Large Consanguineous Pakistani Family Research Articles

Identification of novel homozygous variants in FOXE3 and AP4M1 underlying congenital syndromic anophthalmia and microphthalmia.

Anophthalmia and microphthalmia are severe developmental ocular disorders that affect the size of the ocular globe and can be unilateral or bilateral. The disease is found in syndromic as well as non-syndromic forms. It is genetically caused by chromosomal aberrations, copy number variations and single gene mutations, along with non-genetic factors such as viral infections, deficiency of vitamin A and an exposure to alcohol or drugs during pregnancy. To date, more than 30 genes having different modes of inheritance patterns are identified as causing anophthalmia and microphthalmia. In the present study, a clinical and genetic analysis was performed of six patients with anophthalmia and microphthalmia and/or additional phenotypes of intellectual disability, developmental delay and cerebral palsy from a large consanguineous Pakistani family. Whole exome sequencing followed by data analysis for variants prioritization and validation through Sanger sequencing was performed to identify the disease causing variant(s). American College of Medical Genetics and Genomics (ACMG) guidelines were applied to classify clinical interpretation of the prioritized variants. Clinical investigations revealed that the affected individuals are afflicted with anophthalmia. Three of the patients showed additional phenotype of intellectual disability, developmental delays and other neurological symptoms. Whole exome sequencing of the DNA samples of the affected members in the family identified a novel homozygous stop gain mutation (NM_012186: c.106G>T: p.Glu36*) in Forkhead Box E3 (FOXE3) gene shared by all affected individuals. Moreover, patients segregating additional phenotypes of spastic paraplegia, intellectual disability, hearing loss and microcephaly showed an additional homozygous sequence variant (NM_004722: c.953G>A: p.Arg318Gln) in AP4M1. Sanger sequencing validated the correct segregation of the identified variants in the affected family. ACMG guidelines predicted the variants to be pathogenic. We have investigated first case of syndromic anophthalmia caused by variants in the FOXE3 and AP4M1. The present findings are helpful for understanding pathological role of the mutations of the genes in syndromic forms of anophthalmia. Furthermore, the study signifies searching for the identification of second variant in families with patients exhibiting variable phenotypes. In addition, the findings will help clinical geneticists, genetic counselors and the affected family with respect to prenatal testing, family planning and genetic counseling.

Syntaxin 4 is essential for hearing in human and zebrafish.

Congenital hearing impairment (HI) is a genetically highly heterogeneous disorder in which prompt recognition and intervention are crucial to optimize outcomes. In this study, we used exome sequencing to investigate a large consanguineous Pakistani family with eight affected individuals showing bilateral severe-to-profound HI. This identified a homozygous splice region variant in STX4 (c.232 + 6T>C), which causes exon skipping and a frameshift, that segregated with HI (two-point logarithm of odds (LOD) score = 5.9). STX4, a member of the syntaxin family, is a component of the SNARE machinery involved in several vesicle transport and recycling pathways. In silico analysis showed that murine orthologue Stx4a is highly and widespread expressed in the developing and adult inner ear. Immunofluorescent imaging revealed localization of STX4A in the cell body, cell membrane and stereocilia of inner and outer hair cells. Furthermore, a morpholino-based knockdown of stx4 in zebrafish showed an abnormal startle response, morphological and developmental defects, and a disrupted mechanotransduction function in neuromast hair cells measured via FM1-43 uptake. Our findings indicate that STX4 dysfunction leads to HI in humans and zebrafish and supports the evolutionary conserved role of STX4 in inner ear development and hair cell functioning.

Exome sequencing reveals the first intragenic deletion in ABCA5 underlying autosomal recessive hypertrichosis.

Hereditary hypertrichosis (HH) is characterized by excessive hair growth on various body areas, which is independent of the individual's age. This rare hair disorder has been classified by its origin (genetic or acquired), age of onset, breadth of hair distribution (universal or localized) and the affected body areas. HH is often linked to several additional congenital abnormalities involving teeth, heart and bones. Human HH is associated with heterozygous genomic duplications and deletions in the chromosomal region 17q24.2-q24.3, containing genes such as ABCA5, ABCA6, ABCA10 and MAP2K6. Recently, a homozygous splice-site variant in ABCA5 has been reported to cause autosomal recessive congenital generalized hypertrichosis terminalis (CGHT; OMIM 135400). To investigate the clinical and genetic basis of autosomal recessive hypertrichosis in a large consanguineous Pakistani family. In the present study, we characterized a family of Pakistani origin segregating CGHT in an autosomal recessive pattern, using whole exome sequencing followed by Sanger sequencing RESULTS: We identified a novel 2-bp intragenic deletion [NM_172232.4(ABCA5);c.977_978delAT] causing a frameshift variant (p.His326ArgfsTer5) in ABCA5. To our knowledge, this is the first intragenic deletion in ABCA5 underlying CGHT. The findings further validate the involvement of ABCA5 in hair development. The study will facilitate genetic counselling of families carrying CGHT-related features in Pakistani and other populations.

Delineating the Molecular and Phenotypic Spectrum of the CNGA3-Related Cone Photoreceptor Disorder in Pakistani Families.

Cone photoreceptor dysfunction represents a clinically heterogenous group of disorders characterized by nystagmus, photophobia, reduced central or color vision, and macular dystrophy. Here, we described the molecular findings and clinical manifestations of achromatopsia, a partial or total absence of color vision, co-segregating with three known missense variants of CNGA3 in three large consanguineous Pakistani families. Fundus examination and optical coherence tomography (OCT) imaging revealed myopia, thin retina, retinal pigment epithelial cells loss at fovea/perifovea, and macular atrophy. Combination of Sanger and whole exome sequencing revealed three known homozygous missense variants (c.827A>G, p.(Asn276Ser); c.847C>T, p.(Arg283Trp); c.1279C>T, p.(Arg427Cys)) in CNGA3, the α-subunit of the cyclic nucleotide-gated cation channel in cone photoreceptor cells. All three variants are predicted to replace evolutionary conserved amino acids, and to be pathogenic by specific in silico programs, consistent with the observed altered membrane targeting of CNGA3 in heterologous cells. Insights from our study will facilitate counseling regarding the molecular and phenotypic landscape of CNGA3-related cone dystrophies.

Identification of Frameshift Variants in POLH Gene Causing Xeroderma Pigmentosum in Two Consanguineous Pakistani Families.

Xeroderma pigmentosum (XP) is a rare autosomal recessive genetic disorder characterized by severe sensitivity of skin to sunlight and an increased risk of skin cancer. XP variant (XPV), a milder subtype, is caused by variants in the POLH gene. POLH encodes an error-prone DNA-polymerase eta (pol eta) which performs translesion synthesis past ultraviolet photoproducts. The current study documents the clinical and genetic investigations of two large consanguineous Pakistani families affected with XPV. In family 1, whole exome sequencing (WES) revealed a novel frameshift variant, c.1723dupG (p.(Val575Glyfs*4)), of POLH, which is predicted to cause frameshift and premature truncation of the encoded enzyme. Indeed, our ex vivo studies in HEK293T cells confirmed the truncation of the encoded protein due to the c.1723dupG variant. In family 2, Sanger sequencing of POLH exons, revealed a recurrent nonsense variant, c.437dupA (p.Tyr146*). POLH forms a hetero-tetrameric POLZ complex with REV3L, REV7, POLD2 and POLD3. Next, we performed in silico analysis of POLH and other POLZ complex genes expression in publicly available single cell mRNAseq datasets from adult human healthy and aging skin. We found overlapping expression of POLH, REV3L and POLD2 in multiple cell types including differentiated and undifferentiated keratinocytes, pericytes and melanocytes in healthy skin. However, in aging human skin, POLH expression is reduced in compare to its POLZ complex partners. Insights from our study will facilitate counseling regarding the molecular and phenotypic landscape of POLH-related XPV.

Exome sequencing of a Pakistani family with spastic paraplegia identified an 18 bp deletion in the cytochrome B5 domain of FA2H

ABSTRACT Hereditary spastic paraplegias (HSPs) are a diverse class of neurodegenerative disorders that mainly affect the corticospinal tract of the body and result in various clinical conditions such as lower limb spasticity and muscle weakness in the lower extremities. Worldwide, more than 70 chromosomal loci/genes have been reported to be associated with HSPs, out of which, six genes viz., ATL1, FA2H, GJC2, AP4E1, ALDH18A1 and ATP13A2 have been mapped in Pakistani families. In the present genetic study, we report on a large consanguineous Pakistani family with a complex form of HSP segregating with a 18 bp deletion in the first exon of the Fatty Acid 2-Hydroxylase (FA2H) gene (NM_024306.5:c.159_176del). The identified in-frame deletion results in loss of six amino acids (p.Arg53_Ile58del) within the cytochrome B5 domain of the protein. FA2H is required for alpha-hydroxylation of free fatty acids to form alpha-hydroxylated sphingolipids. Its cytochrome b5-like heme-binding domain, which spans from residues 15 to 85, imparts the redox activity to FA2H. This mutation has previously been reported in a Pakistani family presenting with a similar form of complex HSP. Together with our findings the pathogenic role of the observed variant is further supported. Mutation studies on additional Pakistani families for FA2H will further elucidate its mutational spectrum, which may help in developing a prenatal diagnostic test for Khyber Pakhtunkhwa resident Pakistani families.

Identification and computational analysis of USH1C, and SLC26A4 variants in Pakistani families with prelingual hearing loss.

Hearing loss (HL) is clinically and genetically heterogeneous disorder and is the most frequent occurring sensory deficit in humans. This study was conducted to decipher the genetic cause of HL occurring in two large consanguineous Pakistani families (GCNF-01, GCNF-03). Family history and pure tone audiometry of both families suggested prelingual HL, while the affected individuals of GCNF-01 also had low vision and balance problems, consistent with cardinal features of Usher syndrome type I (USH1). Exome sequencing followed by segregating analysis revealed a novel splice site variant (c.877-1G > A) of USH1C occurring with USH1 phenotype in family GCNF01. While the affected individual of family GCNF-03 were homozygous for the c.716T > A, p.(Val239Asp) previously reported pathogenic variant of SLC26A4. Both variants have very low frequencies in control database. In silico mutagenesis and 3-dimensional simulation analyses revealed that both variants have deleterious impact on the proteins folding and secondary structures. Our study expands the mutation spectrum of the HL genes and emphasizes the utility of exome sequencing coupled with bioinformatics tools for clinical genetic diagnosis, prognosis, and family counseling.

Pathogenic variants of AIPL1, MERTK, GUCY2D, and FOXE3 in Pakistani families with clinically heterogeneous eye diseases.

Significant number out of 2.2 billion vision impairments in the world can be attributed to genetics. The current study is aimed to decipher the genetic basis of Leber congenital Amaurosis (LCA), Anterior Segment dysgenesis (ASD), and Retinitis Pigmentosa (RP), segregating in four large consanguineous Pakistani families. The exome sequencing followed by segregation analysis via Sanger sequencing revealed the LCA phenotypes segregating in families GCUF01 and GCUF04 can be attributed to c.465G>T (p.(Gln155His)) missense and novel c.139_140delinsA p.(Pro47Trhfster38) frameshift variant of AIPL1 and GUCY2D, respectively. The c.1843A>T (p.(Lys615*) truncating allele of MERTK is homozygous in all the affected individuals, presumably suffering with RP, of the GCUF02 family. Meanwhile, co-segregation of the ASD phenotype and the c.289A>G (p.(Ile97Val)) variant of FOXE3 was found in the GCUF06 family. All the identified variants were either absent or present in very low frequencies in the control databases. Our in-silico analyses and 3D molecular modeling support the deleterious impact of these variants on the encoded proteins. Variants identified in MERTK, GUCY2D, and FOXE3 were categorized as “pathogenic” or “likely pathogenic”, while the missense variant found in AIPL1 was deemed to have “uncertain significance” based upon the variant pathogenicity guidelines from the American College of Medical Genetics and Genomics (ACMG). This paper highlights the genetic diversity of vision disorders in the Pakistani population and reports the identification of four novel mutations in families who segregate clinically heterogeneous eye diseases. Our results give insight into the genotype-phenotype correlations of AIPL1, FOXE3, MERTK, and GUCY2D variants.

Molecular characterization of SLC24A5 variants and evaluation of Nitisinone treatment efficacy in a zebrafish model of OCA6.

Skin pigmentation is a highly heterogeneous trait with diverse consequences worldwide. SLC24A5, encoding a potent K+ -dependent Na+ /Ca2+ exchanger, is among the known color-coding genes that participate in melanogenesis by maintaining pH in melanosomes. Deficient SLC24A5 activity results in oculocutaneous albinism (OCA) type 6 in humans. In this study, by utilizing a exome sequencing (ES) approach, we identified two new variants [p. (Gly110Arg) and p. (IIe189Ilefs*1)] of SLC24A5 cosegregating with the OCA phenotype, including nystagmus, strabismus, foveal hypoplasia, albinotic fundus, and vision impairment, in three large consanguineous Pakistani families. Both of these variants failed to rescue the pigmentation in zebrafish slc24a5 morphants, confirming the pathogenic effects of the variants. We also phenotypically characterized a commercially available zebrafish mutant line (slc24a5ko ) that harbors a nonsense (p.Tyr208*) allele of slc24a5. Similar to morphants, homozygous slc24a5ko mutants had significantly reduced melanin content and pigmentation. Next, we used these slc24a5ko zebrafish mutants to test the efficacy of nitisinone, a compound known to increase ocular and fur pigmentation in OCA1 (TYR) mutant mice. Treatment of slc24a5ko mutant zebrafish embryos with varying doses of nitisinone did not improve melanin production and pigmentation, suggesting that treatment with nitisinone is unlikely to be therapeutic in OCA6 patients.

Genetic mapping of autosomal recessive microspherophakia to chromosome 14q24.3 in a consanguineous Pakistani family and screening of exon 36 of LTBP2 gene

Latent transforming growth factor beta binding protein 2 (LTBP2) plays a critical role in the development of connective tissue structure and function. Mutations in gene encoding LTBP2 are known to cause syndromic and a non-syndromic microspherophakia. Here, we present a 'first' report of genetic linkage of microspherophakia (MSP) to LTBP2 locus in a large consanguineous Pakistani family with four affected individuals in three loops. Using polymorphic microsatellite markers, haplotypes and linkage analysis, the diseased phenotype in MSP001 family was mapped to the LTBP2 gene. A maximum two point Logarithm of the odds (LOD) score of 4.16 was obtained with marker D14S284 at θ =0. Mutational analysis of exon 36 of LTBP2 using Sanger's sequencing did not reveal any previously reported mutations. Further analysis of the remaining exons are required to identify the causative variant.

Genetic Testing of a Large Consanguineous Pakistani Family Affected with Mucolipidosis III Gamma Through Next-Generation Sequencing.

Mucolipidosis III gamma (MLIIIγ) is a rare autosomal recessive disorder characterized by radiographic evidence of mild-to-moderate dysostosis multiplex, progressive joint stiffness and pain, scoliosis, and normal to mildly impaired cognitive development. Cardiac valve involvement and respiratory complications can be significant. MLIIIγ is caused by mutations in the GNPTG, which encodes the γ subunit of the enzyme N-acetylglucosamine-1-phosphotransferase. Clinical and genetic study of seven individuals of a consanguineous Pakistani family affected with mucolipidosis phenotype who never pursued medical care. Genome-wide homozygosity mapping was performed using Affymetrix Human SNP Array 6.0 followed by whole exome and Sanger sequencing. The affected individuals showed characteristic clinical features of MLIIIγ. Whole-genome single nucleotide polymorphism genotyping identified a region of homozygosity shared by affected individuals of the family on chromosome 16p13.3. Whole exome sequencing identified a novel 4-bp deletion in the GNPTG segregating in the family in agreement with autosomal recessive pattern. We identified a novel mutation in the GNPTG gene as the underlying cause of MLIIIγ in a Pakistani family. This study supports the role of next-generation sequencing technologies for the molecular diagnosis of rare inherited disorders.

Identification of novel L2HGDH mutation in a large consanguineous Pakistani family- a case report

BackgroundL-2-hydroxyglutaric aciduria (L2HGA) is a progressive neurometabolic disease of brain caused by mutations of in L-2-hydroxyglutarate dehydrogenase (L2HGDH) gene. Cardinal clinical features include cerebellar ataxia, epilepsy, neurodevelopmental delay, intellectual disability, and other clinical neurological deficits.Case presentationWe describe an index case of the family presented with generalised tonic-clonic seizure, developmental delay, intellectual disability, and ataxia. Initially, the differential diagnosis was difficult to be established and a SNP genome wide scan identified the candidate region on chromosome 14q22.1. DNA sequencing showed a novel homozygous mutation in the candidate gene L2HGDH (NM_024884.2: c.178G > A; p.Gly60Arg). The mutation p.Gly60Arg lies in the highly conserved FAD/NAD(P)-binding domain of this mitochondrial enzyme, predicted to disturb enzymatic function.ConclusionsThe combination of homozygosity mapping and DNA sequencing identified a novel mutation in Pakistani family with variable clinical features. This is second report of a mutation in L2HGDH gene from Pakistan and the largest family with L2HGA reported to date.

Delineation of Novel Autosomal Recessive Mutation in GJA3 and Autosomal Dominant Mutations in GJA8 in Pakistani Congenital Cataract Families.

Congenital cataract is a clinically and genetically heterogeneous disease. The present study was undertaken to find the genetic cause of congenital cataract families. DNA samples of a large consanguineous Pakistani family were genotyped with a high resolution single nucleotide polymorphism Illumina microarray. Homozygosity mapping identified a homozygous region of 4.4 Mb encompassing the gene GJA3. Sanger sequence analysis of the GJA3 gene revealed a novel homozygous variant c.950dup p.(His318ProfsX8) segregating in an autosomal recessive (AR) manner. The previously known mode of inheritance for GJA3 gene mutations in cataract was autosomal dominant (AD) only. The screening of additional probands (n = 41) of cataract families revealed a previously known mutation c.56C>T p.(Thr19Met) in GJA3 gene. In addition, sequencing of the exon-intron boundaries of the GJA8 gene in 41 cataract probands revealed two additional mutations: a novel c.53C>T p.(Ser18Phe) and a known c.175C>G p.(Pro59Ala) mutation, both co-segregating with the disease phenotype in an AD manner. All these mutations are predicted to be pathogenic by in silico analysis and were absent in the control databases. In conclusion, results of the current study enhance our understanding of the genetic basis of cataract, and identified the involvement of the GJA3 in the disease etiology in both AR and AD manners.

Identification of a Novel Nonsense ASPM Mutation in a Large Consanguineous Pakistani Family Using Targeted Next-Generation Sequencing.

To identify the pathogenic mutation underlying microcephaly primary hereditary (MCPH) in a large consanguineous Pakistani family. A five-generation family with an autosomal recessive transmission of MCPH was recruited. Targeted next-generation DNA sequencing was carried out to analyze the genomic DNA sample from the proband with MCPH using a previously designed panel targeting 46 known microcephaly-causing genes. Sanger sequencing was performed to verify all identified variants. We found a novel homozygous nonsense mutation, c.7543C>T, in the ASPM gene. This mutation led to the substitution of an arginine with a stop codon at amino acid residue 2515 (p.Arg2515Ter). The mutation cosegregated with the MCPH phenotype in all affected and obligate carrier family members, but was not present in public databases (dbSNP147, Exome Variant Server, the 1000 Genomes Project, Exome Aggregation Consortium, Human Gene Mutation Database, and ClinVar) or 200 control individuals. The c.7543C>T mutation in ASPM may activate nonsense-mediated mRNA decay pathways and could underlie the pathogenesis of MCPH through a loss-of-function mechanism. The c.7543C>T (p.Arg2515Ter) mutation in ASPM is a novel pathogenic mutation for the typical MCPH phenotype in this family.

Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy.

Objectives:To identify the underlying gene mutation in a large consanguineous Pakistani family.Methods:This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool.Results:Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM) like elevated serum creatine kinase (CK) levels, distal muscle weakness, myopathic changes in electromyography (EMG) and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT) in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X), which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein.Conclusion:A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X) in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

A novel missense mutation in cathepsin K (CTSK) gene in a consanguineous Pakistani family with pycnodysostosis.

Deficiency of cathepsin K (CTSK), a lysosomal cysteine protease, has been shown earlier as a cause of an autosomal recessive osteosclerotic skeletal dysplasia pycnodysostosis. The objective of the present study was to identify the potential sequence variants in CTSK gene in a large consanguineous Pakistani family with pycnodysostosis. Genotyping of 4 affected and 6 unaffected members of the family was performed using polymorphic microsatellite markers linked to CTSK gene on chromosome 1q21. To screen for pathogenic mutation, exons and splice junctions of CTSK gene were polymerase chain reaction amplified from genomic DNA and sequenced directly in an automated DNA sequencer. Microsatellite analysis showed linkage of the family to CTSK gene on chromosome 1q21. Sequence analysis revealed a novel missense mutation c.728G>A (p.G243E) in exon 6 of the CTSK gene. A novel missense mutation was identified in CTSK gene in a Pakistani family with 5 individuals affected with autosomal recessive pycnodysostosis.

A novel splice-site mutation in ALS2 establishes the diagnosis of juvenile amyotrophic lateral sclerosis in a family with early onset anarthria and generalized dystonias.

The diagnosis of childhood neurological disorders remains challenging given the overlapping clinical presentation across subgroups and heterogeneous presentation within subgroups. To determine the underlying genetic cause of a severe neurological disorder in a large consanguineous Pakistani family presenting with severe scoliosis, anarthria and progressive neuromuscular degeneration, we performed genome-wide homozygosity mapping accompanied by whole-exome sequencing in two affected first cousins and their unaffected parents to find the causative mutation. We identified a novel homozygous splice-site mutation (c.3512+1G>A) in the ALS2 gene (NM_020919.3) encoding alsin that segregated with the disease in this family. Homozygous loss-of-function mutations in ALS2 are known to cause juvenile-onset amyotrophic lateral sclerosis (ALS), one of the many neurological conditions having overlapping symptoms with many neurological phenotypes. RT-PCR validation revealed that the mutation resulted in exon-skipping as well as the use of an alternative donor splice, both of which are predicted to cause loss-of-function of the resulting proteins. By examining 216 known neurological disease genes in our exome sequencing data, we also identified 9 other rare nonsynonymous mutations in these genes, some of which lie in highly conserved regions. Sequencing of a single proband might have led to mis-identification of some of these as the causative variant. Our findings established a firm diagnosis of juvenile ALS in this family, thus demonstrating the use of whole exome sequencing combined with linkage analysis in families as a powerful tool for establishing a quick and precise genetic diagnosis of complex neurological phenotypes.

Identification of a homozygous splice site mutation in the dynein axonemal light chain 4 gene on 22q13.1 in a large consanguineous family from Pakistan with congenital mirror movement disorder.

Mirror movements (MRMV) are involuntary movements on one side of the body that mirror voluntary movements on the opposite side. Congenital mirror movement disorder is a rare, typically autosomal-dominant disorder, although it has been suspected that some sporadic cases may be due to recessive inheritance. Using a linkage analysis and a candidate gene approach, two genes have been implicated in congenital MRMV disorder to date: DCC on 18q21.2 (MRMV1), which encodes a netrin receptor, and RAD51 on 15q15.1 (MRMV2), which is involved in the maintenance of genomic integrity. Here, we describe a large consanguineous Pakistani family with 11 cases of congenital MRMV disorder reported across five generations, with autosomal recessive inheritance likely. Sanger sequencing of DCC and RAD51 did not identify a mutation. We then employed microarray genotyping and autozygosity mapping to identify a shared region of homozygosity-by-descent among the affected individuals. We identified a large autozygous region of ~3.3 Mb on chromosome 22q13.1 (Chr22:36605976-39904648). We used Sanger sequencing to exclude several candidate genes within this region, including DMC1 and NPTXR. Whole exome sequencing was employed, and identified a splice site mutation in the dynein axonemal light chain 4 gene, DNAL4. This splice site change leads to skipping of exon 3, and omission of 28 amino acids from DNAL4 protein. Linkage analysis using Simwalk2 gives a maximum Lod score of 6.197 at this locus. Whether or how DNAL4 function may relate to the function of DCC or RAD51 is not known. Also, there is no suggestion of primary ciliary dyskinesis, situs inversus, or defective sperm in affected family members, which might be anticipated given a putative role for DNAL4 in axonemal-based dynein complexes. We suggest that DNAL4 plays a role in the cytoplasmic dynein complex for netrin-1-directed retrograde transport, and in commissural neurons of the corpus callosum in particular. This, in turn, could lead to faulty cross-brain wiring, resulting in MRMV.

Homozygous missense variant in the human CNGA3 channel causes cone-rod dystrophy.

We assessed a large consanguineous Pakistani family (PKAB157) segregating early onset low vision problems. Funduscopic and electroretinographic evaluation of affected individuals revealed juvenile cone-rod dystrophy (CRD) with maculopathy. Other clinical symptoms included loss of color discrimination, photophobia and nystagmus. Whole-exome sequencing, segregation and haplotype analyses demonstrated that a transition variant (c.955T>C; p.(Cys319Arg)) in CNGA3 co-segregated with the CRD phenotype in family PKAB157. The ability of CNGA3 channel to influx calcium in response to agonist, when expressed either alone or together with the wild-type CNGB3 subunit in HEK293 cells, was completely abolished due to p.Cys319Arg variant. Western blotting and immunolocalization studies suggest that a decreased channel density in the HEK293 cell membrane due to impaired folding and/or trafficking of the CNGA3 protein is the main pathogenic effect of the p.Cys319Arg variant. Mutant alleles of the human cone photoreceptor cyclic nucleotide-gated channel (CNGA3) are frequently associated with achromatopsia. In rare cases, variants in CNGA3 are also associated with cone dystrophy, Leber's congenital amaurosis and oligo cone trichromacy. The identification of predicted p.(Cys319Arg) missense variant in CNGA3 expands the repertoire of the known genetic causes of CRD and phenotypic spectrum of CNGA3 alleles.

A missense mutation in the PISA domain of HsSAS-6 causes autosomal recessive primary microcephaly in a large consanguineous Pakistani family.

Asymmetric cell division is essential for normal human brain development. Mutations in several genes encoding centrosomal proteins that participate in accurate cell division have been reported to cause autosomal recessive primary microcephaly (MCPH). By homozygosity mapping including three affected individuals from a consanguineous MCPH family from Pakistan, we delineated a critical region of 18.53 Mb on Chromosome 1p21.3-1p13.1. This region contains the gene encoding HsSAS-6, a centrosomal protein primordial for seeding the formation of new centrioles during the cell cycle. Both next-generation and Sanger sequencing revealed a homozygous c.185T>C missense mutation in the HsSAS-6 gene, resulting in a p.Ile62Thr substitution within a highly conserved region of the PISA domain of HsSAS-6. This variant is neither present in any single-nucleotide polymorphism or exome sequencing databases nor in a Pakistani control cohort. Experiments in tissue culture cells revealed that the Ile62Thr mutant of HsSAS-6 is substantially less efficient than the wild-type protein in sustaining centriole formation. Together, our findings demonstrate a dramatic impact of the mutation p.Ile62Thr on HsSAS-6 function and add this component to the list of genes mutated in primary microcephaly.