Large vWF Research Articles

Impact of extracorporeal membrane oxygenation treatments on acquired von Willebrand syndrome in patients with out-of-hospital cardiac arrest: a retrospective observational study

BackgroundVon Willebrand factor (vWF) plays a crucial role in hemostasis, acting as a key factor for platelet adhesion/aggregation and as a transport protein for coagulation factor VIII. vWF is secreted as a giant multimer, and it undergoes shear stress-dependent cleavage by a specific metalloproteinase in plasma. Among vWF multimers, high-molecular-weight (large) multimers are essential for hemostasis. Acquired von Willebrand syndrome, linked to various conditions, is a hemostatic disorder due to reduced vWF activity. Extracorporeal membrane oxygenation (ECMO), utilized recently for out-of-hospital cardiac arrest patients, generates high shear stress inside the pump. This stress may induce a conformational change in vWF, enhancing cleavage by a specific metalloproteinase and thereby reducing vWF activity. However, no study has investigated the effects of ECMO on vWF-related factors in patients receiving or not receiving ECMO. This study aimed to elucidate the relationship between ECMO treatment and acquired von Willebrand syndrome-related factors in patients with out-of-hospital cardiac arrest.MethodsThis study included patients with cardiogenic out-of-hospital cardiac arrest admitted to our hospital. The patients were categorized into two groups (ECMO and non-ECMO) based on the presence or absence of ECMO treatment. Plasma samples were collected from patients admitted to the emergency department (days 0–4). The vWF antigen (vWF: Ag), vWF ristocetin cofactor activity (vWF: RCo), and factor VIII activity were measured. Additionally, a large multimer of vWF was evaluated through vWF multimer analysis, utilizing western blotting to probe vWF under non-reducing conditions.ResultsThe ECMO and non-ECMO groups included 10 and 22 patients, respectively. The median ECMO treatment in the ECMO group was 64.6 h. No differences in vWF: Ag or factor VIII activity were observed between the two groups during the observation period. However, the ECMO group exhibited a decrease in large vWF multimers and vWF: RCo during ECMO. Strong correlations were observed between vWF: RCo and vWF: Ag in both groups, although the relationships were significantly different between the two groups.ConclusionsECMO treatment in patients with out-of-hospital cardiac arrest resulted in the loss of large vWF multimers and decreased vWF activity. Hence, decreased vWF activity should be considered as a cause of bleeding during ECMO management.

The 'scintilla' starting vaso-occlusion in sickle cell disease.

RBCEV SS RBC SS Reduced adhesion to endothelial cells# RBCEV AA RBC AA ADAMTS-13 is a metalloproteinase that cleaves von vWF and ultra large vWF. The importance of ADAMTS-13 is well known for conditions where vaso-occlusion occurs in microvessels, such as in thrombotic thrombocytopenic purpura (TTP). Similarly to hemopexin, the demonstration of a direct involvement of ADAMTS-13 in the adhesion process of SCD is relevant for potential therapeutical development. In fact, An Ran et al. showed that in the presence of hemopexin and ADAMTS-13, adhesion of sickle erythrocytes is returned to the level seen when normal erythrocytes are tested. The finding of an involvement of vWF in sickle cell adhesion suggests a role for anticoagulant proteins in SCD. This is also in keeping with similar findings of reduced naturally occurring anticoagulant (Protein C and Protein S) and vaso-occlusion in SCD.2, 10 In our opinion, this study has a strong scientific value, since it has been conducted in both in vitro and in vivo studies, in a mouse model with SCD. It will now be important to validate these findings in human trials, possibly in a large cohort of patients with SCD. If these findings were to be further corroborated, RBCEVs could potentially be used as a new parameter for monitoring SCD patients in a steady state and during SCD crises. RBCEV trials may possibly even predict SCD crises. Finally, the link between RBCEV, hemopexin and ADAMTS-13 offer an excellent target for the development of future treatment strategies for SCD.

Extracellular Vesicles from Sickle Red Blood Cells Activate Endothelial Cells and Trigger Von Willebrand Factor-Mediated Sickle Red Cell Adhesion

Introduction: The sickle mutation of hemoglobin (HbS) afflicts millions of people worldwide and is characterized by hemolytic anemia, inflammation, painful vaso-occlusive crises, significant morbidity, and early mortality. In sickle cell disease (SCD), HbS polymerization under deoxygenation increases red blood cell (RBC) rigidity, adhesivity and susceptibility to lysis. Products of intravascular hemolysis including heme and RBC-released extracellular vesicles (REVs) promote acute and chronic inflammation triggering endothelial activation and abnormal RBC adhesion. Extracellular vesicles (EVs) are nano- or micro-particles composed of a lipid bilayer, comprised of transmembrane proteins, and enclosing intracellular remnants, including cytosolic proteins and miRNAs. EVs are known to exchange biomaterial between cells, and may serve as surrogate markers for the activated state of the parent cell thus are of high clinical significance. Quantitatively, REVs are more abundant from sickle RBCs (SS RBCs) compared with normal HbA-containing RBCs (AA RBCs). SS REVs are known to promote endothelial cell (EC) activation through cell signaling and transcriptional regulation at longer terms. However, the SS REV-mediated short term non transcriptional response of EC is unclear. Methods: Here, we have developed the SCD-EV-BioChip using microfluidic technology. SCD-EV-BioChip assesses RBC adhesion as a biomarker for REV-mediated human pulmonary microvascular endothelial cells (HPMECs) dysfunction using functional biomarker of RBC adhesion. Utilizing SCD-EV-BioChip, Here, we examined the impact of SS REVs on acute microvascular EC activation and RBC adhesion at 2 hours. For in vitro studies, SS REVs and AA REVs were collected from pooled human SS RBCs and AA RBCs activated using calcium ionophore. The generated REVs were characterized using scanning electron microscopy (SEM) and nanoparticle tracking analyzer (NTA). HPMECs were cultured in microfluidic channels under controlled shear stress for more than 72 hours then treated with REVs at 37 ºC for 2 hours. Von Willebrand factor (vWF) expression on REVs-treated HPMECs were quantified. RBC adhesion tests were conducted with and without vWF protease ADAMTS13 and heme-binding protein hemopexin under shear stress at 1 dyne/cm2 followed by a rinse step and quantification of adhered RBCs. For in vivo study, HbSS-Townes mice and a dorsal skin-fold chamber model was used to determine if ADAMTS13 would reduce microvascular stasis in response to hemin. Results: Within 2 hours, SS REVs, but not AA REVs, promoted increased levels of vWF expression on HPMECs, indicating HPMEC activation (Fig. 1A-C). VWF is known to trigger SRBC adhesion and vaso-occlusion. Using SCD-EV-BioChip, we found significantly increased SS RBC adhesion to HPMECs exposed to SREVs, compared to SRBC adhesion to HPMECs exposed to AA REVs, and AA RBC adhesion to HPMECs exposed to SS REVs (Fig. 1D-G). SS RBC adhesion was significantly reduced on HPMECs treated with SS REVs pre-incubated with hemopexin. ADAMTS13 is a regulator which is responsible for cleaving ultra large vWF. In this study, SS RBC adhesion was significantly reduced by vWF cleaving protease ADAMTS13 to a level similar to HPMECs treated with AA REVs (Fig. 1G). Consistent with these observations, studies in SS mice with implanted dorsal skin-fold chambers found hemin-induced stasis was inhibited by ADAMTS13 (Fig. 1F). SRBC adhesion was variable within a total of 15 test subjects with SCD, and was higher with SRBCs from patients with increased markers of hemolysis (LDH and reticulocyte count) or a concomitant clinical diagnosis of deep vein thrombosis. Conclusions: This work demonstrated the acute, non-transcriptional contribution made by REVs to the microvascular EC activation and vWF-mediated SRBC adhesion. Results from SCD-EV-BioChip indicated the effect of hemopexin in mitigating SREV-mediated HPMEC activation. Additionally, results from in vitro SCD-EV BioChip tests agreed with in vivo stasis tests using SS mice, both of which indicated the effect of ADAMTS13 in mitigating SS RBC adhesion and vaso-occlusion. Figure 1View largeDownload PPTFigure 1View largeDownload PPT Close modal

A Rare Case of Mild COVID-19 Disease Associated with Type 1 Cryoglobulinemia and Thrombotic Thrombocytopenic Purpura

Introduction:Type I cryoglobulinemia (Type I CG) usually develops in the setting of protein-secreting monoclonal gammopathies [1,2]. The estimated frequency of renal involvement is 30% in Type 1 CG. Thrombotic Thrombocytopenic Purpura (TTP) is a life-threatening disease in which there is a deficiency in ADAMTS13, a protease which normally functions to cleave von Willebrand factor (vWF). A deficiency leads to persistence of large vWF multimers and the formation of platelet-rich thrombi in the microvasculature. We present a case of 52 years old female with Type 1 CG and acquired autoimmune TTP secondary to mild Covid-19 disease.Case Report:A 52-year-old woman with medical history significant for CKD stage 2, with baseline creatinine (Cr) of 2.5, Diffuse Large B-Cell Gastric Lymphoma (DLBCL), in complete remission, and recent diagnosis with COVID-19 presented to the ED for evaluation of three days of a petechial rash on her bilateral extremities. Significant labs on arrival included hemoglobin (Hgb) 8.9, platelet count 65, Cr of 3.65, and K+ 6.6, meeting criteria for acute kidney injury (AKI). Peripheral blood smear showedthrombocytopenia and normochromic normocytic anemia with no schistocytes or microangiopathic changes. ADAMTS13 was 43% and there was no clinical suspicion for TTP. The patient's Cr continued to worsen up to 8.1 during admission, prompting renal biopsy. Renal biopsy showed Type 1 cryoglobulinemic glomerulonephritis with vasculitis and 30 to 40% fibrosis of glomeruli. The patient was started on systemic steroids, plasma exchange every 2-3 day (completed 6 sessions) and hemodialysis. Her platelet counts steadily increased to 212 but had a significant drop to 32 when rechecked seven days later, prompting further investigation. ADAMTS13 was rechecked and found to be 5% with presence of inhibitor, Hgb was 7.7, haptoglobin was <20, and a diagnosis of TTP was made. The patient was started on daily plasmapheresis, rituximab, Caplacizumab and high dose systemic steroid therapy. Our patient had prior history of DLBCL and was treated with radiation therapy. Restaging PET/CT and EGD with biopsy showed no evidence of recurrence. Bone marrow biopsy was negative for evidence of lymphoma. Several serologic tests were used to rule out other etiologies of Type I CG and came back negative including: SLE, HIV, hepatitis C, multiple myeloma, and Waldenstrom's macroglobulinemia. The patient had elevations in multiple immune markers including IgG, IgM, free kappa light chains, and free lambda light chains. She also had hypocomplementemia of both C3 and C4.Discussion:The relationship of Type I CG and COVID-19 is unclear, though viral infections can trigger autoimmune diseases [3]. Previously, all patients with Type I CG had either ahematologic malignancy, solid-organ malignancy, infection, or autoimmune syndromes. Interestingly, in our patient, several serologic tests were performed and negative, which ruled out these etiologies of Type I CG. Our patient's manifestation of Type I CG was petechial rash on extremities and acute on chronic renal disease. Specific treatment of CG can include plasma exchange, corticosteroids, rituximab, and hemodialysis, depending on underlying cause. Our patient was started on systemic steroids, plasma exchange every 2-3 days, and hemodialysis due to worsening renal functions. Despite cases of covid-19 and TTP being reported, the relationship between the disease processes remains unclear. COVID-19 infection can cause disproportionate activation of the complement system and lead to excessive coagulation and thrombotic events. Systemic infection can decrease ADAMTS-13 activity, and this has also been noted in COVID studies. ADAMTS-13 deficiency has no pathophysiologic relevance specific to Type 1 CG. Our patient developed anemia and thrombocytopenia, and ADAMTS13 activity testing was found to be 5% with presence of an inhibitor. Considered as high-risk disease, our patient was started on steroids, rituximab, Caplacizumab and daily plasmapheresis. Repeated weekly ADAMTS13 level was 26% and platelets were stabilized at 69k/microL.Conclusion:Suggests that Covid-19 virus has the capability to induce cryoglobulinemia through an unknown mechanism• There are two other case reports of an association between Covid-19 and TTP.• May be the first case indicating a possible association of Covid-19 with cryoglobulinemia. DisclosuresNo relevant conflicts of interest to declare.

Backbone resonance assignments of the A2 domain of mouse von Willebrand factor.

von Willebrand factor (vWF) is an adhesive plasma protein that is important for platelet adhesion in normal hemostasis in response to vascular injury. Although large vWF multimers are released from storage granules of platelets and (sub-)endothelial cells in response to hemostatic stimuli, for normal physiological function, vWF multimers are required to be cleaved into smaller multimeric forms. The plasma metalloproteinase ADAMTS13 specifically cleaves the peptide bond located in the middle of the A2 domain of vWF (vWF-A2), but the cleavage site is buried inside the structure of vWF and is difficult to access in the absence of elevated flow shear stress. On the other hand, in the presence of high vascular shear stress, the structure of vWF-A2 is supposed to be unfolded, thereby becoming accessible for proteolysis by ADAMTS13. However, the atomic-level mechanism underlying shear-induced structural changes of vWF-A2 remains unclear and to date no solution NMR information is available. In this study, we present the backbone 1H, 13C, and 15N resonance assignments of mouse vWF-A2; side chain assignments of 13Cβ are also provided. Secondary structure propensity analysis based on the assigned chemical shifts showed that mouse vWF-A2 forms similar secondary structures in solution to the previously determined crystal structure of human vWF-A2. The obtained NMR assignment data will contribute to an atomic-level characterization of shear-induced unfolding of vWF-A2 in solution.

Platelet Factor 4 Binds to Released Von Willebrand Factor Strands from Injured Endothelium and Forms a Prothrombotic HIT Antigenic Complex

Heparin-induced thrombocytopenia (HIT) is driven by the binding of pathogenic HIT antibodies to platelet factor 4 (PF4) complexed to heparin. We, and others, have shown that PF4 bound to a variety of other polyanionic molecules, like surface glycosaminoglycans, also form HIT antigenic complexes. This is likely due to the formation of high molecular weight aggregates by the PF4. While studying the pathogenesis of HIT in a microfluidic system lined with human umbilical endothelial cells (HUVEC), we noted that PF4 did not bind diffusely to the HUVECs after a hematoporphyrin-induced photochemical injury as one would expect if binding were to the injured surface GAGs, but rather in a linear pattern described previously for von Willebrand Factor (vWF) under flow. We confirmed this by concurrent staining using PF4 and vWF-specific labeled antibodies. We also demonstrated that the HIT-like monoclonal antibody KKO, as well as IgG isolated from patients with likely HIT as determined by clinical assessment and ELISA positivity and positive serotonin release assay, bound to these PF4-vWF complexes. The HIT-like complexes were not uniformly distributed along the vWF, but occurred in a periodic fashion along thicker vWF strands. This suggested that the complexes were composed of multiple molecules of PF4 and vWF forming cross-chained high molecular weight aggregates that induce or enhance binding of HIT antibodies as previously reported for PF4/heparin in solution. We then wanted to identify the potential for therapeutics to intervene with PF4-vWF-KKO complex formation or stability. We tested this by introducing heparin; 2-0,3-0 desulfated heparin (ODSH); ADAMTS13 or n-acetylcysteine into channels post-complex formation. All interventions at therapeutically relevant concentrations were able to significantly remove or disrupt complex formation. When whole human blood + PF4 + KKO were flowed through channels lined with injured endothelium, large platelet aggregates developed within 10 mins along the extended strands of vWF. Significantly fewer platelet aggregates formed in the absence of PF4 or with KKO alone or PF4 plus an isotype control TRA. After 1 hour of flow, aggregates in the PF4 + KKO channels had grown significantly, but had largely disappeared in the other settings. Furthermore, by adding the FcgammaRIIA blocking antibody, IV.3, platelet binding could be reduced to background levels. These studies identify large vWF polymeric strands as a binding site for PF4 and a HIT antigen target. The Fc portions of the bound HIT antibody then contribute to platelet binding to the vWF. We are presently examining whether PF4-vWF-KKO aggregates contribute to thrombotic complications in HIT and defining the vWF domain(s) involved as these targets offer a potential novel intervention target in HIT. [Display omitted] DisclosuresCines:Amgen: Consultancy; Ionic: Consultancy; Juno: Consultancy; Astellas: Consultancy; T2 Biosystems: Research Funding; Rigel: Consultancy; Syntimmune: Research Funding.

The effects of streptokinase in a Chacma baboon (Papio ursinus) model of acquired thrombotic thrombocytopenic purpura

TTP is a life-threatening disorder with limited pharmaceutical treatment options. Recently, the potential of streptokinase in the treatment of acquired TTP was demonstrated in humans in vitro, and in vivo in a mouse model. We aimed to determine the in vitro and in vivo effects of streptokinase in an established Papio ursinus model of acquired TTP. In vitro: VWF activities & multimer patterns and thromboelastograms were assessed with increasing concentrations of streptokinase. In vivo: After induction of TTP, escalating streptokinase doses (ranging from 50,000 to 900,000IU) were administered, and the effects of streptokinase assessed on peripheral blood counts, fibrinolysis, VWF activities & multimer patterns and thromboelastograms. In an extension of the study, high-dose streptokinase (1,500,000-3,000,000IU) was administered to another baboon. After spiking, fibrinolysis with loss of large VWF multimers was observed at [2200IU/mL]-roughly equivalent to 1,500,000IU. However, administration of escalating intravenous streptokinase doses had no in vivo effect on the TTP phenotype, and in vivo increases in plasmin activity were mild when compared with baseline, even at high doses. Minimal effect on VWF multimer patterns was observed but only at doses ≥ 1500,000IU. Streptokinase is not effective in resolving TTP in a Papio ursinus model of TTP, possibly due to limited activation of the baboon fibrinolytic system. Modifications to this model, the use of alternative higher animal models, or alternative thrombolytics, should be considered to establish proof-of-concept.

Von Willebrand Factor Multimers and the Relaxation Response: A One-Year Study.

Background and aim: Mental stress represents a pivotal factor in cardiovascular diseases. The mechanism by which stress produces its deleterious ischemic effects is still under study but some of the most explored pathways are inflammation, endothelial function and balancing of the thrombotic state. In this scenario, von Willebrand factor (vWF) is a plasma glycoprotein best known for its crucial hemostatic role, also acting as key regulatory element of inflammation, being released by the activated vascular endothelium. Antistress techniques seem to be able to slow down inflammation. As we have recently verified how the practice of the Relaxation Response (RR), which counteracts psychological stress, causes favorable changes in some inflammatory genes’ expressions, neurotransmitters, hormones, cytokines and inflammatory circulating microRNAs with coronary endothelial function improvement, we aimed to verify a possible change even in serum levels of vWF. Experimental procedure: We measured vWF multimers and the total protein carbonyl contents in the sera of 90 patients with ischemic heart disease (and 30 healthy controls) immediately before and after an RR session, three times (baseline, 6 months, 12 months), during a one-year follow-up study. Results: According to our data, large vWF multimers decrease during the RR, as does the plasma total carbonyl content. Conclusion: vWF levels seem to vary rapidly between anti-inflammatory and antithrombotic behaviors dependent on psychological activity, leading to relaxation and also possibly changes in its quaternary structure.

Caplacizumab As New Paradigm-Changing Therapy for Patients with Autoimmune Thrombotic Thrombocytopenic Purpura (aTTP): Real-World Data from TTP Spanish Registry

Introduction: Autoimmune thrombotic thrombocytopenic purpura (aTTP) is a severe disease caused by the production of autoantibodies against von Willebrand factor (vWF)-cleaving ADAMTS13 (a disintegrin and metalloproteinase with thrombospondin-1 motifs; 13th member of the family). Without functional ADAMTS13, endothelial cells-derived unusually large vWF (ULVWF) multimers are present and are responsible for platelet clumping in the microvasculature. Plasma exchange (PE) and immunosuppressive therapy with steroids and rituximab are the milestones of the treatment of this disease. Moreover, in 2018, nanobody caplacizumab was approved for the treatment of adult patients with an acute episode of aTTP. Our objective was to retrospectively review the efficacy and safety of the current use of caplacizumab in Spain. Methods: We collected demographic, clinical, and laboratory data of patients with aTTP who were reported in the TTP Spanish Registry from 15 centres between July 2018 and July 2020. All patients were diagnosed with aTTP because of the presence of microangiopathic hemolytic anemia (MAHA), thrombocytopenia, organ dysfunction, ADAMTS13 activity less than 5% and the presence of ADAMTS13 autoantibodies. Qualitative data are presented as number (frequencies). Quantitative data are presented as mean ± standard deviation (SD) or median (interquartile range -IQR-) when appropriate. A correlation test was performed to determine the linear relationship between number of days since diagnosis to caplacizumab start and number of days since diagnosis to the first day with &amp;gt;150x109/L platelets. Results: Our series comprises 30 patients: 22 (73%) females and 8 (27%) males with a median age of 45 (IQR: 31-55). At presentation, neurologic abnormalities were seen in 18 (60%) patients, symptoms and signs of anemia were present in 15 (50%) patients, and bleeding was present in 10 (33%) patients. Fever was present in 1 (3%) patient. Laboratory tests showed hemoglobin 92±28 g/L, platelet count 19±16 x109/L, unconjugated bilirubin 2.33±1.76 mg/dL, LDH 1,467±1,428 IU/L, and creatinine 1.0±0.45 mg/dL. Median ADAMTS13 activity was 0 (IQR: 0-0.5) and ADAMTS13 autoantibodies were positive in all cases. After diagnosis, treatment was started with PE and steroids in all patients after a median of 0 days (IQR: 0-0) and patients received a median of 10 PE procedures (IQR: 7-13). Caplacizumab was administered to all patients with a median of 3 (IQR: 1-9) days after diagnosis and it was administered during 36 days (IQR: 31-39). No severe adverse events were reported with the use of caplacizumab. Rituximab was added in 19 (63%) patients after a median of 4 days (IQR: 14-21). Time to platelet normalization (&amp;gt;150x109/L) was 5.5 days (IQR: 4-17) after diagnosis. The longer the delay in administering caplacizumab after diagnosis, the longer the delay in platelet normalization (Pearson's correlation coefficient, r=0.94 (95% CI: 0.86 to 0.98; R2=0.89; p&amp;lt;0.01; figure 1). Clinical remission was achieved in 29 (97%) patients after a median of 8 days (IQR: 4-14). One (3%) patient died because of aTTP complications 11 days after diagnosis. One patient was refractory to PE, steroids, rituximab, caplacizumab, and she achieved clinical remission after receiving vincristine and cyclophosphamide. Conclusion: Caplacizumab was an efficacious and safe drug to treat adult patients with acute episodes of aTTP. A statistically significant strong positive linear correlation was observed between number of days from diagnosis to caplacizumab start and number of days from diagnosis to the first day with &amp;gt;150x109/L platelets. Disclosures No relevant conflicts of interest to declare.

Acquired von Willebrand Syndrome in left Impella supported cardiogenic shock patients

Abstract Background Bleeding is a main cause of morbidity and mortality in critically ill cardiogenic shock patients, supported by short-term percutaneous mechanical circulatory support (pMCS) devices. Bleeding not only occurs because of obligatory heparin and antiplatelet therapy (both required in the prevention of pump and stent thrombosis) but possibly also results from device-related coagulopathy. Similar to long-term ventricular assist devices, mechanical shear-induced acquired von Willebrand syndrome (AVWS) might further increase the bleeding risk. Therefore, we aimed to investigate the effect of left Impella percutaneous continuous flow pumps on the development of AVWS due to shear-induced excessive cleavage of large vWF multimers by the metalloproteinase ADAMTS-13, resulting in loss of high-molecular-weight vWF multimers. Methods Between March 2019 and January 2020, all cardiogenic shock patients supported by a left Impella and referred to a single tertiary ICU were studied. Both vWF Antigen (vWF:Ag) and vWF:GPIbR (ristocetin-induced binding of vWF to a recombinant wildtype Glycoprotein Ib fragment) levels were measured by chemiluminescent immunoassays using an AcuStar (Werfen) assay to determine the vWF:GPIbR /vWF:Ag ratio (normal range ≥1.0). VWF multimer analysis was performed by electrophoresis. On-pump analyses were performed 12h after implantation and off-pump analyses 12h after Impella explantation. Patients who died on-pump were excluded because of lack of paired data after explantation. Results Eight left Impella patients (four Impella CP, four Impella 5.0) were analyzed for AVWS. The vWF:GPIbR /vWF:Ag ratio was &amp;lt;1.0 in all patients on-pump (mean±SD 0.68±0.1 versus 1.1±0.15 off-pump (panel A; p=0.0018)) and thus AVWS was detected in all Impella-supported patients. The presence of AVSW was also confirmed by loss of large vWF multimers on-pump (panel B). Four patients (50%) had mucosal bleeds (epistaxis or gastrointestinal), none of them requiring transfusion. The mean rise in ratio 12h after pump removal was 0.35 which was also reflected by recovery of large multimers by electrophoresis (panel B). Conclusions Our data highlight the rapid onset and reversal of AVWS in all studied cardiogenic shock patients, supported by a left Impella pump. The determination of the GPIbR /vWF:Ag ratio with the AcuStar appears a reliable and faster test to detect AVWS as compared to vWF multimers electrophoresis. Further research into innovative pharmacological interventions (e.g. ADAMTS-13 inhibitors) should target pMCS-induced AVWS in an effort to reduce hemostatic complications in this critically ill ICU population. AVWS in Impella supported patients Funding Acknowledgement Type of funding source: None

Assessment and Monitoring of Patients with Immune-Mediated Thrombotic Thrombocytopenic Purpura (iTTP): Strategies to Improve Outcomes.

BackgroundAcquired or immune-mediated TTP (iTTP) is a life-threatening thrombotic microangiopathy, characterized by the presence of microangiopathic hemolytic anemia and severe thrombocytopenia, and a variable degree of ischemic organ damage, related to a severe deficiency of ADAMTS13, which is a serine metalloprotease necessary for cleavage of large vWF multimers. There has been a dramatic decrease in mortality rates with the recognition of the pathophysiology of iTTP over the years. Although therapeutic plasma exchange (TPE) together with corticosteroids are the backbone of the upfront treatment of patients with iTTP with successful outcomes, patients may remain refractory and/or relapse following an initial response to this treatment.MethodsWe performed a review regarding the pathogenesis, diagnosis, treatment strategies, monitoring, and prognosis of iTTP.ResultsThere are several new treatment strategies, which can be used among these patients, helping in improving outcomes of iTTP. Rituximab has been shown to be a safe and effective adjunct to TPE, especially in patients with refractory and/or relapse as well as it is increasingly used preemptively to prevent exacerbation or recurrence. Recently, caplacizumab, a nanobody targeting vWF, was approved as an addition to the current regimen of TPE and immunomodulation for patients of iTTP.ConclusionSpecific predictors of relapse in patients in remission can be relevant for an optimal patient management. Different models including ADAMTS13 biomarkers can provide a new screening strategy to identify patients who may predict outcomes and the risk of relapse, benefit from preemptive therapy prior to relapse.

Does Outcome/Survival of Patients With Myelodysplastic Syndromes Should Be Predicted by Reduced Levels of ADAMTS-13? Results From a Pilot Study

IntroductionVon Willebrand factor (vWF) cleaving protease ADAMTS-13 has a key role for maintaining normal size of vWF. A deficiency or dysfunction of vWF cleaving protease is associated with ultra large vWF multimers and thrombotic microangiopathy. Patients with cancers have reduced levels of vWF cleaving protease. In this pilot study, we have evaluated whether or not deficiencies of ADAMTS-13 were present in myelodysplastic syndromes (MDS). Moreover, we assessed if a reduction in basal levels of ADAMTS-13 may play a role in the prognosis of MDS. Patients and MethodsWe measured and compared the levels of vWF cleaving protease ADAMTS-13 in 100 patients with MDS and 35 healthy controls. Patients were divided into 2 groups according to the International Prognostic Scoring System: group I consisting of 44 patients with low-risk MDS and group II of 56 patients with high-risk MDS. Patients with high-risk and low-risk MDS presented significantly lower levels of ADAMTS-13 than controls (P < .001 and P = .0177, respectively). High-risk patients had significantly lower levels of ADAMTS-13 when compared with the low-risk group (P < .001). ResultsWe found that reduced levels of ADAMTS-13 have a relationship with overall survival (P < .001). Statistical analysis showed that ADAMTS-13 correlates with cytogenetics (P < .001) and a tendency of slight correlation with platelet count and basal levels of ADAMTS-13 (R, 0.35; P value, 0.001). Moreover, we found that levels of ADAMTS-13 have correlation with response to treatment (P < .001). ConclusionsADAMTS-13 in MDS might represent a surrogate marker of prognosis, response to therapy, or disease progression. Further studies are needed.

Identification of Thrombospondin-1 As a Novel Substrate of Cereblon Responsible for IMiDs-Induced Venous Thromboembolism

Immunomodulatory drugs (IMiDs) such as lenalidomide and pomalidomide, are key drugs for the treatment of multiple myeloma (MM) and myelodysplastic syndrome(MDS) with chromosome 5q deletion[del(5q)].IMiDs modulate the ubiquitination of intracellular proteins by E3 ubiquitin ligase and alter the stability of target proteins via proteasomal degradation. IMiDs directly bind to cereblon (CRBN), a substrate receptor for the E3 ubiquitin ligase complex, and retarget the enzyme complex toward neo-substrates such as IKAROS family zinc finger 1/3 (IKZF1/3) and casein kinase 1α (CK1α) in MM and MDS with del(5q), respectively, which underlies their clinical efficacy in these disorders. Thus, the identification of cell specific neo-substrates should be a critical step to understand IMiDs-mediated pleiotropic effects. Clinically, IMiDs cause venous thromboembolism (VTE); however, the molecular machineries how IMiDs increase the risk of VTE still remains elusive. We, therefore, hypothesized that there is an unknown substrate for CRBN that induces thrombosis in megakaryocytes and platelets. To identify possible molecules that could interact with CRBN in human megakaryocytes, we performed screening analysis. Human CD34+hematopoietic stem/progenitor cells (HSPCs) from cord blood were cultured in a serum-free megakaryocytic condition for 7 days as previously reported. Most of the CD34+HSPCs were differentiated into CD41+CD42b+mature megakaryocytes, and we extracted human megakaryocytic protein. Cellular lysates from CD34+HSPCs-derived megakaryocytes and FLAG-tagged CRBN-overexpressing HEK293T cells were mixed with or without lenalidomide. CRBN-binding proteins were subsequently pulled down using anti-FLAG antibody, and subjected to mass spectrometry analysis. Mass spectrometry analysis revealed that THBS1 was coimmunoprecipitated with CRBN, and its interaction was decreased in the presence of lenalidomide. We therefore hypothesized that THBS1 could be a neo-substrate for CRBN. Consistent with the screening results, we found that IMiDs increased THBS1 protein in Meg-01 cells, a human megakaryoblastic leukemia cell line in a dose and time dependent manner, without affecting mRNA level. Proteasome inhibitor increased THBS1 level in Meg-01 cells, suggesting that THBS1 should be physiologically degraded via proteasome. The immunoprecipitation experiments showed CRBN and THBS1 conjugation, which was inhibited in the presence of Lenalidomide in vitro. Furthermore, we confirmed an increase in THBS1 protein level in the bone marrow and plasma of MM patients treated with IMiDs-containing regimen, suggesting that IMiDs actually induce the accumulation of THBS1 in vivo. These results collectively suggest that THBS1 is a neo-substrate for CRBN and IMiDs induces the accumulation of THBS1 through the inhibition of proteasomal THBS1 degradation in human. THBS1 is reported to competitively inhibit ADAMTS13 activity of von Willebrand Factor (vWF) multimer cleavage, leading to increased level of large vWF multimers. Since large vWF multimers promote thrombus formation and several studies showed increased plasma level of THBS1 correlates with the incidence of VTE, we tested whether the accumulation of THBS1 induced by IMiDs treatment could affect the size of vWF multimer in MM patients. vWF multimer analysis revealed the large vWF multimers increased in plasma of MM patients undergoing IMiDs treatment. These results collectively suggest that IMiDs-induced accumulation of THBS1 should be one of the molecular machineries for IMiDs-induced VTE in human. Disclosures Akashi: Celgene, Kyowa Kirin, Astellas, Shionogi, Asahi Kasei, Chugai, Bristol-Myers Squibb: Research Funding; Sumitomo Dainippon, Kyowa Kirin: Consultancy.

Prolonged Circulation of Ultra-Large Von Willebrand Factor and a Reduction in ADAMTS13 Activity Promotes Microvascular Disease Following Traumatic Injury

Introduction: Increases in plasma von Willebrand Factor (vWF) levels, accompanied by decreases in its respective metalloprotease, ADAMTS13, have been demonstrated in diseases of microvascular injury. We hypothesized that following severe trauma, a burst of ultra-large vWF (UL-vWF) is released into the bloodstream by damaged endothelium, resulting in increased thrombogenicity due to circulating vWF multimers. We further hypothesized that traumatic injury would lead to a deficit of ADAMTS13, promoting the accumulation of UL-vWF forms and, ultimately, the increased risk of microvascular disease, such as acute kidney injury (AKI). Methods: A cohort of 37 severely injured trauma patients was analyzed for antigen levels of plasma vWF and ADAMTS13 at 0- and 24-hours after admission. Circulating vWF multimeric composition from both time points was determined by vertical agarose gel electrophoresis. Multivariate analyses were performed with data abstracted from the electronic medical records to identify further dependences. A similar analysis was also performed on plasma from a cohort of 8 patients with trauma induced AKI at 0-, 24-, and 72-hours after admission; these patients were well matched against trauma patients without AKI. Finally, we utilized a murine model of polytrauma and hemorrhage, in conjunction with qRT-PCR of ADAMTS13 in total liver RNA, to specifically address how the expression of ADAMTS13 is altered by the systemic effects of traumatic injury. Results: Circulating vWF levels were increased in severe trauma patients when compared to healthy controls at presentation (189% (110-263) vs. 95% (74-120)) and persisted through 24-hours (213% (146-257) vs. 132% (57-160)). Ultra-large vWF forms were elevated at both 0- and 24-hours when compared to pooled normal plasma ((10.0% (8.9-14.3) and 11.3% (9.1-21.2), respectively, vs 0.6%). The largest vWF forms within trauma patient plasma circulated at 33±4 dimers vs 18±1 dimer in length within pooled normal plasma. Severe trauma patient ADAMTS13 activity was decreased at 0-hours (66% (47-86) vs. 100% (98-100)) and at 24-hours (72.5% (56-87.3) vs 103% (103-103)) when compared to healthy patients. Furthermore, the proportion of circulating low molecular weight multimeric (LMWM) vWF to total circulating vWF forms was directly dependent upon ADAMTS13 activity at 24-hours (Decreased ADAMTS13 Activity: 20.4% (15.0-22.7) LMWM vWF vs Normal Activity: 25.8% (22.7-35.2) LMWM vWF). Strikingly, ADAMTS13 activity independently predicted the development of coagulopathy, correlating with presentation INR (ρ =-0.63), activated clotting time of thromboelastography (TEG) (ρ=-0.36), and TEG maximum amplitude (ρ=0.36). ADAMTS13 activity also closely correlated with injury severity (ISS) (ρ=-0.34) and blood product transfusion (ρ =-.45). The cohort of 8 trauma patients who went on to develop AKI showed a 1.54-fold (1.02-2.05) increase in plasma vWF antigen levels between 0 and 72 hours, while those who did not develop AKI showed no change in vWF levels over this time period. Furthermore, those who developed AKI demonstrated a smaller proportion of LMWM vWF in plasma than those who did not (25.4% (23.4-28.0) vs 31.2% (27.2-35.6)), suggesting the increased thrombogenicity of their circulating vWF forms. Finally, qRT-PCR of total liver RNA in 6 mice demonstrated a 2-fold decrease in ADAMTS13 RNA expression levels between the times immediately before and 24-hours after trauma. Altogether, these data indicate that both circulating ADAMTS13 and its production are deficient in the days following severe injury. Conclusions: Severe traumatic injury alters the circulating composition of ADAMTS13 and its target, vWF, shifting their equilibrium to one that promotes thrombosis. Not only is the concentration of circulating ADAMTS13 decreased following traumatic injury, but hepatic expression of the enzyme is lacking as well. In the immediate moments following injury, these mechanisms contribute to life-saving hemostasis; however, as these changes extend into the following days, the early hemostatic benefit quickly shifts to burden that may exacerbate microvascular disease. Disclosures Ragni: Bioverativ/Sanofi: Consultancy, Research Funding; Sangamo: Research Funding; Shire/Takeda: Consultancy, Other: Study drug; Alnylam/Sanofi: Consultancy, Research Funding; Bayer: Consultancy; Spark Therapeutics: Consultancy, Research Funding; ICER: Consultancy; OPKO: Research Funding; Biomarin: Consultancy, Research Funding. Rollins-Raval:Bayer, Inc: Membership on an entity's Board of Directors or advisory committees. Raval:Sanofi: Membership on an entity's Board of Directors or advisory committees; Bayer, Inc: Research Funding. Neal:Janssen Pharmaceuticals: Consultancy, Membership on an entity's Board of Directors or advisory committees; CSL Behring: Membership on an entity's Board of Directors or advisory committees.

Ischaemia–reperfusion injury with Pringle's maneuver induces unusually large von Willebrand factor multimers after hepatectomy

Introductionvon Willebrand factor (VWF) is synthesised in vascular endothelial cells and released into the plasma as unusually large VWF multimers (UL-VWFMs). Sinusoidal endothelial cells are a major target of ischaemia–reperfusion injury due to liver surgery. This study aimed to clarify the effect of hepatectomy on UL-VWFMs. Materials and methodsThirty-five patients who underwent hepatectomy were eligible for the study. Plasma ADAMTS13 activity and VWF antigen levels were measured by enzyme-linked immunosorbent assay and multimer analysis of plasma VWF was performed according to Ruggeri and Zimmerman's method. For analyses, patients were categorised according to UL-VWFM positivity after hepatectomy. ResultsPlasma ADAMTS13 activity significantly decreased from 61.0% (27.7%–126.2%) before operation to 37.4% (20.2%–71.4%) on postoperative day 7 (p < 0.001). Plasma VWF antigen levels significantly increased from 172.1% (80.5%–412.8%) before operation to 361.0% (154.7%–745.8%) on postoperative day 2, which remained high until postoperative day 7 (p < 0.001). Seven patients remained UL-VWFMs-negative and 22 patients became UL-VWFMs-positive after operation. Pringle's maneuver duration was significantly longer and blood loss volume was significantly higher in the UL-VWFMs-positive group (p = 0.001 and p = 0.003, respectively). By multivariable analysis, Pringle's maneuver duration [odds ratio 1.049, 95% confidence interval (CI) 1.001–1.098; p = 0.043] was significantly associated with increased UL-VWFMs level after hepatectomy. UL-VWFMs index was significantly correlated with Pringle's maneuver duration (r = 0.444, p = 0.017). ConclusionsPlasma UL-VWFMs levels increased after hepatectomy due to ischaemia–reperfusion injury with Pringle's maneuver.

Active and Ultra-Large Von Willebrand Factor Is Significantly Elevated in Patients with Immune Thrombotic Thrombocytopenic Purpura

▪Background: Immune thrombotic thrombocytopenic purpura (iTTP), a potentially fatal hematological emergency, is primarily caused by acquired deficiency of ADAMTS13 activity due to autoantibodies. Immunoglobulin G (IgG)-type autoantibodies bind ADAMTS13 and inhibit its ability to cleave endothelium-derived ultra large von Willebrand factor (ULVWF). However, it remains poorly understood whether plasma VWF status can be used as a disease marker for diagnosis and monitoring therapy in patients with acute iTTP.Objective: To address this question, we determined plasma levels of VWF antigen (VWF:Ag), collagen-binding activity (VWF:CB), active forms of VWF (VWF:Ac), and VWF multimers in iTTP patients during acute episode and in early remission.Patients and Methods: From the Alabama registry, we identified 69 unique patients with a confirmed diagnosis of iTTP in whom plasma ADAMTS13 activity was <10 U/dL with positive inhibitors and elevated anti-ADAMTS13 IgGs. Of 69 patients, 21 had longitudinal plasma samples collected. Plasma samples from 56 healthy individuals, who did not have a hematological disease, cancer, and infection, were recruited as controls. Plasma levels of VWF:Ag, VWF:CB, and VWF:Ac were determined by an ELISA-based assay. Plasma VWF multimer distribution was assessed by an in-gel Western blotting assay following electrophoresis on a 1% SDS-agarose gel.Results: The mean age for our cohort iTTP patients was 43.9 ± 13.4 years. Twenty-six patients were male and 43 were female with male to female ratio of 1 to 1.7. Fifty-three patients were African American descents, 14 Caucasians, 1 Hispanic, and 1 unknown race. Plasma levels of VWF:Ag in acute iTTP patients were 289.4 ± 17.7%, significantly increased compared with those in the healthy controls (144.9 ± 7.6%) (p<0.0001); plasma levels of VWF:CB in these patients were 241 ± 17.9%, also significantly elevated compared with those in the healthy controls (149.9 ± 12.01%) (p=0.0001); additionally, plasma levels of VWF:Ac (304.6 ± 23.2%), assessed by its ability to bind anti-VWF-A1 nanobody, were more dramatically elevated compared with those in the controls (101.6 ± 5.9%) (p<0.0001). More interestingly, while the ratios of VWF:CB to VWF:Ag in patients with acute iTTP (0.8 ± 0.04) were lower than those in the healthy controls (1.0 ± 0.05) (p=0.0036), the ratios of VWF:Ac to VWF:Ag were significantly higher in patients with acute episode (1.2 ± 0.1) than those in the controls (0.8 ± 0.05) (p=0.0003). Furthermore, there was no statistically significant difference in the patient plasma levels of VWF:Ag (p=0.69) and VWF:CB (p=0.08) during acute episode and during early remission. However, the plasma levels of VWF:Ac in patients with acute disease were significantly higher than those in the early remission (p=0.002). Surprisingly, 90% (36/40) of out iTTP patients during acute episode showed the presence of ULVWF in their plasma using in-gel Western blotting, which allows the ULVWF to be detected without the transfer step to avoid any potential loss of larger VWF multimers during protein transfer. These ULVWF multimers disappeared in 3/4 iTTP patients in remission when ADAMTS13 activity recovered. In 28 healthy control samples, only one showed ULVWF.Conclusion: Our results demonstrate, for the first time in a large cohort, that active forms of VWF and ultra large VWF multimers are present in iTTP patient's plasma during the acute period, which is reduced or disappears during the early remission. Therefore, measuring active forms of VWF and ultra large VWF multimers may aid in diagnosis of iTTP and help monitoring of disease processes following therapy. Our ongoing study is to determine whether these biomarkers can be used to predict responses to treatment and long-term outcome. DisclosuresZheng:Alexion: Research Funding, Speakers Bureau.

Variable Clinical Presentation of Congenital Thrombotic Thrombocytopenic Purpura in a Large Cohort of Patients Carrying a New Mutation in the CUB1 Domain of ADAMTS13 Gene

Introduction:Congenital TTP (Thrombotic Thrombocytopenic Purpura) is a rare life-threatening inherited disorder, resulted from mutations in ADAMTS13 gene. Such mutations interfere with ADAMTS13 enzyme production or function, subsequently resulting in microangiopathic hemolytic anemia (MAHA) and microvascular thrombosis. The investigation of congenital TTP is challenging because of its rarity with an estimated prevalence ranging from 0.4 to 16.7 cases per million and about 150 identified mutations. Recently, we identified a cohort of patients with congenital TTP from three consanguineous families of Arab Bedouin origin in southern Israel. All patients have the same, previously unidentified mutation c.3772 delA in the ADAMTS13 gene. In this single center prospective cohort study, we present patients' genetic, clinical and laboratory data and results of the abnormal ADAMTS13 protein Western blot analysis.Methods:Patients with episodes of MAHA and thrombocytopenia were diagnosed with congenital TTP by abnormally low ADAMTS13 activity and absence of inhibitory autoantibodies (Table 1). Subsequently, patients were referred for genetic testing. Patients' DNA served for PCR amplification of the exons of ADAMTS13 (NM_139026) followed by direct sequencing of the PCR products. The mutation was found in exon 28, the primers used for PCR were forward: atgtccctatgtcccacctg and reverse: ctgtccagaatcacagcacaa (annealing temperature 61°C).Western blot analysis of the abnormal ADAMTS13 protein was performed according to the method previously described by Zheng et al, using antihuman ADAMTS13 rabbit polyclonal antibody (ab28274; Abcam, Cambridge, UK).Patients' clinical and laboratory parameters were collected at diagnosis and during follow-up.The study was approved by the institutional research ethics board.Results:We identified a novel mutation on chromosome 9:136323172del A (GRCh37/hg19) in coding exon 28, c.3772 del A (NM_139026), causing p.N1258T fs Ter 15 of ADAMTS13 gene close to the C-terminus of the 1427-amino acid long protein (Fig.1). We validated that all patients in our cohort are homozygous for the mutation. The mutation is found within the CUB1 domain and the frameshift is predicted to result in the loss of the next 169 highly conserved amino acids of the full-length protein that contains the CUB2 domain, normally responsible for cleavage of large VWF multimers under flow conditions.Our Western blot analysis of the abnormal protein (Fig. 2) demonstrates that a 170-190 Kd band is missing in plasma of five patients, compared to four controls. These results suggest that the mutation may interfere with the entire enzyme production.The cohort consists of 17 homozygotic patients (3 males and 14 females), all belong to three closely related families of Arab Bedouin descent with high rate of consanguinity. All 17 patients in this cohort have blood group A. This finding may represent genetic linkage disequilibrium between the ADAMTS13 gene and the transferase gene, both found on chromosome 9 in close proximity.Despite the fact that all the patients are homozygous for the same mutation and belong to three closely related families, their presenting symptoms and disease severity were markedly heterogenous (Table 1): eight of 14 female patients initially presented with complications of pregnancy, two presented with laboratory abnormalities, two presented with stroke and two asymptomatic female patients were recognized on family screening. Of three male patients, one presented with Budd-Chiari syndrome, one had laboratory abnormalities alone and one developed a stroke.Conclusion:To the best of our knowledge, this is one of the largest congenital TTP cohorts described in the literature. This cohort is unique due to the fact that all members carry the same, previously unreported, ADAMTS13 gene mutation in the CUB1 domain of the gene. Our findings support an assumption that environmental and hereditary modifiers may influence disease course. Further research of the involved families may enable us to expand the understanding of the pathophysiology and develop better treatment options for this understudied rare condition. [Display omitted] DisclosuresNo relevant conflicts of interest to declare.

The elusive and heterogeneous pattern of type 2M von Willebrand disease: A diagnostic challenge.

To investigate type 2M heterogeneity and to establish the most appropriate diagnostic flowchart. Hemostatic and genetic VWF analyses were performed in 14 type 2M VWD patients carrying the p.G1324S, p.R1374H, p.R1374C, p.A1344_A1350del, or p.F1293L mutations. PFA-100 was always significantly prolonged, and ristocetin-induced platelet aggregation (RIPA) and VWF ristocetin cofactor (VWF:RCo) greatly reduced or absent. Plasma VWF antigen (VWF:Ag) was reduced except in the p.G1324S patient, while platelet VWF:Ag was normal or near normal except in the p.R1374C patients. The ratio of collagen binding (VWF:CB) to VWF:Ag was normal or near normal except in patients carrying the p.R1374H and p.A1344_A1350del mutations, whose large VWF multimers were slightly reduced. Multimer patterns were normal or lacking in large oligomers, or with larger than normal VWF components. Only PFA100, RIPA and VWF:RCo were always abnormal. We thus propose a minimal diagnostic test battery: RIPA (demonstrating the defective VWF-platelet interaction), VWF:Ag (exploring VWF synthesis), and VWF:CB and its ratio (to explore multimer patterns). Other tests would only serve for confirmation, if necessary.

VWF/ADAMTS13 is associated with on-aspirin residual platelet reactivity and clinical outcome in patients with stable coronary artery disease

BackgroundThe mechanisms behind residual platelet reactivity (RPR) despite aspirin treatment are not established. It has been shown that coronary artery disease (CAD) patients with high on-aspirin RPR have elevated levels of von Willebrand factor (vWF). ADAMTS13 is a metalloprotease cleaving ultra large vWF multimers into less active fragments.Our aim was to investigate whether ADAMTS13 and vWF/ADAMTS13 ratio were associated with high RPR, and further with clinical endpoints after 2 years.MethodsStable aspirin-treated CAD patients (n = 999) from the ASCET trial. RPR was assessed by PFA-100. ADAMTS13 antigen and activity were analysed using chromogenic assays. Endpoints were a composite of acute myocardial infarction, stroke and death.ResultsThe number of patients with high RPR was 258 (25.8%). Their serum thromboxane B2 (TxB2) levels were low, indicating inhibition of COX-1. They had significantly lower levels of ADAMTS13 antigen compared to patients with low RPR (517 vs 544 ng/mL, p = 0.001) and significantly lower ADAMTS13 activity (0.99 vs 1.04 IU/mL, p = 0.020). The differences were more pronounced when relating RPR to ratios of vWF/ADAMTS13 antigen and vWF/ADAMTS13 activity (p < 0.001, both). We found an inverse correlation between vWF and ADAMTS13 antigen (r = −0.14, p < 0.001) and ADAMTS13 activity (r = −0.11, p < 0.001). No correlations between TxB2 and ADAMTS13 antigen or activity, were observed, implying that ADAMTS13 is not involved in TxB2 production. Patients who experienced endpoints (n = 73) had higher vWF level (113 vs 105%, p = 0.032) and vWF/ADAMTS13 antigen ratio (0.23 vs 0.20, p = 0.012) compared to patients without. When dichotomizing vWF/ADAMTS13 antigen at median level we observed that patients above median had higher risk for suffering endpoints, with an adjusted OR of 1.86 (95% CI 1.45, 2.82).ConclusionThese results indicate that ADAMTS13 is of importance for RPR, and that it in combination with vWF also is associated with clinical endpoints in stable CAD patients on aspirin.Trial registrationClinicaltrials.gov NCT00222261. Registered 13.09.2005. Retrospectively registered.

Left Ventricular Assist Device Design Reduces von Willebrand Factor Degradation: A Comparative Study Between the HeartMate II and the EVAHEART Left Ventricular Assist System

Supraphysiologic shear stress from continuous-flow left ventricular assist devices (LVADs) accelerates von Willebrand factor (vWF) degradation and predisposes patients to nonsurgical bleeding. It is unknown whether unique design characteristics of LVADs differentially affect vWF degradation. We tested the hypothesis that the centrifugal-flow EVAHEART (Evaheart, Houston, TX) left ventricular assist system (LVAS), which was designed to minimize shear stress (low operational revolutions per minute [rpm], larger flow gaps, low shear stress, flat H-Q curve), reduced vWF degradation versus the axial-flow HeartMate II (Thoratec, Pleasanton, CA) LVAD. Whole human blood was obtained from volunteer donors (n= 22). Blood was circulated for 12 hours in mock circulatory loops through a HeartMate II (n= 10; 11,400 rpm, 6.3 ± 0.8 L/min, 76 ± 2 mm Hg) or an EVAHEART LVAS (n= 12; 2,300 rpm, 5.7 ± 0.1 L/min, 80± 1 mm Hg). vWF degradation was characterized with electrophoresis and immunoblotting for large vWF multimers and 11 vWF degradation fragments. The HeartMate II eliminated large vWF multimers and significantly (p < 0.05) increased 10 of 11 vWF degradation fragments at 6 and 12 hours. The increase was approximately 2.0-fold at 6 hours and 2.2-fold at 12 hours. In contrast, the EVAHEART LVAS modestly reduced large vWF multimers and significantly increased 5 of 11 and 8 of 11 vWF degradation fragments at 6 and 12 hours, respectively. The increase was approximately 1.5-fold at 6 hours and 1.7-fold at 12 hours. The EVAHEART LVAS caused significantly less degradation (p < 0.01) than the HeartMate II of the 140 kDa vWF fragment (cleavage product of ADAMTS-13, the vWF protease). The EVAHEART LVAS caused significantly less vWF degradation than the HeartMate II in a mock circulatory loop with whole human blood. LVAD design features may minimize vWF degradation. These data may inform the design and operation of next-generation LVADs to minimize blood trauma.