temperature and converter efficiency are evaluated in dc/dc buck-converter operation.

Guiding the folding of G-quadruplexes through loop residue interactions.

A G-rich sequence was designed to allow folding into either a stable parallel or hybrid-type topology. With the parent sequence featuring coexisting species, various related sequences with single and double mutations and with a shortened central propeller loop affected the topological equilibrium. Two simple modifications, likewise introduced separately to all sequences, were employed to lock folds into one of the topologies without noticeable structural alterations. The unique combination of sequence mutations, high-resolution NMR structural information, and the thermodynamic stability for both topological competitors identified critical loop residue interactions. In contrast to first loop residues, which are mostly disordered and exposed to solvent in both propeller and lateral loops bridging a narrow groove, the last loop residue in a lateral three-nucleotide loop is engaged in stabilizing stacking interactions. The propensity of single-nucleotide loops to favor all-parallel topologies by enforcing a propeller-like conformation of an additional longer loop is shown to result from their preference in linking two outer tetrads of the same tetrad polarity. Taken together, the present studies contribute to a better structural and thermodynamic understanding of delicate loop interactions in genomic and artificially designed quadruplexes, e.g. when employed as therapeutics or in other biotechnological applications.

Ruthenium Polypyridyl Complex Bound to a Unimolecular Chair-Form G-Quadruplex.

The DNA G-quadruplex is known for forming a range of topologies and for the observed lability of the assembly, consistent with its transient formation in live cells. The stabilization of a particular topology by a small molecule is of great importance for therapeutic applications. Here, we show that the ruthenium complex Λ-[Ru(phen)2(qdppz)]2+ displays enantiospecific G-quadruplex binding. It crystallized in 1:1 stoichiometry with a modified human telomeric G-quadruplex sequence, GGGTTAGGGTTAGGGTTTGGG (htel21T18), in an antiparallel chair topology, the first structurally characterized example of ligand binding to this topology. The lambda complex is bound in an intercalation cavity created by a terminal G-quartet and the central narrow lateral loop formed by T10–T11–A12. The two remaining wide lateral loops are linked through a third K+ ion at the other end of the G-quartet stack, which also coordinates three thymine residues. In a comparative ligand-binding study, we showed, using a Klenow fragment assay, that this complex is the strongest observed inhibitor of replication, both using the native human telomeric sequence and the modified sequence used in this work.

Lateral pelvic node dissection after neoadjuvant chemoradiation in rectal cancer with right internal iliac node metastasis but without regional node metastasis: A case report.

Introduction and importanceTotal mesorectal excision (TME) with lateral pelvic node dissection was routinely done in low clinical T3 rectal tumors below the peritoneal reflection as stated in the Japanese guidelines for colorectal cancer. Our institution follows the same practice in selected patients. This is our first reported case wherein a patient with rectal cancer underwent total mesorectal excision with lateral lymphadenectomy after neoadjuvant treatment with a positive lateral node on histopathology.Case presentationA 49 year old female rectal had rectal adenocarcinoma 4 cm FAV. Pelvic MRI revealed a low rectal tumor abutting the mesorectal fascia anteriorly, anal sphincters not involved, and confluent enlarged right iliac nodes. After neoadjuvant treatment, interval decrease in size of the rectal lesion and the right iliac nodes were noted. Patient underwent partial intersphincteric resection, lateral pelvic node dissection and protective loop ileostomy.Clinical discussionHistopathology revealed a rectal adenocarcinoma with one right internal iliac lymph node was positive for tumor involvement. Circumferential resection margin was 4.0 mm. Patient is currently on 4th cycle of adjuvant chemotherapy. Preoperative chemoradiation could not completely eradicate lateral pelvic node metastasis. Therefore, lateral pelvic node dissection should be considered if lateral pelvic lymph node metastasis is suspected even after neoadjuvant therapy.ConclusionUnlike TME, performance of a routine lateral lymphadenectomy in rectal cancer surgery varies by geographic location. Reports from Asian countries and our practice in our institution shows that it can be performed safely. This could improve the oncologic outcomes of patients especially if combined with neoadjuvant chemoradiotherapy.

Expanding the Topological Landscape by a G-Column Flip of a Parallel G-Quadruplex.

Canonical G‐quadruplexes can adopt a variety of different topologies depending on the arrangement of propeller, lateral, or diagonal loops connecting the four G‐columns. A novel intramolecular G‐quadruplex structure is derived through inversion of the last G‐tract of a three‐layered parallel fold, associated with the transition of a single propeller into a lateral loop. The resulting (3+1) hybrid fold features three syn⋅anti⋅anti⋅anti G‐tetrads with a 3’‐terminal all‐syn G‐column. Although the ability of forming a duplex stem‐loop between G‐tracts seems beneficial for a propeller‐to‐lateral loop rearrangement, unmodified G‐rich sequences resist folding into the new (3+1) topology. However, refolding can be driven by the incorporation of syn‐favoring guanosine analogues into positions of the fourth G‐stretch. The presented hybrid‐type G‐quadruplex structure as determined by NMR spectroscopy may provide for an additional scaffold in quadruplex‐based technologies.

3D‐Printed Multiband Absorber Based on Stereo Frequency Selective Structures

Multiband Absorber In article number 2000734 by Guangsheng Deng, Jun Yang, and co-workers, a multiband absorber based on three-dimensional (3D) frequency selective structures (FSSs) is presented. Four standing closed loops intersecting with a lateral split loop in each cell, as shown in the bottom of the picture, generate multi-band perfect electromagnetic wave absorption. The proposed structure, which is fabricated using 3D printing technology, also exhibits high incident wave absorption even at extreme wide angles for both transverse electric and transverse magnetic polarizations.

Observations of a prominence eruption and loop contraction

Context.Prominence eruptions provide key observations to understand the launch of coronal mass ejections as their cold plasma traces a part of the unstable magnetic configuration.Aims.We select a well observed case to derive observational constraints for eruption models.Methods.We analyze the prominence eruption and loop expansion and contraction observed on 02 March 2015 associated with a GOES M3.7 class flare (SOL2015-03-02T15:27) using the data from Atmospheric Imaging Assembly (AIA) and the Reuven Ramaty High Energy Solar Spectroscopic Imager (RHESSI). We study the prominence eruption and the evolution of loops using the time-distance techniques.Results.The source region is a decaying bipolar active region where magnetic flux cancellation is present for several days before the eruption. AIA observations locate the erupting prominence within a flux rope viewed along its local axis direction. We identify and quantify the motion of loops in contraction and expansion located on the side of the erupting flux rope. Finally, RHESSI hard X-ray observations identify the loop top and two foot-point sources.Conclusions.Both AIA and RHESSI observations support the standard model of eruptive flares. The contraction occurs 19 min after the start of the prominence eruption indicating that this contraction is not associated with the eruption driver. Rather, this prominence eruption is compatible with an unstable flux rope where the contraction and expansion of the lateral loop is the consequence of a side vortex developing after the flux rope is launched.

3D‐Printed Multiband Absorber Based on Stereo Frequency Selective Structures

A multiband absorber fabricated from stereo frequency selective structures (FSSs) is presented herein. The proposed absorber is composed of a lateral spilt loop intersected by four standing closed loops. The absorber exhibits pentaband electromagnetic (EM) wave absorption at normal incidence, as well as an angle‐dependent multiband absorption with high absorptivity at large incident angles (&gt;80°) for both transverse electric and transverse magnetic polarizations. The complicated structure, including the stereo resonators and dielectric substrate, is fabricated using one‐step forming method of multimaterial hybrid microdroplet jetting modeling (MHMJM) technology. The results suggest that this design strategy has great potential in constructing stereo FSSs with unique characteristics.

Molecular Recognition and Imaging of Human Telomeric G-Quadruplex DNA in Live Cells: A Systematic Advancement of Thiazole Orange Scaffold To Enhance Binding Specificity and Inhibition of Gene Expression.

A series of fluorescent ligands, which were systematically constructed from thiazole orange scaffold, was investigated for their interactions with G-quadruplex structures and antitumor activity. Among the ligands, compound 3 was identified to exhibit excellent specificity toward telomere G4-DNA over other nucleic acids. The affinity of 3-Htg24 was almost 5 times higher than that of double-stranded DNA and promoter G4-DNA. Interaction studies showed that 3 may bind to both G-tetrad and the lateral loop near the 5'-end. The intracellular colocalization with BG4 and competition studies with BRACO19 reveal that 3 may interact with G4-structures. Moreover, 3 reduces the telomere length and downregulates hTERC and hTERT mRNA expression in HeLa cells. The cytotoxicity of 3 against cancer cells (IC50 = 12.7-16.2 μM) was found to be generally higher than noncancer cells (IC50 = 52.3 μM). The findings may support that the ligand is telomere G4-DNA specific and may provide meaningful insights for anticancer drug design.

Author’s response to the letter “Is a big lateral loop of internal carotid artery rare and unique or well-known entity?”

Author’s response to the letter “Is a big lateral loop of internal carotid artery rare and unique or well-known entity?”

The Design of Optimal Lateral Motion Control of an UAV Using the Linear-Quadratic Optimization Method in the Complex Domain

The purpose of the paper is to investigate the approach to the Unmanned Aerial Vehicle (UAV) control system synthesis, based on linear-quadratic optimization methods. The paper considers the challenges of developing an optimal control system for UAV “dry” landing (without landing on a sea surface) on a non-aircraft carrier vessel. The purpose of the control system is to guide the UAV to the centerline of the landing strip. To achieve it, lateral movement commands are sent separately through the yaw control loop. In this case, the decoupling of the roll and yaw control loops is obtained as a result of structuring the control system. In this paper the structuring is carried out by transforming the structural diagrams of the UAV control system where the initial motion model of the UAV is non-linear. As a result, the linearization of this non-linear model is performed first. Then, the linearized model is represented in the complex domain in the form of a structural diagram with the corresponding transfer functions. The design of optimal lateral motion control of the UAV is carried out by using the linear-quadratic optimization method in the complex domain. Optimization is carried out separately for the yaw control loop (inner loop) and the lateral movement control loop (outer loop). A quadratic criterion in the form of restrictions on the control energy is used as an optimization criterion. The authors provide examples of system modeling in the article.

Recognizing the Ultrasound Patterns of Mesenteric Panniculitis.

Mesenteric panniculitis (MP) is a rare, benign, and nonspecific chronic fibrosing inflammation of the mesenteric adipose tissue. Abdominal pain is the most frequent presentation.The objective was to recognize ultrasound (US) features in MP. A retrospective 9-year review of computed tomography- (CT) or US-diagnosed cases of MP recorded in the radiology department was performed. The inclusion criteria included an US recorded in PACS imaging data base within 10 days before CT, to compare and evaluate the correlation of MP diagnosis.The prevalence of MP on CT was 2.8%. The 120 selected patients had an abdominal US 10 days before CT. Male-to-female ratio was 4:1. Fifty-three percent of MP was suggested by US. The US finding was increased volume with fatty mass in the mesentery root (98%). The fatty mesenteric mass had oval shape or convex anterior border in 94%, central abdominal location in 91%, and focal mesenteric increased echogenicity in 95%. Lateral bowel loop displacement was observed in 59%. Detection of lymph nodes was less frequent (55%).In conclusion, MP is an entity to be considered in the differential diagnosis of abdominal pain. Knowledge and recognition of the US findings of MP and central abdominal compression may improve detection during the abdominal US examination.